Method for in situ quantitative detection of target protein-specific glycosylation based on double probes

By employing dual-probe binding and DNA enzyme cleavage techniques, rapid and accurate quantitative detection of proteins in cells has been achieved, solving the problem of quantitative detection of protein-specific glycosylation in existing technologies and providing more comprehensive clinical information.

CN116087524BActive Publication Date: 2026-02-13ZHONGNAN HOSPITAL OF WUHAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210908561.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-29
Publication Date
2026-02-13
Estimated Expiration
2042-07-29

AI Technical Summary

Technical Problem

Existing technologies struggle to quantitatively detect protein-specific glycosylation without interfering with cells, especially when using mass spectrometry, which suffers from low glycosylation efficiency and poor fluorescence signal interference resistance.

Method used

A dual-probe-based approach was adopted, in which protein probes and glycan probes were combined to form a hybrid double strand. The glycan probes were then enzymatically cleaved by DNase under the action of a metal cofactor, and the released reporter peptides were quantitatively analyzed by mass spectrometry, converting the protein-specific glycoform signal into a mass spectrometry signal.

Benefits of technology

It enables rapid and accurate quantitative detection of protein-specific glycoforms in living cells, providing more comprehensive clinical information. It is suitable for detecting terminal-specific glycans on specific membrane proteins, especially the sialic acid expression of the MUC1 protein.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116087524B_ABST
    Figure CN116087524B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biological detection, in particular to a method for in-situ quantitative detection of specific glycosylation of target protein based on double probes. The method provided by the application comprises the following steps: a protein probe and a glycan probe are used to combine with target protein and target glycan respectively, and the spatial proximity relationship after combination triggers hybridization between the probes on the same target protein to form hybrid double strands; the DNA enzyme of the protein probe is used to enzymatically cut the glycan probe on the hybrid double strands under the action of a metal cofactor; and the report peptide released after enzymatic cutting of the glycan probe is subjected to mass spectrometric quantitative analysis, so that the signal of protein-specific glycoform is converted into a mass spectrometric signal.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, in particular to a method for in situ quantitative detection of specific glycosylation of target protein based on double probes. BACKGROUND

[0002] Glycosylation is a complex and important post-translational modification of proteins in living organisms, which plays an irreplaceable role in reflecting the physiological and pathological state of cells. Glycosylation patterns, especially in membrane proteins, are finely controlled by a variety of glycosyltransferases and are involved in a series of cellular processes, including communication, migration and transport. In the past few decades, abnormal glycosylation has been widely recognized as a marker of physiological imbalance, suggesting the occurrence of various diseases. Recent studies have shown that the main factor leading to malignant transformation of diseases is the glycosylation of certain proteins, rather than the overall level of glycosylation in cells. Therefore, quantitative monitoring of changes in protein-specific glycosylation is of great significance for revealing the molecular mechanisms of cancer-related diseases and providing diagnostic and prognostic information.

[0003] Currently, there are mainly two methods for detecting protein-specific glycoforms. One of the methods involves enzyme pretreatment, which uses a variety of techniques to separate proteins and directly detects glycans based on mass spectrometry (MS). The process is cumbersome. Although MS is widely used in glycomics research, there are still some important technical obstacles that cannot be avoided, such as weak ionization efficiency of glycosyl and complex matrix effect of biological samples. More importantly, this method destroys the integrity of cells, which may lead to the loss of some important biological information. In contrast, the other method centered on spatial proximity pairing technology combined with fluorescence imaging can study protein-specific glycosylation in living cells in situ. The core principle is to construct a receptor (usually an aptamer) selective for the target protein, and a molecular beacon that can attach to specific glycoforms such as selective lectins or metabolically engineered glycans. This method is limited by low affinity of lectins, unsatisfactory efficiency of metabolic labeling, poor anti-interference ability of fluorescence signal, etc. Since subtle changes in protein-specific glycosylation expression can reflect different disease states and prognostic effects, it is worth exploring to develop a method for quantitative and sensitive detection in living cells.

[0004] The method based on MS direct determination is not suitable for quantitative detection of protein-specific glycoforms without interfering with cells. The prior art realizes the quantification of several biomarkers such as miRNAs by MS through the introduction of a carefully designed exogenous polypeptide to transform the undetectable signal. However, this method cannot simultaneously obtain the information of the target protein and the target glycan for the quantification of protein-specific glycoforms. The most important difficulty is how to transform the abstract glycan information into intuitive mass spectrometry signals without interference.

[0005] Therefore, it is important to provide a method capable of quantitatively detecting protein-specific glycoforms to overcome the defects in the prior art. SUMMARY

[0006] The present application provides a method for in situ quantitative detection of target protein-specific glycosylation based on double probes to solve the problems in the prior art.

[0007] In a first aspect, the present application provides a method for in situ quantitative detection of target protein-specific glycosylation based on double probes, comprising:

[0008] The protein probe PP and the glycan probe GP are combined with the target protein and the corresponding target glycan, and the spatial proximity relationship after the combination triggers hybridization between the probes on the same target protein to form hybrid double-stranded DNA;

[0009] The DNA enzyme of the protein probe cleaves the glycan probe on the hybrid double-stranded DNA under the action of a metal cofactor;

[0010] The report peptide released by the cleaved glycan probe is subjected to mass spectrometry quantitative analysis, so as to transform the signal of protein-specific glycoforms into a mass spectrometry signal.

[0011] In some embodiments, the oligonucleotide sequence of the protein probe is GCAGTTGATCCTTTGGATACCCTGGTTTTTTTTTATCTCATCTCCGAGCCGGTCGAAATAGTGACT.

[0012] In some embodiments, the oligonucleotide sequence of the glycan probe is TTTAGTCACTATrAGGATGAGATTTTTTTTTT.

[0013] In some embodiments, the preparation of the protein probe solution specifically comprises:

[0014] The protein probe is dissolved in diethyl pyrocarbonate-treated water to prepare a 50 μM stock solution, which is stored at -20°C;

[0015] For target protein recognition, the protein probe solution is dissolved in 5 mM Mg2+ PBS dilution and heated at 95 °C for 10 min, slowly annealed to 25 °C in a thermal cycler, kept at 25 °C for about 1 hour, and finally stored at 4 °C until use.

[0016] In some embodiments, the synthesis of the glycan probe specifically comprises:

[0017] The DNA sequence of the glycan probe contains a disulfide group at its 5' end, which is reduced by tris(2-carboxyethyl)phosphine to bind to the maleimide-modified substrate peptide; the DNA sequence of the glycan probe also contains a dibenzocyclooctyne (DBCO) group at its 3' end, which specifically binds to the aldehyde-modified target glycan with the help of a heterobifunctional functional crosslinker.

[0018] In some embodiments, the metal cofactor is selected from magnesium ions.

[0019] In some embodiments, the heterobifunctional functional crosslinker is selected from azide-PEG4-hydrazide hydrochloride.

[0020] In some embodiments, the binding of the protein probe and the glycan probe to their corresponding targets specifically comprises:

[0021] The aptamer of the protein probe recognizes and binds to the MUC1 protein;

[0022] The terminal sialic acid of the MUC1 protein is oxidized by periodate to introduce an aldehyde group; with the help of a heterobifunctional functional crosslinker, it is combined with the dibenzocyclooctane tag on the glycan probe.

[0023] In some embodiments, the above mass spectrometric quantitative analysis of the reporter peptide released by the enzyme-cleaved glycan probe specifically comprises:

[0024] The DNA enzyme of the protein probe can cleave all glycan probes bound to the target protein, and the reporter peptide produced by trypsin enzyme cleavage of the enzyme-cleaved glycan probe is subjected to mass spectrometric quantification.

[0025] In some embodiments, the DNA enzyme of the protein probe cleaves the glycan probe on the hybrid double strand with the help of Mg 2+

[0026] The protein probe returns to a single-stranded state and continues to participate in the next round of hybridization and enzyme cleavage with an intact structure; the DNA enzyme of the protein probe can be recycled to cleave all glycan probes bound to the target protein.

[0027] In some embodiments, when the target protein is a MUC1-specific glycoform in cells, the method specifically comprises:

[0028] ​MCF-7 and T47D cells (1 x 10 6 ) were collected in cell dissociation buffer without enzyme at exponential growth phase; cells were dispersed in binding buffer for 1 h to reduce non-specific adsorption of protein probes, incubated in 200 μL 1.25 μM protein probe solution at room temperature for 30 min; after washing cells with PBS, incubated with sodium metaperiodate and cross-linking agent at 37°C for 30 min and 1.5 h, respectively;

[0029] After washing cells with PBS, 200 μL of PBS containing glycan probes, 10 mM aniline and 5% fetal bovine serum were added, and incubated at 37°C; cells were carefully washed with PBS and redistributed in PBS solution containing Mg 2+ After washing cells with PBS 3 times, all supernatants combined with MUC1 terminal sialic acid were collected, and sequencing grade trypsin was added, and incubated at 37°C for 24 h to release reporter peptides; 10 μL of 0.1% trifluoroacetic acid was added to stop the reaction; after adding an internal standard, the polypeptide solution was desalted by a desalting chromatographic column, and determined by liquid chromatography-tandem mass spectrometry.

[0030] In some embodiments, the liquid chromatography-tandem mass spectrometry detection specifically comprises:

[0031] Sample analysis was performed using a Shimadzu LC-30A UPLC coupled with a Shimadzu LCMS-8050 triple quadrupole mass spectrometer; an Agilent SB C18 chromatographic column was used to separate the sample, and the column temperature was 40°C; the mobile phase A was 0.1% formic acid aqueous solution, and the mobile phase B was 0.1% formic acid methanol; the injection volume was 10 μL, and the elution flow rate was 0.3 mL / min; the elution gradient was: 0 min (10% mobile phase B)-1 min (10% mobile phase B)-5 min (60% mobile phase B)-8 min (60% mobile phase B)-9 min (10% mobile phase B)-10 min (10% mobile phase B), and the elution time was 10 min;

[0032] In some embodiments, the polypeptides were all operated in the positive ion mode of the electrospray ionization source; the potential energy and collision energy were adjusted to achieve ideal ionization according to the selected optimal ion pair; the electrospray ionization source conditions and MS parameters were set as follows: the ion source temperature and heating / driving gas flow were set to 350°C and 10 L / min, respectively; Q1 and Q3 were operated at unit resolution; the capillary voltage of the experiment was 4 kV, and the nebulizer pressure was 35 psi; data recording and analysis were completed.

[0033] After the protein probe and the glycan probe selectively bind to the target protein and the target glycan, the DNA enzyme in the protein probe can automatically cleave the glycan probe on the target protein under the control of the metal cofactor, and the report peptide generated by trypsin enzyme cleavage of the cleaved glycan probe is subjected to mass spectrometry quantification, thereby realizing the quantification of the protein-specific glycoform which is difficult to directly detect.

[0034] In the preferred scheme of the present application, the new design of the DNA enzyme motor precisely controls the switch drive through the metal cofactor, and widely applies the high sensitivity and specificity MS quantification technology, which can provide more comprehensive analysis information for the correlation between protein-specific glycoform and cancer progression.

[0035] The beneficial effects brought by the technical scheme provided by the present application include: in view of the universality of aptamer recognition and the chemical plasticity of glycosylation, the present application provides a promising quantitative tool which is theoretically applicable to detecting terminal-specific glycan on specific membrane proteins; the present application successfully constructs a recyclable DNA enzyme motor for in situ quantitative detection of MUC1-specific sialic acid. After the protein probe and the glycan probe selectively bind to the target protein and the target glycan, the DNA enzyme in the protein probe can automatically cleave the glycan probe on the MUC1 protein under the control of the metal cofactor. Then the report peptide generated by trypsin enzyme cleavage of the cleaved glycan probe is subjected to mass spectrometry quantification, thereby realizing the quantification of the protein-specific glycoform which is difficult to directly detect. The new design of the DNA enzyme motor precisely controls the switch drive through the metal cofactor, and widely applies the high sensitivity and specificity MS quantification technology, which can provide more comprehensive clinical information for the correlation between protein-specific glycoform and cancer progression. BRIEF DESCRIPTION OF DRAWINGS

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0037] Figure 1 is a schematic diagram of the recyclable DNA enzyme motor combined with mass spectrometry (MS) technology for in situ protein-specific glycoform quantification provided by the present application embodiment 1;

[0038] Figure 2 is a flowchart of the method for in situ quantitative detection of protein-specific glycosylation based on double probes provided by the present application embodiment 1;

[0039] Figure 3is a flowchart of the method for in situ quantitative detection of protein-specific glycosylation based on double probes provided by Embodiment 1 of the present application;

[0040] Figure 4 is a flowchart of the method for preparing a protein probe solution provided by the present application;

[0041] Figure 5 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0042] Figure 6 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0043] Figure 7 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0044] Figure 8 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0045] Figure 9 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0046] Figure 10 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0047] Figure 11 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0048] Figure 12 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0049] Figure 13 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0050] Figure 14 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application; 2+ is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0051] Figure 15 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0052] Figure 16 is a flowchart of the method for in situ quantitative detection of MUC1-specific glycoforms provided by the present application;

[0053] Figure 17 is the selectivity and specificity evaluation of the detection method provided by the embodiments of the present application;

[0054] Figure 18 is the calibration curve (50 μm to 10 nM) of the reporter peptide provided by the embodiments of the present application;

[0055] Figure 19 is the LOD (50 μm) of the reporter peptide and the LC-MS / MS chromatogram of the matrix blank provided by the embodiments of the present application. DETAILED DESCRIPTION

[0056] To make the objectives, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described below in detail with reference to the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application.

[0057] The embodiments of the present application provide a method for in situ quantitative detection of protein-specific glycosylation based on double probes, which can solve the problem that in the prior art, abstract glycan information cannot be converted into intuitive mass signals without disturbing cells.

[0058] The prior art such as direct mass spectrometry analysis and near-field induced fluorescence imaging analysis is limited by low glycosyl ionization efficiency and poor anti-interference ability of fluorescence signals. The research focus of the present application is to quantitatively determine protein-specific glycosylation in living cells without disturbing the original functions of the cells.

[0059] In the embodiments of the present application, a recyclable DNA enzyme motor is constructed, and MS technology is combined to use MUC1 binding terminal sialic acid as a model for in situ quantitative determination of protein-specific glycosylation, as shown in Figure 1 To this end, the present application designs two kinds of probes, a protein probe and a glycan probe. The protein probe comprises an aptamer that can specifically recognize MUC1 protein and a DNA enzyme, and the glycan probe comprises an oligonucleotide sequence partially complementary to the DNA enzyme sequence of the protein probe, a substrate peptide segment that can be enzymatically cleaved into a reporter peptide by trypsin, and a Dibenzocyclooctyne (DBCO) tag. The Dibenzocyclooctyne tag can be covalently connected to the aldehyde group generated by the oxidation of the terminal sialic acid with the help of a heterobifunctional functional group crosslinking agent. When the protein probe and the glycan probe are sequentially combined with the corresponding target protein, due to the close distance in space, the DNA enzyme on the protein probe can hybridize with the adjacent glycan probe attached to the same protein, and the DNA enzyme can cleave the glycan probe to release the reporter peptide under the action of a metal cofactor such as Mg2+ Subsequently, the protein probe returns to the single-stranded state and can freely participate in the next round of hybridization and cleavage on the three-dimensional track. Therefore, all adjacent glycan probes in the same protein can be cleaved. The reporter peptide released after the glycan probe is cleaved by trypsin is quantitatively analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS). In this way, the MUC1-specific sialic acid signal is ingeniously converted into the MS signal of the reporter peptide, thereby realizing rapid and accurate in situ quantitative detection of protein-specific glycoforms. After further optimization and improvement, this method is successfully used for in situ quantitative detection of MUC1-specific sialic acid in different breast cancer cell lines.

[0060] In addition, the technical features involved in each embodiment of the present application described below can be combined with each other as long as they do not conflict with each other.

[0061] Embodiment 1:

[0062] With reference to Figure 2 , the embodiment 1 of the present application provides a method for in situ quantitative detection of protein-specific glycosylation based on double probes, comprising the following steps:

[0063] In step S101, the protein probe and the glycan probe are combined with the target protein and the corresponding target glycan, and the spatial proximity after the combination triggers hybridization between the probes on the same target protein to form hybrid double strands. Taking the terminal sialic acid of MUC1 protein as an example, the combination of the protein probe and the glycan probe with the target protein and the corresponding target glycan is specifically as follows: the aptamer of the protein probe recognizes and combines with the MUC1 protein; the terminal sialic acid of the MUC1 protein is oxidized by periodate to introduce an aldehyde group; under the action of azide-PEG4-hydrazine hydrochloride, it is combined with the dibenzo cyclooctyne tag on the glycan probe.

[0064] As Figure 1 shown in the second layer structure diagram, in the left and right parts of the second layer structure diagram, there are hybrid double strands in which the DNA enzyme of the protein probe and the oligonucleotide sequence of the glycan probe are entangled together.

[0065] In step S102, the DNA enzyme of the protein probe cleaves the glycan probe on the hybrid double strand with the help of a metal cofactor.

[0066] As Figure 1 shown in the third layer structure diagram, it is an effect diagram after the corresponding glycan probe is cut off after the completion of the above step S102.

[0067] In the scenario where the protein-specific glycosylation is MUC1-specific sialic acid as exemplified in the subsequent schemes of the embodiments of the present application, the metal cofactor is preferably Mg2+ As a person skilled in the art, the optional range of metal cofactors should not be limited to Mg 2+ Different metal cofactors that can be used in different application scenarios should all belong to the protection scope of the present application.

[0068] In step S103, the signal of the protein-specific glycoform is converted into a mass spectrometry signal by performing mass spectrometry quantitative analysis on the reporter peptide released by the enzyme-cut glycan probe.

[0069] Generally, before performing the mass spectrometry quantitative analysis in step S103, the reporter peptide released by the enzyme-cut glycan probe is specifically as follows: the DNA enzyme of the protein probe can cut all glycan probes combined with the target protein, and the reporter peptide produced by the trypsin enzyme-cut of the glycan probe is subjected to mass spectrometry quantitative analysis.

[0070] The present embodiment successfully constructs a recyclable DNA enzyme motor for in situ quantitative detection of MUC1-specific sialic acid levels. After the protein probe and the glycan probe selectively bind to the corresponding target, the DNA enzyme in the protein probe can automatically cut the glycan probe on the MUC1 protein under the control of the metal cofactor. The reporter peptide produced by the trypsin enzyme-cut of the enzyme-cut glycan probe is subjected to mass spectrometry quantitative analysis, thereby cleverly realizing quantitative detection of the protein-specific glycoform which is difficult to directly detect. The new design of the DNA enzyme motor precisely controls the switch drive through the metal cofactor, and widely applies the high-sensitivity and specific MS quantitative technology, which can provide more comprehensive clinical information on the correlation between protein-specific glycoform and cancer progression. In view of the universality of aptamer recognition and the chemical plasticity of glycosylation, the method provides a promising quantitative tool, which is theoretically applicable to detecting the terminal-specific glycan on a specific membrane protein.

[0071] The scheme of the present embodiment can also realize a recycling mechanism, as shown in Figure 3 which specifically includes:

[0072] In step S104, the protein probe returns to a single-stranded state after the enzyme-cut process and continues to participate in the next round of hybridization and enzyme cutting while maintaining the integrity of the structure; the DNA enzyme of the recycling protein probe can cut all glycan probes combined with the target protein.

[0073] In the present embodiment, a specific method is also provided for solution preparation of the protein probe, as shown in Figure 4 which includes:

[0074] In step S201, the protein probe is dissolved in diethyl pyrocarbonate (DCEP)-treated water to prepare a 50 μM stock solution, which is stored at -20°C.

[0075] Step S202, for target protein recognition, the stock solution is diluted with PBS containing 5 mM Mg 2+ and heated at 95 °C for 10 min, then slowly annealed to 25 °C in a thermal cycler, and kept at 25 °C for about 1 h, and finally stored at 4 °C until use.

[0076] wherein PBS is phosphate buffer solution, which is the most widely used buffer solution in biochemical research, and the main components are Na2HPO4, KH2PO4, NaCl and KCl, which generally act as solvents to protect the reagents. Since Na2HPO4 and KH2PO4 have secondary dissociation, the pH value of the buffer is very wide, and NaCl and KCl mainly increase the salt ion concentration.

[0077] In the embodiments of the present application, a feasible scheme is also provided for the synthesis of glycan probes, which includes:

[0078] The DNA sequence of the glycan probe contains a disulfide group at its 5' end, which is combined with a maleimide-modified substrate peptide after reduction by tris(2-carboxyethyl) phosphine (English abbreviation: TCEP);

[0079] The DNA sequence of the glycan probe also has a DBCO group at its 3' end, which is specifically combined with an aldehyde-modified target sugar chain with the help of a heterobifunctional functional group crosslinker (azide-PEG4-hydrazide hydrochloride).

[0080] In the specific process, the above combination process can also be refined as follows: 200 μL of DNA reactant (200 μM) is first reduced by TCEP at 37 °C for 1 h, and the remaining TCEP is removed by ultrafiltration; then 200 μL of maleimide-modified substrate peptide (1 mM) is added to the reduction product, combined at 37 °C under nitrogen for 2 h, and finally the unreacted DNA and substrate peptide are removed by preparative high performance liquid chromatography (HPLC) to obtain the purified synthesized glycan probe.

[0081] Example 2:

[0082] Example 2 is based on the method idea proposed in Example 1, and further describes the implementation process of the method in Example 1 in the scene instance when the target protein glycoform is an example of MUC1 specific glycoform (also described as MUC1 specific sialic acid or MUC1 terminal sialic acid or MUC1 specific Sia in subsequent embodiments of the present application) in cells. As shown in Figure 5 , which includes:

[0083] Step S301, collect MCF-7 and T47D cells in exponential growth phase with cell enzyme-free dissociation buffer (for example, the number of cells collected is 1 x 10 6 ).

[0084] Step S302, disperse MCF-7 and T47D cells in binding buffer for 1 h to reduce non-specific adsorption of protein probes, and then incubate in 200 μL of 1.25 μM protein probe solution at room temperature for 30 min. Among them, μM refers to 10 - 6 mol / L, the concentration unit.

[0085] 200 μL of 1.25 μM protein probe solution is the protein probe solution after step S201 and step S202.

[0086] Step S303, after washing the cells with PBS, incubate with sodium periodate and cross-linking agent at 37°C for 30 min and 1.5 h, respectively.

[0087] The nucleic acid aptamer recognizes and binds to MUC1 protein; the terminal sialic acid of MUC1 protein is oxidized by periodate to introduce an aldehyde group.

[0088] Further, with the help of heterobifunctional functional cross-linking agent, it is combined with the dibenzocyclooctyne tag on the glycan probe.

[0089] Step S304, after washing the cells with PBS, add 200 μL of PBS containing glycan probe, 10 mM aniline and 5% fetal bovine serum, and incubate at 37°C.

[0090] Step S305, wash the cells with PBS and redistribute in PBS solution containing Mg 2+ , and slowly shake at 37°C for 1 hour.

[0091] At this point, the process of step S102 in Example 1 is equivalent.

[0092] Step S306, after washing the cells with PBS for 3 times, collect all the supernatant of the released fragmented fragments combined with the terminal sialic acid of MUC1, add sequencing grade trypsin, and incubate at 37°C for 24 h to release the reporter peptide.

[0093] Step S307, stop the reaction by adding 10 μL of 0.1% trifluoroacetic acid. After adding the internal standard, desalt the polypeptide solution with a desalting chromatographic column (for example: Thermo Scientific, UT, USA), and determine it with liquid chromatography-tandem mass spectrometry LC-MS / MS. Among them, adding an internal standard is to correct the error of the instrument when mass spectrometry is detected, and to ensure the accuracy of quantification.

[0094] In the embodiments of the present application, the MUC1-specific Sia signal is ingeniously converted into the MS signal of the reporter peptide, thereby realizing rapid and accurate in situ quantitative detection of protein-specific glycoforms. After further optimization and improvement, the method is successfully used for in situ quantitative detection of MUC1-specific Sia in different breast cancer cell lines.

[0095] In combination with the embodiments of the present application, the liquid chromatography-tandem mass spectrometry (LC-MS / MS) detection involved in the above method steps is given a more detailed implementation process, including:

[0096] Sample analysis was performed using a Shimadzu LC-30A UPLC coupled with a Shimadzu LCMS-8050 triple quadrupole mass spectrometer (Shimadzu, Kyoto, Japan). An Agilent SB C18 column (30 mm × 2.1 mm, 2.7 μm) was used for sample separation, and the column temperature was 40°C. The mobile phase A was 0.1% formic acid in water, and the mobile phase B was 0.1% formic acid in methanol. The injection volume was 10 μL, and the elution flow rate was 0.3 mL / min. The optimized elution gradient was: 0 min (10% mobile phase B)-1 min (10% mobile phase B)-5 min (60% mobile phase B)-8 min (60% mobile phase B)-9 min (10% mobile phase B)-10 min (10% mobile phase B), and the elution time was 10 min.

[0097] In combination with the embodiments of the present application, there is a preferred implementation scheme, in which all polypeptide samples are operated in the positive ion mode of an electron spray ionization (ESI) source. According to the selected optimal ion pair, the potential and collision energy are adjusted to achieve ideal ionization. The ESI source conditions and MS parameters are set as follows: the ion source temperature and heating / driving gas flow are set to 350°C and 10 L / min, respectively; the quadrupole Q1 and quadrupole Q3 are operated at unit resolution; the experimental capillary voltage is 4 kV, and the atomizer pressure is 35 psi; for example, LabSolution software can also be used for data recording and analysis.

[0098] In the embodiments of the present application, the design principle and working principle of the protein probe and the glycan probe are: generally, the quantitative analysis of a single protein or a single sugar chain is easy to complete. However, a more ingenious method is needed to efficiently study specific glycoforms on specific proteins. By the combined application of DNA enzyme motor and MS, the embodiments of the present application directly prove the feasibility of the universal method designed by the embodiments of the present application by quantitatively detecting MUC1 specific sialic acid. MUC1 is one of the most representative transmembrane glycoproteins and is a biomarker with high discrimination. Its extracellular domain has about 20-120 variable number tandem repeats (VNTRs) with high O-glycosylation, and each VNTR consists of 20 amino acids containing 5 potential O-glycosylation sites. Studies on tumor cell lysates show that usually only two sites of a VNTR are glycosylated. Sialic acid is usually the outermost monosaccharide sequence of the sugar chain molecule and has basic biological functions in cell signal transduction, migration, recognition and interaction. The abnormal expression and distribution of MUC1 specific sialic acid are related to the malignant and metastatic phenotypes of various cancers.

[0099] In the embodiments of the present application, in order to exclude the potential influence of the added sequence on the performance of the aptamer, the affinity and specificity of the protein probe were determined by flow cytometry by observing the fluorescence intensity of MUC1 positive MCF-7 cells and MUC1 negative HepG2 cells after incubation with FITC labeled protein probe or nucleic acid aptamer S2.2 (also referred to as aptamer in the present application). As expected, bright fluorescence appeared in MCF-7 cells, but not in HepG2 cells, and the fluorescence signals between the fluorescein isothiocyanate (FITC) labeled protein probe and the FITC labeled nucleic acid aptamer S2.2 were consistent in MCF-7 cells, as shown in FIG. 2B. The result curve shows that the addition of the DNA enzyme sequence has little effect on the performance of the original aptamer. In Figure 6 , MCF-7 cells (MUC1 positive) and HepG2 cells (MUC1 negative) were cultured with FITC labeled aptamer S2.2 and FITC labeled PP, and untreated cells were used as a control. Figure 6 , MCF-7 cells (MUC1 positive) and HepG2 cells (MUC1 negative) were cultured with FITC labeled aptamer S2.2 and FITC labeled PP, and untreated cells were used as a control.

[0100] In the embodiments of the present application, in order to achieve this ingenious conversion from MUC1 specific Sia level to reporter peptide ion signal, the design and characterization of GP are also crucial. The sequence of GP should be consistent with the catalytic substrate strand of 8-17 RNA cleaving DNA enzyme, which contains a cleavage point (rA) connecting F1 and F2. In addition, a disulfide group is labeled at its 5' end, which binds to the maleimide modified substrate peptide through Michael addition reaction, and then 3 T bases are added to enhance the accessibility between DNA enzyme and GP.

[0101] In the embodiments of the present application, it is preferred to select AVQLGVDPFR as the reporter peptide because it has a high-quality multiple reaction monitoring (MRM) channel. Among them, the divalent ion m / z 551.3 is the most abundant in the scan mode, and the three ions m / z 171.3 (b2), m / z 419.2 (y3) and m / z 690.3 (y6) are used as MRM for subsequent quantitative analysis of the reporter peptide due to their high signal-to-noise ratio (S / N). The reporter peptide ion spectrum and chromatogram are shown in Figure 7 , Figure 7 A is the sub-ion spectrum of the reporter peptide AVQLGVDPFR, Figure 7 B is the LC-MS / MS mass spectrum of the reporter peptide AVQLGVDPFR, Figure 7 C is the mass spectrum of the corresponding internal standard. In order to ensure the high accuracy of the mass spectrometric quantitative results, an internal standard is added for correction. The internal standard is usually selected to be a stable isotope-labeled form or a structural analog of the reporter peptide (AVLGVDPFR) as its internal standard. Compared with the reporter peptide, the internal standard lacks a glutamine amino acid at the 3rd position. In addition, the reporter peptide is measured by MS after being enzymatically digested from the substrate peptide by trypsin. Therefore, the substrate peptide in the embodiments of the present application is designed as (Mal-GDRAVQLGVDPFR). Under the same conditions, according to the response ratio of the reporter peptide generated by the enzymatic digestion of the substrate polypeptide to the equimolar reporter peptide standard, the enzymatic efficiency is calculated to be 96.3 ± 3.8%, as shown in Figure 8 . Figure 8 Among them, the LC-MS / MS chromatograms of (A) Mal-GDRAVQLGVDPR and (B) AVQLGVDPR before and after trypsin digestion; the MRM transition of the substrate peptide is m / z 812.4→ m / z 70.3, m / z 812.4→ m / z 175.0 and m / z 812.4→ m / z 419.6;

[0102] In the preferred scheme of the embodiments of the present application, the target sugar chain must be subjected to mild chemical treatment, and an aldehyde group is first introduced by sodium periodate-mediated Sia oxidative cleavage. Under the catalysis of aniline under physiological conditions, the aldehyde group can quickly form a covalent bond with hydrazine or aminooxy reagent. Therefore, the applicant adds a DBCO group at the 3' end of the DNA sequence of GP, which is connected with the heterobifunctional functional group crosslinking agent (alkyl-reactive azide group and carbonyl-reactive hydrazine group) and the aldehyde group generated by periodate oxidation. In addition, a base sequence of 9 Ts is added between DBCO and the DNA sequence to space apart. The complete structure and DNA sequence of GP are shown in Figure 9 and Table 1, Figure 9 A is the structure of the DNA reactant, Figure 9B is the structure of the glycan probe. The DNA sequence of GP consists of a 5' end modified disulfide and a 3' end labeled dibenzocyclooctyne (DBCO) tag; the disulfide reduced by tris(2-carboxyethyl)phosphine can bind to the maleimide-modified substrate peptide, and the DBCO tag can be connected to the aldehyde group oxidized by periodic acid through a cross-linking agent.

[0103] Table 1: All oligonucleotide sequences used in the examples of the present application:

[0104]

[0105] wherein the sequence in bold in PP is the sequence of aptamer S2.2. In the FITC-labeled S2.2 and the FITC-labeled PP, the oligonucleotide is labeled with FITC at the 3' end.

[0106] In the examples of the present application, the synthesis and characterization of the glycan probe are also involved:

[0107] The GP synthesis process was investigated by high-performance liquid chromatography at a wavelength of 260 nm. First, the 5' end disulfide of the DNA reactant was reduced before coupling and covalently added to the maleimide-modified substrate peptide through Michael addition reaction to form a thiol maleimide linkage. As shown in Figure 11 A, the peak time of the original DNA reactant and the synthesized GP is 17.6 min and 16.5 min, respectively. The HPLC results show that almost all of the DNA reactants can be reacted off when the substrate peptide is sufficient. In fact, 100% reaction efficiency is not necessary here, because the synthesized GP is finally purified and collected by preparative HPLC for subsequent experiments. The synthesis product was further verified by LCQ Deca XP Plus ion trap mass spectrometry, and the measured molecular weight was consistent with the theoretically calculated molecular weight, as shown in Figure 10 A, the peak time of the original DNA reactant and the synthesized GP is 17.6 min and 16.5 min, respectively. The HPLC results show that almost all of the DNA reactants can be reacted off when the substrate peptide is sufficient. In fact, 100% reaction efficiency is not necessary here, because the synthesized GP is finally purified and collected by preparative HPLC for subsequent experiments. The synthesis product was further verified by LCQ Deca XP Plus ion trap mass spectrometry, and the measured molecular weight was consistent with the theoretically calculated molecular weight, as shown in Figure 10 A is the mass spectrum of the DNA reactant, Figure 10 B is the mass spectrum of the glycan probe. The applicants also evaluated the state of GP after trypsin digestion by HPLC and LC-MS / MS, which provided more solid evidence for the successful formation of GP, as shown in Figure 11 B and Figure 11 C, Figure 11In the middle, (A) is the HPLC profile of GP synthesis process, (B) is the HPLC before and after trypsin digestion of GP, (C) is the profile of LC-MS / MS after trypsin digestion of GP; from the results of HPLC and LC-MS / MS, after trypsin digestion, the peak of GP is replaced by a new peak, which indicates that GP loses the reporter peptide; as expected, the original peak disappears and a new peak appears in HPLC, which is due to the loss of reporter peptide of GP after trypsin digestion. However, the mass spectrum signal and peak retention time of the released polypeptide are consistent with the synthetic reporter peptide. Finally, the applicant evaluated the stability of GP, and the results are shown in Figure 12 As shown, after incubation at 37°C for 16 hours, the change is negligible. Figure 12 In the middle, the Y axis is the percentage of residual glycoprotein.

[0108] In the embodiments of the present application, the characterization of the recyclable DNAzyme motor is also involved.

[0109] One of the basic features of DNAzyme motor is that it is inactivated in the absence of divalent metal cofactor, and is immediately activated in the presence of divalent metal cofactor. When activated, DNAzyme motor can cleave the substrate strand and can recycle the cleavage. Therefore, the applicant uses native polyacrylamide gel electrophoresis (PAGE) to test its feasibility and cleavage process within 1 h at 37°C. From Figure 13 As can be seen, the marker (lane 1), PP (lane 2), GP (lane 3) and other bands are very clear and can be used as a reference. In the absence of divalent metal cofactor (lane 4), there is no difference in the relative position and brightness of the PP and GP bands compared with the reference band. In the presence of divalent metal cofactor (lane 5), the PP band remains unchanged, while the original GP band disappears and a new band appears, indicating that the DNAzyme motor is working properly. The applicant further studied the optimal ratio of PP / GP under given conditions. As can be seen from bands 5-9, with the increase of GP, the cleavage band gradually becomes obvious until the ratio of PP / GP reaches 1:10. Considering that not all sites of VNTR of MUC1 are glycosylated, and because modification of Sia does not produce extensive sugar branching, ten cycles of cleavage are sufficient to release all GPs bound to a single VNTR of MUC1. Figure 13 In the middle, column 1: 500 bp marker; column 2: PP; column 3: GP; column 4: PP+GP (1:1) in PBS; column 5: PP+GP (1:1) in PBS (5 mM Mg 2+ ) ; column 6: PP+GP (1:2) in PBS (5 mM Mg 2+ ) ; column 7: PP+GP (1:2) in PBS (5 mM Mg2+ PP+GP (1 :5) in PBS; Column 8: PP+GP (1 :5) in PBS (5 mM Mg 2+ PP+GP (1 :10) in PBS; Column 9: PP+GP (1 :10) in PBS (5 mM Mg 2+ PP+GP (1 :15) in PBS.

[0110] It is important to note that DNase usually requires the recruitment of specific metal cofactors to help fold into a compact conformation to achieve its catalytic activity. The extent to which the original 8-17 sequence-containing DNase can cleave DNA substrates depends on the effectiveness of divalent metal ions: Pb 2+ Zn 2+ Cd 2+ Mg 2+ . Given that the quantification of protein-specific glycoforms is to be performed in live cells, heavy metal ions are discarded. In this study, the DNase is in a modified form, so the applicants compared the cleavage ability of the DNase motor in the presence of Zn 2+ or Mg 2+ . Contrary to the conclusion of the effectiveness of the ions in the original DNase, Mg 2 + is a better metal cofactor for the modified DNase (data not shown), as confirmed by previous studies. Therefore, Mg 2 + was chosen as the best metal cofactor for the activation of the DNase, and the effect of its concentration on the activity of the DNase was optimized. As shown in Figure 14 , when the PP / GP ratio is 1 :10, the DNase motor has little effect at low concentrations of Mg 2+ , while it is active at Mg 2+ concentrations above 5 mM, almost cleaving all the substrate. Therefore, the preferred concentration in the experiments was 5 mM Mg 2+ . Figure 14 Column 1 : 500 bp marker; Column 2: PP; Column 3: GP; Column 4: PP+GP (100 mM Mg 2+ ) in PBS; Column 5: PP+GP (200 mM Mg 2+ ) in PBS; Column 6: PP+GP (500 mM Mg 2+ ) in PBS; Column 7: PP+GP (1 mM Mg 2+ ) in PBS; Column 8: PP+GP (5 mM Mg 2+ ) in PBS; Column 9: PP+GP (10 mM Mg 2+ ) in PBS; the ratio of PP to GP was 1 :10.

[0111] Based on the technical solutions described in Embodiment 1 and Embodiment 2, the present application further provides an improved implementation scheme for the periodate oxidation involved in step S101 of Embodiment 1 and the glycan probe recognition involved in step S103.

[0112] The selective introduction of aldehyde group to the terminal sialic acid of MUC1 is achieved by sodium periodate oxidation. Therefore, optimizing the periodate oxidation condition is a necessary condition to improve the oxidation efficiency. To achieve this goal, the present application selects MCF-7 cells as the research object, and applies biotin-hydrazide and streptavidin-FITC to detect the fluorescence intensity by flow cytometry. With the increase of sodium periodate concentration, the fluorescence intensity gradually increases, and reaches a stable state when the sodium periodate concentration is 1 mM Figure 15 A). It is worth noting that the ketone / aldehyde-hydrazine / amino oxygen connection (hydrazone or oxime) usually requires a weak acidic environment and a high substrate concentration (millimolar range) to make up for its slow kinetic characteristics, but it is difficult to achieve labeling in living cells. In order to overcome these unfavorable conditions, the present application uses aniline as a nucleophilic catalyst to accelerate the reaction process by forming a protonated aniline Schiff base intermediate. As shown in Figure 15 B, the fluorescence signal is significantly enhanced after adding 10 mM aniline, which is about 7 times higher than that without aniline. Figure 15 In the meantime, (A) is the flow cytometry analysis of Sia in MCF-7 cells oxidized by different concentrations of sodium periodate; (B) is the comparison of glycan labeling efficiency with / without 10 mM aniline.

[0113] In addition, the degree of binding of the glycan probe to the terminal sialic acid is another key step for the accuracy of MUC1 specific sialic acid quantitative detection. The concentration of the glycan probe and the reaction time are optimized to ensure complete recognition of the terminal sialic acid. As shown in Figure 16 A and Figure 16 B, with the addition of the glycan probe and the extension of time, the mass spectrometry response of the reporter peptide significantly increases and reaches a stable stage. Incubating with 1 μM glycan probe for 1 h is the most economical and effective condition. Figure 16 A is the concentration, Figure 16 B is the reaction time, and the results are detected by LC-MS / MS.

[0114] MCF-7 cells positive for MUC1 are used as the research object to verify the selectivity and specificity based on the recyclable DNA enzyme motor method, as shown in Figure 17 , Figure 17 A is to evaluate the experiments lacking PP or periodate oxidation and tunicamycin inhibition, Figure 17 B is to compare the sialic acid signals on MCF-7 cells and MUC1 protein, Figure 17C shows the quantification of MUC1 -specific sialic acids in MCF-7 and T47D cells using the designed recyclable DNAzyme motor. As shown in Figure 17 A, negligible signal can be observed in the absence of protein probes or high-iodine oxidation, which can be caused by non-specific binding between the glycan probes and the cells. The specificity of MUC1 -specific sialic acids was further verified by tunicamycin inhibition of N-linked glycosylation, as MUC1 proteins only exhibit O-linked glycosylation. Therefore, the MUC1 -specific sialic acid content is not affected by the absence of N-glycans. Moreover, considering that the overall sialic acid signal on MCF-7 cells is significantly higher than that of MUC1 proteins, the present embodiments can infer that the observed signal comes from MUC1 proteins, rather than adjacent proteins, as the designed spacing in the probes limits their hybridization range, as shown in Figure 17 B.

[0115] The following describes the implementation of the correlation experiment scheme for the quantification of MUC1 -specific sialic acids in breast cancer cells under specific examples.

[0116] Before quantifying MUC1 -specific sialic acids with mass spectrometry, a calibration curve was plotted according to the ratio of the reporter peptide standard to its internal standard in the range of 50 pM to 10 nM, as shown in Figure 18 , the relative peak area ratio of the reporter peptide standard to its internal standard was plotted according to the concentration; it was constructed using a weighted linear regression model with a weighting factor of 1 / x2. The limit of detection (LOD) was set to 50 pM Figure 19 ), Figure 19 , the internal standard was omitted for clarity, Figure 19 A is the LOD graph of the reporter peptide, Figure 19 B is the LC-MS / MS chromatogram of the matrix blank. The stability of the method was further verified. The present embodiments used the percentage coefficient of variation (%CV) to evaluate the intra-day precision and inter-day precision, and the accuracy was calculated by comparing the ratio of the average value to the actual value (%bias). As shown in Table 2, both the precision and the accuracy were acceptable (≤±15%, LOD≤±20%).

[0117] Table 2: Accuracy and precision of QC samples:

[0118]

[0119] After verification, the recyclable DNAzyme motor was used to determine the levels of MUC1 -specific sialic acids in different breast cell lines. The results are shown in Figure 17 C, the average number of MUC1 -specific sialic acids in MCF-7 cells was (4.73 ± 0.54) ×10 6The average number of MUC1 -specific sialic acid per MUC1 protein in T47D cells was (8.18 ± 0.72) x 10 6 which is consistent with the previously reported results. In addition, considering the difference in MUC1 protein expression in different cells, the sialic acid level on a single MUC1 protein can be an ideal parameter for detecting the dynamic changes of protein-specific glycoforms. According to the MUC1 protein content determined in different cell lines in the previous work of the present application, the expression amount of sialic acid per MUC1 protein in MCF-7 cells and T47D cells was calculated to be 27.5 and 36.0, respectively. The different expression of sialic acid per MUC1 protein in different breast cancer cells can be mainly due to the different expression of glycosyltransferases that regulate the extension of glycan chains during tumorigenesis, as well as the difference in the size of MUC1 protein.

[0120] In summary, the present application successfully constructed a recyclable DNA enzyme motor for in situ quantitative detection of the level of MUC1 -specific Sia. After selective binding of PP and GP to their respective targets, the DNA enzyme in PP can automatically cleave GP on the MUC1 protein under the control of metal cofactors. The cleaved GP is then subjected to trypsin digestion to produce a reporter peptide, which is quantified by mass spectrometry, thereby ingeniously achieving quantification of protein-specific glycoforms that are difficult to detect directly. The new design of DNA enzyme motor, precise control of the switch drive by metal cofactors, and the wide application of high sensitivity and specificity MS quantification technology can provide more comprehensive clinical information on the correlation between protein-specific glycoforms and cancer progression. Given the universality of aptamer recognition and the chemical plasticity of glycosylation, this method provides a promising quantitative tool that is theoretically applicable to the detection of terminal-specific glycans on specific membrane proteins.

[0121] In the description of the present specification, the description of the terms "one embodiment / way", "some embodiments / ways", "example", "specific example" or "some examples" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment / way or example are included in at least one embodiment / way or example of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment / way or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments / ways or examples. In addition, the person skilled in the art can combine and combine the different embodiments / ways or examples described in the present specification and the features of the different embodiments / ways or examples, without contradiction.

[0122] It has to be noted that, in the present application, terms like "first", "second", and the like in the description and in the claims are used to distinguish between similar elements and not necessarily to describe a sequential or chronological order. Furthermore, the terms "comprises", "comprising", or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but can also include other elements not expressly listed or inherent to such process, method, article, or apparatus. An element proceeded by "comprises... a" does not, without more constraints, exclude the presence of additional identical elements in the process, method, article, or apparatus that comprises the element. The term "plurality" denotes two or more, for example two, three or four unless expressly specified otherwise.

[0123] The foregoing is considered as illustrative only of the principles of the application. Numerous modifications and changes will readily occur to those skilled in the art, and the generic principles defined herein can be applied to other embodiments without departing from the spirit or scope of the application. Accordingly, the scope of the application is indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalents are intended to be embraced therein.

Claims

1. A method for in situ quantitative detection of protein-specific glycosylation based on dual probes for non-diagnostic purposes, characterized in that, The method comprises the following steps: The protein probe and the glycan probe are combined with the target protein and the target glycan respectively, and the spatial proximity relationship after the combination triggers hybridization between the probes on the same target protein to form a hybrid double strand, the protein probe comprises an aptamer for recognizing the target protein and a DNA enzyme, and the glycan probe comprises an oligonucleotide sequence complementary to a DNA enzyme sequence of the protein probe, a substrate peptide segment capable of being enzymatically cut into a reporter peptide by trypsin, and a dibenzocyclooctyne group; The DNA enzyme of the protein probe enzymatically cuts the glycan probe on the hybrid double strand under the action of a metal cofactor, and the metal cofactor is selected from magnesium ions; Mass spectrometric quantitative analysis is performed on the reporter peptide released by the enzymatically cut glycan probe, so as to convert the signal of the protein-specific glycoform into a mass spectrometric signal. After the DNA enzyme of the protein probe enzymatically cuts the glycan probe on the hybrid double strand under the action of the metal cofactor, the method further comprises: The protein probe returns to a single-stranded state and continues to participate in the next round of hybridization and enzymatic cutting while maintaining an intact structure; the DNA enzyme of the protein probe is cyclically utilized to enzymatically cut all glycan probes combined with the target protein; The method of combining the protein probe and the glycan probe with the target protein and the target glycan respectively comprises: The nucleic acid aptamer of the protein probe recognizes and combines with the MUC1 protein; The terminal sialic acid of the MUC1 protein is oxidized by periodate to introduce an aldehyde group; under the action of a heterobifunctional functional group crosslinking agent, the aldehyde group is combined with the dibenzocyclooctyne tag on the glycan probe; The periodate is sodium periodate with a concentration of 1 mM, and 10 mM aniline is added to the sodium periodate as a nucleophilic catalyst; when the glycan probe is combined with the target glycan, the incubation conditions are 1 μM glycan probe for 1 h; the target protein is MUC1, and the target glycan is the terminal sialic acid combined with MUC1; The nucleotide sequence of the protein probe is shown in SEQ ID No. 1; The nucleotide sequence of the glycan probe is shown in SEQ ID No. 2; The heterobifunctional functional group crosslinking agent is selected from azide-PEG4-hydrazide hydrochloride.

2. The method for in situ quantitative detection of protein-specific glycosylation for non-diagnostic purposes according to claim 1, characterized in that, The mass spectrometric quantitative analysis on the reporter peptide released by the enzymatically cut glycan probe comprises: the DNA enzyme of the protein probe enzymatically cuts all glycan probes combined with the target protein, and the reporter peptide produced by trypsin enzymatic cutting of the enzymatically cut glycan probe is subjected to mass spectrometric quantitative analysis.

Citation Information

Patent Citations

  • Molecular conjugate

    CN104090095A

  • Oligosaccharide connexon and fixed-point-connected antibody-drug conjugate prepared by using oligosaccharide connexon

    CN107778372A