A specific MHCII + Genetically engineered mice and MHCII in adipocytes + Preparation method and application of fat cells

By constructing a genetically engineered mouse model and magnetic bead sorting technology that can specifically remove MHCII+ fat cells, the problem that existing anti-inflammatory therapies cannot specifically inhibit adipose tissue inflammation is solved, and effective improvements to obesity-induced insulin resistance and adipose tissue inflammation are achieved.

CN116098126BActive Publication Date: 2025-08-12THE SECOND XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310211471.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-07
Publication Date
2025-08-12
Estimated Expiration
2043-03-07

AI Technical Summary

Technical Problem

Existing anti-inflammatory therapies cannot specifically inhibit adipose tissue inflammation without affecting systemic immunity, leading to a high risk of treating metabolic diseases and lacking effective treatments for adipose tissue inflammation.

Method used

A genetically engineered mouse model that can specifically eliminate MHCII+ adipocytes was constructed, and MHCII+ adipocytes were obtained through magnetic bead sorting technology, and the cells were used as targets for drug screening and research.

Benefits of technology

By targeting MHCII+ adipocytes, reducing the number of inflammatory Th1 cells and M1 macrophages in adipose tissue, improving obesity-induced insulin resistance and adipose tissue inflammation, provides a new way to specifically inhibit adipose tissue inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116098126B_ABST
    Figure CN116098126B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for specifically clearing MHCII + Genetically engineered mice and MHCII in adipocytes + Preparation method and application of fat cells. Preparation method of genetically engineered mice: (1) inserting a ‑loxp‑STOP‑loxp‑DTR‑ fragment after the last exon of the H2‑Aa gene. Since the STOP fragment blocks gene transcription, all cells of the mouse cannot express DTR; (2) after hybridizing the mouse with Adipoq‑cre mice, only the STOP fragment in the fat cells will be removed, so that MHCII expressing both the H2‑Aa gene and the cre gene will be + Fat cells can express DTR and obtain aH2-Aa DTR Mouse; (3) aH2‑Aa DTR The mice were hybridized with purebred C57BL / 6J mice for 5 generations to purify the genetic background and then used for subsequent experimental studies. + The use of adipocytes in preparing products for improving obesity-induced insulin resistance, the use of adipocytes in preparing products for improving obesity-induced Th1 cell infiltration in adipose tissue, and the use of adipocytes in preparing products for improving obesity-induced M1 macrophage infiltration in adipose tissue.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a method for specifically clearing MHCII + Genetically engineered mice and MHCII in adipocytes + Preparation method and application of fat cells. Background Art

[0002] Obesity has become a global epidemic. The primary threat of obesity is that it can cause insulin resistance, contributing to numerous complications such as diabetes, cardiovascular disease, and cancer. Numerous studies have demonstrated that chronic inflammation is a key mechanism underlying obesity-related complications, and visceral adipose tissue is a key site for the development and progression of obesity-induced chronic inflammation. Since the publication of a 1993 article in Science demonstrating high expression of the inflammatory cytokine TNFα in adipose tissue of obese mice, nearly 10,000 papers have examined the mechanisms of adipose tissue inflammation and its key role in obesity-related metabolic diseases. Hundreds of clinical trials have tested the effects of anti-inflammatory therapies on metabolic diseases. Despite some initial successes, no anti-inflammatory therapy has yet received approval from the US Food and Drug Administration (FDA) for the treatment of metabolic diseases. This failure is primarily due to the fact that currently tested anti-inflammatory therapies target classical immune cells and immune signaling molecules, potentially increasing patients' risk of infection and cancer, making them unsuitable for treating metabolic diseases, which are often chronic conditions. The search for new approaches that can specifically inhibit adipose tissue inflammation without affecting systemic immunity will offer new hope for immunotherapy of metabolic diseases. Summary of the Invention

[0003] In order to solve the above technical problems, the present invention provides a method for specifically clearing MHCII + Methods for preparing genetically engineered mice expressing adipocytes.

[0004] Furthermore, the present invention also provides MHCII extracted from the above genetically engineered mice or extracted from the adipose tissue of animals or humans. + Fat cells.

[0005] Furthermore, the present invention also provides the above-mentioned MHCII + Method for preparing fat cells.

[0006] Furthermore, the present invention provides the above-mentioned MHCII + Application of adipocytes in the research of preparing products to improve obesity-induced insulin resistance.

[0007] Furthermore, the present invention provides the above-mentioned MHCII + Application of adipocytes in the preparation of products to improve obesity-induced Th1 cell infiltration in adipose tissue.

[0008] Furthermore, the present invention provides the above-mentioned MHCII + Application of adipocytes in the preparation of products to improve obesity-induced M1 macrophage infiltration in adipose tissue.

[0009] Furthermore, the present invention also provides the above-mentioned MHCII + Application of magnetic bead sorting technology for adipocytes.

[0010] The technical solution of the present invention is:

[0011] A specific MHCII + Preparation of genetically engineered mice with adipocytes:

[0012] (1) Construction of H2-Aa DTR Mice: Gene editing was performed on the H2-Aa gene of C57BL / 6J mice. A -loxP-eGFP-STOP-loxP-DTR-mCherry- fragment was inserted after the last exon (exon 4) of the H2-Aa gene. The loxP site is the sequence recognized and bound by the Cre recombinase, eGFP is enhanced green fluorescent protein, STOP is a transcription termination sequence that can block the transcription of the following gene, DTR is the diphtheria toxin receptor, and mCherry is a red fluorescent protein. Cells expressing the H2-Aa gene (i.e., expressing MHCII) in this mouse will express eGFP fluorescent protein but not DTR and mCherry, resulting in H2-Aa DTR mice;

[0013] (2) H2-Aa DTR aH2-Aa was obtained by crossing mice with Adipoq-cre mice. DTR Mouse: The fat cells of the mouse can express Cre recombinase, which recognizes loxP sites and cuts the DNA sequence between the two loxP sites, and can simultaneously express the H2-Aa gene and the Cre gene, that is, the genetically engineered mouse that can express DTR and mCherry fluorescent protein and can specifically eliminate MHCII+ fat cells, namely aH2-Aa DTR mouse.

[0014] Wherein, the method can specifically remove MHCII + The method for preparing genetically engineered mice of fat cells further comprises the following steps:

[0015] (3)aH2-Aa DTR The mice were obtained by hybridizing with purebred C57BL / 6J mice for 5 generations to purify the genetic background and then purified to specifically eliminate MHCII +Genetically engineered mice with fat cells.

[0016] MHCII + Fat cells:

[0017] The MHCII + Adipocytes from the above aH2-Aa DTR Adipose tissue of mice, other animals or humans can be obtained by flow cytometry or magnetic bead separation.

[0018] Wherein, the MHCII + fat cells,

[0019] The specific method of obtaining adipose tissue from other animals or humans by magnetic bead separation is:

[0020] (1) Obtaining adipose tissue from animals or humans;

[0021] (2) Extraction of fat cells: Use surgical scissors to cut the fat tissue into pieces of about 1 mm. 3 For small pieces, add 5 mL of collagenase II buffer per gram of adipose tissue and digest at 37°C and 100 rpm for 45 minutes. Filter animal adipose tissue with a 200 μm filter and human adipose tissue with a 300 μm filter. Centrifuge the filtered cell suspension at 200 g for 1 minute. Adipocytes will float in the upper layer, and the lower sediment is the vascular matrix component.

[0022] (3) Use a Pasteur pipette to transfer the upper layer of adipocytes to a new tube, add 5 mL of 2 mM EDTA solution, gently shake the tube upside down for 5 minutes to wash the adipocytes, centrifuge at 200g for 1 minute, remove the lower layer of liquid, and repeat the above steps 3 times to obtain adipocytes;

[0023] (4) The obtained adipocytes were divided into 200 μL portions, and 200 μL of CD45 antibody working solution was added. The CD45 antibody working solution was prepared by adding 2 μL of biotin-conjugated anti-mouse CD45 antibody to 200 μL of PBS containing 2 mM EDTA and 1% BSA, and incubated at room temperature for 15 minutes.

[0024] (5) Add 1 mL of PBS, wash once, and centrifuge at 200 g for 1 minute;

[0025] (6) Add 200 μL of magnetic bead suspension and incubate at room temperature for 15 minutes;

[0026] (7) Place the tube containing the cell suspension on the magnetic rack. + The cells will bind to the magnetic beads and be adsorbed to the tube wall, thereby removing CD45 + Cells, aspirate cells that are not adsorbed by magnetic beads, and transfer them to a new tube;

[0027] (8) Add 200 μL of MHC II antibody working solution, which is prepared by adding 2 μL of biotin-conjugated anti-mouse MHC II antibody to 200 μL of PBS containing 2 mM EDTA and 1% BSA, and incubate at room temperature for 15 minutes;

[0028] (9) Add 1 mL of PBS, wash once, and centrifuge at 200 g for 1 minute;

[0029] (10) Add 200 μL of magnetic bead suspension, which is prepared by adding 200 μL of PBS containing 2 mM EDTA and 1% BSA to 2.5 μL of biotin-binding magnetic beads, and incubate at room temperature for 15 minutes;

[0030] (11) Place the tube containing the cell suspension on the magnetic rack, MHCII + The fat cells will bind to the magnetic beads and be adsorbed on the tube wall. First, the MHCII - Fat cells are fully removed, and the remaining MHCII + Adipocytes were washed three times with 2 mM EDTA and 1% BSA in PBS, and the MHCII + Adipocytes and MHCII - Fat cells.

[0031] MHCII + Application of adipocytes in the preparation of products to improve obesity-induced insulin resistance.

[0032] MHCII + Application of adipocytes in the preparation of products to improve obesity-induced Th1 cell infiltration in adipose tissue.

[0033] MHCII + Application of adipocytes in the preparation of products to improve obesity-induced M1 macrophage infiltration in adipose tissue.

[0034] In order to find a new method to specifically inhibit inflammation in adipose tissue without affecting the whole body immunity, the present invention focuses on adipocytes. Adipocytes are a type of cell that exists almost exclusively in adipose tissue and are naturally tissue specific. The inventors' research found that there is a group of MHCII in adipose tissue. + Adipocytes, MHCII in adipose tissue of humans and mice as obesity progresses + The proportion of fat cells gradually increased. This means that MHCII + Adipocytes may be a special adipocyte subpopulation enriched in obese adipose tissue.

[0035] The present invention utilizes a newly constructed MHCII-specific + In a genetically engineered mouse model of adipocytes, clearing inflammatory adipocytes in the early stages of obesity can reduce the number of inflammatory Th1 cells and M1 macrophages in adipose tissue and improve insulin resistance. These studies have shown that MHCII + Adipocytes may be the key cell subset that triggers obesity-induced adipose tissue inflammation by targeting MHCII + Fat cells are expected to create new ways to specifically inhibit obesity-induced chronic inflammation.

[0036] The present invention develops a new MHCII + Adipocyte magnetic bead sorting technology can greatly improve MHCII + The sorting rate, survival rate and purity of adipocytes are MHCII + Subsequent research on adipocytes provides a solid physiological basis.

[0037] Based on the above, MHCII can be specifically eliminated + Genetically engineered mouse models of adipocytes and MHCII + Adipocyte magnetic bead sorting technology, the present invention constructs a MHCII + The present invention can specifically remove MHCII from the above-mentioned drug screening model targeting fat cells. + Obtain adipose tissue from mice with adipocytes and obtain MHCII by magnetic bead sorting technology + Adipocytes (which express mCherry red fluorescent protein) + Adipocytes were cultured in 96-well plates, and a drug was added to each well of the 96-well plate. After 24 hours, the red fluorescence was directly observed under a fluorescence microscope to see whether it was enhanced (increased) or weakened (decreased), so as to judge whether the drug had an effect on MHCII. + The promotion or inhibition of adipocytes can be achieved through large-scale and high-throughput drug screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Example 1 - Specific removal of MHCII + Preparation and verification of genetically engineered mice expressing adipocytes. (A) aH2-Aa DTR Mouse preparation strategy; (B) Flow cytometry detection of H2-Aa in HFD for 9 weeks DTR and aH2-Aa DTR MHCII in mouse epididymal adipose tissue + Adipocyte content, n=5 / group, *p<0.05.

[0039] Figure 2 Example 3 - Clearing MHCII + Adipocytes can protect against obesity-induced insulin resistance. (A) H2-Aa DTR and aH2-Aa DTR Insulin tolerance test (ITT) results of mice on HFD for 9 weeks; (B) Area under the curve (AUC) statistical graph of ITT results, n=6-7 / group, *p<0.05, ***p<0.001.

[0040] Figure 3 Example 4 - Clearing MHCII + Adipocytes reduce obesity-induced accumulation of inflammatory T cells (Th1) and macrophages (M1) in adipose tissue. (A) Flow cytometry analysis of H2-Aa DTR and aH2-Aa DTR The content of Th1 cells in mouse epididymal adipose tissue; (B) H2-Aa DTR and aH2-Aa DTR The number of Th1 cells per gram of epididymal adipose tissue in mice; (C) Flow cytometry detection of H2-Aa DTR and aH2-Aa DTR The content of M1 macrophages in mouse epididymal adipose tissue; (D) H2-Aa DTR and aH2-Aa DTR The number of M1 cells per gram of epididymal adipose tissue in mice. n = 5-6 / group, **p < 0.01, ***p < 0.001.

[0041] Figure 4 Example 5 - Isolation and acquisition of MHCII by magnetic bead sorting technology + Adipocytes. (A) MHCII + Diagram of magnetic bead sorting of adipocytes; (B) qPCR detection of MHCII obtained from magnetic bead sorting + Adipocytes and MHCII - Expression of H2-Ab1, Ciita and Cd74 in adipocytes, n=4 / group, **p<0.01, ***p<0.001. DETAILED DESCRIPTION

[0042] To help those skilled in the art better understand the technical solutions of the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative work are within the scope of protection of the present invention.

[0043] Unless otherwise specified, all reagents involved in the embodiments of the present invention are commercially available products and can be purchased through commercial channels.

[0044] Biotin binder magnetic beads (Biotin Binder Dynabeads): purchased from Invitrogen, catalog number 11533D;

[0045] Collagenase II: 1 mg / mL, 250 U / mg, purchased from Worthington.

[0046] Example 1

[0047] Can specifically eliminate MHCII + Preparation of genetically engineered mice with adipocytes:

[0048] (1) Construction of H2-Aa DTR Mice: Gene editing was performed on the H2-Aa gene of C57BL / 6J mice. A -loxP-eGFP-STOP-loxP-DTR-mCherry- fragment was inserted after the last exon (exon 4) of the H2-Aa gene. The loxP site is the sequence recognized and bound by the Cre recombinase, eGFP is enhanced green fluorescent protein, STOP is a transcription termination sequence that can block the transcription of the following gene, DTR is the diphtheria toxin receptor, and mCherry is a red fluorescent protein. Cells expressing the H2-Aa gene (i.e., expressing MHCII) in this mouse will express eGFP fluorescent protein but not DTR and mCherry, resulting in H2-Aa DTR mice;

[0049] (2) H2-Aa DTR aH2-Aa was obtained by crossing mice with Adipoq-cre mice. DTR Mice: The adipocytes of these mice can express Cre recombinase, which recognizes loxP sites and cuts the DNA sequence between the two loxP sites, thus producing cells that can express both the H2-Aa gene and the Cre gene (MHCII + Adipocytes) can express DTR and mCherry fluorescent proteins, and obtain the genetically engineered mice that can specifically eliminate MHCII+ adipocytes, namely aH2-Aa DTR mice;

[0050] (3)aH2-Aa DTR The purified MHCII was obtained by hybridizing with purebred C57BL / 6J mice for 5 generations to purify the genetic background. + Genetically engineered mice with fat cells.

[0051] In the embodiment: (1) Figure 1 As shown, H2-Aa was constructed DTR Mice: The H2 gene encodes MHC II in mice. The MHC II molecule consists of an α chain and a β chain, with the α chain encoded by the H2-Aa gene and the β chain by the H2-Ab1 gene. Because H2-Aa is more highly expressed than H2-Ab1 in adipocytes of C57BL / 6J mice, gene editing was performed on the H2-Aa gene. A -loxP-eGFP-STOP-loxP-DTR-mCherry- fragment is inserted after the last exon (exon 4) of the H2-Aa gene, where the loxP site is the sequence recognized and bound by the Cre recombinase, eGFP is enhanced green fluorescent protein, STOP is a transcription termination sequence that can block the transcription of the following gene, DTR is the diphtheria toxin receptor, and mCherry is a red fluorescent protein. Since the STOP fragment blocks gene transcription, the sequence following the STOP fragment will not be expressed. Cells expressing the H2-Aa gene (i.e., expressing MHCII) in this mouse will express eGFP fluorescent protein, but not DTR and mCherry, resulting in H2-Aa DTR mice;

[0052] (2) H2-Aa DTR aH2-Aa was obtained by crossing mice with Adipoq-cre mice. DTR Mice: The adipocytes of these mice can express Cre recombinase, which recognizes loxP sites and cuts the DNA sequence between the two loxP sites. Because the STOP fragment is removed, cells expressing both the H2-Aa gene and the Cre gene (MHCII + Adipocytes), that is, the genetically engineered mice that can express DTR and mCherry fluorescent protein and can specifically eliminate MHCII+ adipocytes, namely aH2-Aa DTR mice;

[0053] (3)aH2-Aa DTR The mice were hybridized with purebred C57BL / 6J mice for 5 generations to purify the genetic background and then used to obtain the purified MHCII + Genetically engineered mice with fat cells.

[0054] Example 2

[0055] MHCII + Preparation method of fat cells:

[0056] Alternatively, MHCII can be extracted from animal or human adipose tissue using the following method (magnetic bead separation). + Fat Cell Methods:

[0057] (1) Obtaining adipose tissue from animals or humans;

[0058] (2) Extraction of fat cells: Use surgical scissors to cut the fat tissue into pieces of about 1 mm. 3 For small pieces, add 5 mL of collagenase II buffer per gram of adipose tissue and digest at 37°C and 100 rpm for 45 minutes. Filter animal adipose tissue with a 200 μm filter and human adipose tissue with a 300 μm filter. Centrifuge the filtered cell suspension at 200 g for 1 minute. Adipocytes will float in the upper layer, and the lower sediment is the vascular matrix component.

[0059] (3) Use a Pasteur pipette to transfer the upper layer of adipocytes to a new tube, add 5 mL of 2 mM EDTA solution, gently shake the tube upside down for 5 minutes to wash the adipocytes, centrifuge at 200g for 1 minute, remove the lower layer of liquid, and repeat the above steps 3 times to obtain adipocytes;

[0060] (4) The obtained adipocytes were divided into 200 μL portions, and 200 μL of CD45 antibody working solution was added. The CD45 antibody working solution was prepared by adding 2 μL of biotin-conjugated anti-mouse CD45 antibody to 200 μL of PBS containing 2 mM EDTA and 1% BSA, and incubated at room temperature for 15 minutes.

[0061] (5) Add 1 mL of PBS, wash once, and centrifuge at 200 g for 1 minute;

[0062] (6) Add 200 μL of magnetic bead suspension and incubate at room temperature for 15 minutes;

[0063] (7) Place the tube containing the cell suspension on the magnetic rack. + The cells will bind to the magnetic beads and be adsorbed to the tube wall, thereby removing CD45 + Cells, aspirate cells that are not adsorbed by magnetic beads, and transfer them to a new tube;

[0064] (8) Add 200 μL of MHC II antibody working solution, which is prepared by adding 2 μL of biotin-conjugated anti-mouse MHC II antibody to 200 μL of PBS containing 2 mM EDTA and 1% BSA, and incubate at room temperature for 15 minutes;

[0065] (9) Add 1 mL of PBS, wash once, and centrifuge at 200 g for 1 minute;

[0066] (10) Add 200 μL of magnetic bead suspension, which is prepared by adding 200 μL of PBS containing 2 mM EDTA and 1% BSA to 2.5 μL of biotin-binding magnetic beads, and incubate at room temperature for 15 minutes;

[0067] (11) Place the tube containing the cell suspension on the magnetic rack, MHCII + The fat cells will bind to the magnetic beads and be adsorbed on the tube wall. First, the MHCII - Fat cells are fully removed, and the remaining MHCII + Adipocytes were washed three times with 2 mM EDTA and 1% BSA in PBS, and the MHCII + Adipocytes and MHCII - Adipocytes, MHCII - Adipocytes are the cells that express MHCII + The remaining fat cells after fat cell removal can be used to identify MHCII + Comparison with fat cells to explore MHCII + Characteristics of fat cells.

[0068] Example 3 Clearing MHCII + Verification that adipocytes can prevent obesity-induced insulin resistance 1. Experimental methods

[0069] Insulin tolerance test (ITT) in mice

[0070] 6-week-old male aH2-Aa DTR mice and their control mice H2-Aa DTR Mice were fed a high-fat diet (HFD) and, after 4 weeks, intraperitoneal injection of diphtheria toxin (6.25 ng / g body weight, twice a week) was started to clear aH2-Aa DTR MHCII in mice + Adipocytes. After 9 weeks of high-fat diet feeding, insulin tolerance test (ITT) was performed.

[0071] (1) Fasting for 6 hours: Remove the feed from the cage and replace it with clean bedding.

[0072] (2) Use a marker to draw a line on the mouse's tail to quickly distinguish each mouse, weigh the mouse and record the weight.

[0073] (3) Measure fasting blood glucose: Wipe the tip of the mouse’s tail with an alcohol cotton ball, cut off about 1 mm of the tail end with sterile scissors, and then wipe off the first drop of blood with sterile gauze. When the second drop of blood flows, use a blood glucose meter to absorb and measure the blood glucose.

[0074] (4) Intraperitoneal Injection of Insulin: Determine the insulin dosage based on the mouse's weight, typically 0.5-0.8 U / kg body weight. Add 5-8 μl of insulin to 5 ml of sterile saline to prepare a working solution. The insulin injection volume is [5 × mouse weight (g)] μl.

[0075] (5) Start timing after the first mouse is injected, and complete the insulin injection of all mice within 15 minutes. Determine the injection interval based on the number of mice.

[0076] (6) After 15 minutes, the blood glucose levels of mice were tested in sequence. The time points to be tested in this experiment included 15 minutes, 30 minutes, 45 minutes, 60 minutes and 90 minutes after insulin injection.

[0077] (7) After all time points have been tested, add feed to the mice and continue feeding.

[0078] The above results can be seen Figure 2 .

[0079] 2. Experimental results

[0080] ITT results showed that MHCII was cleared under high-fat diet + aH2-Aa in adipocytes DTR The insulin sensitivity of mice was significantly improved ( Figure 2 ). The above results show that the clearance of MHCII + Fat cells can prevent obesity-induced insulin resistance, indicating that the MHCII prepared by the present invention + Adipocytes can be used in research on the preparation of products to improve obesity-induced insulin resistance.

[0081] Example 4 Verification that depletion of MHCII+ adipocytes reduces obesity-induced accumulation of inflammatory T cells (Th1) and macrophages (M1) in adipose tissue

[0082] 1. Experimental methods

[0083] Flow cytometric analysis of stromal components and spleen cells

[0084] (1) 6-week-old male aH2-Aa DTR mice and their control mice H2-Aa DTR Mice were fed a high-fat diet (HFD) and, after 4 weeks, intraperitoneal injection of diphtheria toxin (6.25 ng / g body weight, twice / week) was started to clear aH2-Aa DTR MHCII in mice +Adipocytes. Mice were sacrificed by cervical dislocation after 9 weeks of high-fat diet feeding, and the peri-epididymal adipose tissue and spleen were harvested. The peri-epididymal adipose tissue was weighed and used to subsequently calculate the absolute number of Th1 cells and M1 macrophages.

[0085] (2) Extraction of vascular matrix components: Use surgical scissors to cut the peri-epididymal fat tissue into pieces of approximately 1 mm. 3 For small pieces of adipose tissue, add 5 mL of collagenase II (1 mg / mL, 250 U / mg, Worthington) buffer per gram of adipose tissue and digest at 37°C, 100 rpm for 45 minutes. Filter the cell suspension through a 70 μm filter. Centrifuge the filtered cell suspension at 500 g for 5 minutes. Adipocytes will float in the upper layer, and the lower pellet will be the stromal vascular fraction (SVF).

[0086] (3) Extraction of spleen cells: Remove the mouse spleen and place it in a culture dish. Use the end of a clean syringe to crush the tissue. Rinse the culture dish with PBS and filter through a 70 μm filter. Centrifuge the filtered cell suspension at 500 g for 5 minutes, discard the supernatant, and the lower sediment is the spleen cells.

[0087] (4) Red blood cell lysis: Add 1 mL of red blood cell lysis buffer to the obtained SVF and spleen cells, resuspend the cells, and let them stand on ice for 5 minutes. Centrifuge at 500g for 5 minutes, remove the supernatant, and resuspend in 1 mL of PBS.

[0088] (5) Take 700 μL of the obtained SVF cell suspension for Th1 cell staining and 300 μL for M1 macrophage staining. Take 100 μL of the spleen single cell suspension for Th1 cell staining and 50 μL for M1 macrophage staining.

[0089] (6) Intracellular stimulation: The SVF cell suspension and spleen single cell suspension used for Th1 cell staining were centrifuged and resuspended in 1 mL of cell stimulation medium (RPMI 1640 complete medium supplemented with 20 ng / mL PMA, 1 μL / mL lonomycin, and 2 μM Monensin) and plated in a 12-well plate for a total culture time of 6 h.

[0090] (7) Collect all cells after stimulation, centrifuge at 500g for 5 minutes, and discard the supernatant.

[0091] (8) Cell death and viability staining: Add 100 μL PBS and 1 μL Zombie NIR to each sample, blow gently to mix well, and incubate at room temperature in the dark for 7 minutes.

[0092] (9) Blocking: Add 1 μL CD16 / 32 to each sample, gently blow evenly, and incubate at room temperature in the dark for 7 minutes.

[0093] (10) Surface staining: Th1 cell staining (CD45-FITC, CD3-Percp / cy5.5, and CD4-APC antibodies were added to each sample in sequence), and M1 macrophage staining (CD45-FITC, F4 / 80-PE / Cy7, CD11b-APC, and CD11c-PE were added to each sample in sequence). The mixture was gently blown evenly and incubated at room temperature in the dark for 7 minutes.

[0094] (11) Wash once with 1 mL of PBS and centrifuge at 500 g for 5 minutes at 4°C. For M1 macrophage staining, resuspend the cells in 200 μL of PBS, transfer to a flow cytometer, and analyze. For Th1 cell staining, perform the following steps.

[0095] (12) Fixation / Permeabilization: Discard the supernatant and add 100 μL of Fixation / Permeabilization (Solution A:Solution B = 1:3) to each tube. Incubate at 4°C in the dark for 40 minutes.

[0096] (13) Termination: Add 1 mL of 1× Permeabilization Buffer and centrifuge at 500 g for 5 minutes at 4°C.

[0097] (14) Intracellular staining: Discard the supernatant, add 100 μL of 1× Permeabilization Buffer to each sample for resuspending, and add IFNγ-PE antibody. After mixing, incubate at 4°C in the dark for 40 minutes.

[0098] (15) Termination: Add 1 mL of 1× Permeabilization Buffer and centrifuge at 500 g for 5 minutes at 4°C.

[0099] (16) Discard the supernatant, add 200 μL PBS to resuspend, transfer to a flow cytometer, and analyze on a flow cytometer.

[0100] The above results can be seen Figure 3 .

[0101] 2. Experimental results

[0102] Because Th1 cells and M1 macrophages play the most critical role in obesity-induced adipose tissue inflammation, the inventors detected H2-Aa by flow cytometry. DTR and aH2-Aa DTR Th1 cells (CD45 + 、CD3 + 、CD4 + and IFNγ + ) and M1 macrophages (CD45+ 、F4 / 80 + 、CD11b + and CD11c + ) ratio and absolute number, the results showed that aH2-Aa DTR The proportion and absolute number of Th1 cells and M1 macrophages in the epididymal adipose tissue of mice were significantly reduced ( Figure 3 ); There were no significant differences in the two cell subsets in the spleens of the two groups of mice ( Figure 3 A and C). The above results show that the clearance of MHCII + Adipocytes can reduce the accumulation of obesity-induced inflammatory Th1 and M1 macrophages in adipose tissue, indicating that the MHCII prepared by the present invention + Adipocytes can be used in the preparation of products for improving obesity-induced Th1 cell infiltration in adipose tissue, and can be used in the research on the preparation of products for improving obesity-induced M1 macrophage infiltration in adipose tissue.

[0103] Example 5

[0104] 1. Experimental Methods

[0105] From aH2-Aa DTR MHCII was isolated from mouse adipocytes by magnetic bead sorting + fat cells

[0106] (1) aH2-Aa was fed a high-fat diet for 12 weeks DTR Mice were killed by cervical dislocation, and epididymal adipose tissue was obtained.

[0107] (2) Extraction of fat cells: Use surgical scissors to cut the fat tissue around the epididymis into pieces of about 1 mm. 3 For small pieces, add 5 mL of collagenase II (1 mg / mL, 250 U / mg, Worthington) buffer per gram of adipose tissue and digest at 37°C, 100 rpm for 45 minutes. Filter the cell suspension through a 200 μm filter. Centrifuge the filtered cell suspension at 200 g for 1 minute. Adipocytes will float in the upper layer, and the lower pellet will be the stromal vascular fraction (SVF).

[0108] (3) Use a Pasteur pipette to transfer the upper layer of fat cells to a new tube, add 5 mL of 2 mM EDTA solution, gently shake the tube upside down for 5 minutes to wash the fat cells, centrifuge at 200g for 1 minute, remove the lower layer of liquid, and repeat the above steps 3 times.

[0109] (4) The obtained adipocytes were divided into 200 μL portions, and 200 μL of CD45 antibody working solution (200 μL of PBS containing 2 mM EDTA and 1% BSA plus 2 μL of biotin-conjugated anti-mouse CD45 antibody) was added and incubated at room temperature for 15 minutes.

[0110] (5) Add 1 mL of PBS, wash once, and centrifuge at 200 g for 1 minute.

[0111] (6) Add 200 μL of magnetic bead suspension (200 μL of PBS containing 2 mM EDTA and 1% BSA plus 2.5 μL of BiotinBinder Dynabeads, purchased from Invitrogen) and incubate at room temperature for 15 minutes.

[0112] (7) Place the tube containing the cell suspension on the magnetic rack. + The cells will bind to the magnetic beads and be adsorbed to the tube wall, thereby removing CD45 + Aspirate the cells that are not attracted to the magnetic beads and transfer them to a new tube.

[0113] (8) Add 200 μL of MHC II antibody working solution (200 μL of PBS containing 2 mM EDTA and 1% BSA plus 2 μL of biotin-conjugated anti-mouse MHC II antibody) and incubate at room temperature for 15 minutes.

[0114] (9) Add 1 mL of PBS, wash once, and centrifuge at 200 g for 1 minute.

[0115] (10) Add 200 μL of magnetic bead suspension (200 μL of PBS containing 2 mM EDTA and 1% BSA plus 2.5 μL of BiotinBinder Dynabeads) and incubate at room temperature for 15 minutes.

[0116] (11) Place the tube containing the cell suspension on the magnetic rack, MHCII + Fat cells will bind to the magnetic beads and be adsorbed on the tube wall. First, the cells that are not adsorbed by the magnetic beads (MHCII - Fat cells) are fully removed, and the remaining MHCII + Adipocytes were washed three times with 2 mM EDTA and 1% BSA in PBS, and the MHCII + Adipocytes and MHCII - Adipocytes were used for subsequent experiments, MHCII - Adipocytes are the cells that express MHCII + The remaining fat cells after fat cell removal can be used to identify MHCII + Comparison with fat cells to explore MHCII+ Characteristics of fat cells.

[0117] Quantitative PCR (qPCR)

[0118] (1) MHCII obtained by magnetic bead sorting + Adipocytes and MHCII - RNA was extracted from adipocytes using the Quick-RNA MicroPrep kit from Zymo.

[0119] (2) Reverse transcription: Reverse transcription was performed using Takara's PrimeScript RT reagent Kit with gDNA Eraser reverse transcription kit.

[0120] (3) qPCR: SYBR Green Master Mix from Yisheng Company was used for qPCR to detect the expression of MHCII complex-related genes H2-Ab1 (F: TGCCATTACCTGTGCCTTAG; R: CCTCCCGGTTGTAGATGTATC), Ciita (F: GATCCTTCCAGCCTTCTCTTC; R: GTTTTGGGACAAGTTGAGCG), and CD74 (F: AAGTACGGCAACATGACCC; R: ATCTTCCAGTTCACGCCATC).

[0121] The above results can be seen Figure 4 .

[0122] 2. Experimental results

[0123] The inventors used the magnetic bead sorting method ( Figure 4 A) Isolation and acquisition of MHCII + Adipocytes and MHCII - Adipocytes were then extracted and cDNA was reversed for qPCR detection, and the results showed that MHCII + The expression of MHCII complex-related genes (H2-Ab1, Ciita, CD74) in adipocytes was significantly increased and much higher than that in MHCII - Fat cells ( Figure 4 B) The above results show that the magnetic bead separation technology of the present invention can be used to separate MHCII + Fat cells are very effective and easy.

[0124] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A specific MHCII clearing + Preparation of genetically engineered mice with adipocytes: (1) Construction of H2-Aa DTR Mice: Gene editing was performed on the H2-Aa gene of C57BL / 6J mice. A -loxP-eGFP-STOP-loxP-DTR-mCherry- fragment was inserted after the last exon of the H2-Aa gene. The loxP site is the sequence recognized and bound by the Cre recombinase, eGFP is enhanced green fluorescent protein, STOP is a transcription termination sequence that can block the transcription of the following gene, DTR is the diphtheria toxin receptor, and mCherry is a red fluorescent protein. Cells expressing the H2-Aa gene in this mouse will express eGFP fluorescent protein but not DTR and mCherry, resulting in H2-Aa DTR Mice; among them, The last exon of the H2-Aa gene is exon 4; (2) H2-Aa DTR aH2-Aa was obtained by crossing mice with Adipoq-cre mice. DTR Mouse: The fat cells of the mouse can express Cre recombinase, which recognizes loxP sites and cuts the DNA sequence between the two loxP sites, and can simultaneously express the H2-Aa gene and the Cre gene, that is, the genetically engineered mouse that can express DTR and mCherry fluorescent protein and can specifically eliminate MHCII+ fat cells, namely aH2-Aa DTR mouse.

2. The method of claim 1 capable of specifically clearing MHC II + The method for preparing genetically engineered mice of fat cells further comprises the following steps: (3) aH2-Aa DTR The mice were obtained by hybridizing with purebred C57BL / 6J mice for 5 generations to purify the genetic background and then purified to specifically eliminate MHCII + Genetically engineered mice with fat cells.

3. A MHCII + Fat cells: The MHCII + Adipocytes are obtained from aH2-Aa in claim 1 or 2 DTR Obtained from mouse adipose tissue by flow cytometry or magnetic bead sorting.

4. The MHC II according to claim 3 + Application of adipocytes in the preparation of products to improve obesity-induced insulin resistance.

5. The MHC II according to claim 3 + Application of adipocytes in the preparation of products to improve obesity-induced Th1 cell infiltration in adipose tissue.

6. The MHC II according to claim 3 + Application of adipocytes in the preparation of products to improve obesity-induced M1 macrophage infiltration in adipose tissue.

Citation Information

Patent Citations

  • Non-alcoholic fatty liver mouse model and construction method thereof

    CN112352739A

  • Construction and application of inducible uterine epithelium specific genetic engineering mouse

    CN113519460A