Recombinant human superoxide dismutase and its preparation method and application

By mutating the human Cu/Zn-SOD gene and adding a membrane-penetrating peptide, recombinant human superoxide dismutase was efficiently expressed using Pichia pastoris, solving the existing problems of SOD source difficulty and degradation, achieving high yield and antioxidant performance, and expanding its application in multiple fields.

CN116103253BActive Publication Date: 2026-04-28HANGZHOU PUTAI BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HANGZHOU PUTAI BIOTECHNOLOGY CO LTD
Filing Date
2023-01-10
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Currently, superoxide dismutase (SOD) is mainly derived from bovine blood, which poses risks of rejection by human products and exogenous infection. Furthermore, natural SOD is difficult to degrade in the gastrointestinal tract, has a large molecular weight, is difficult to prepare, and has limited applications. In addition, the yield of existing recombinant SOD is low, making it difficult to expand the application fields of antioxidant preparations.

Method used

By mutating the Cys112 codon in the human Cu/Zn-SOD gene to the Ser codon, adding a 6×His to the N-terminus and the membrane-penetrating peptide sequence RRQRRQRRQRRQRRR to the C-terminus, recombinant human superoxide dismutase (rhSOD) was efficiently secreted and expressed using Pichia pastoris. The resulting product was purified by Ni-NTA affinity chromatography, ultrafiltration desalting, and cation exchange chromatography.

Benefits of technology

High yield and structural stability of rhSOD were achieved, and it possesses antioxidant properties and cell membrane penetration ability, expanding its application in cosmetics, health products, food and pharmaceuticals. In particular, it has significant effects in scavenging free radicals and inhibiting pro-inflammatory cytokines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116103253B_ABST
    Figure CN116103253B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of recombinant human superoxide dismutase and its preparation method and application.A kind of recombinant human superoxide dismutase, the amino acid sequence of the described recombinant human superoxide dismutase is characterized as SEQ ID NO:1;A kind of preparation method of recombinant human superoxide dismutase, including preparation recombination vector, gene recombination and screening high resistance transformant, induction expression rhSOD;A kind of recombinant human superoxide dismutase in preparation anti-oxidation preparation, the anti-oxidation preparation is the preparation for removing free radical, and inhibiting the release of proinflammatory cytokines IL-6, IL-8 and TNF-alpha.The recombinant human superoxide dismutase of the present application will be inactivated center Cys112 codon in human Cu / Zn-SOD gene Mutated to Ser codon, and 6xHis is added in N-terminal, self-designed transmembrane peptide sequence is added in C-terminal, can guide SOD transmembrane into cell interior, has the advantages of both anti-oxidation performance and cell transmembrane performance, can be widely used in cosmetics, health care products, food and pharmaceuticals and other fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the technical field of superoxide dismutase, and in particular to a recombinant human superoxide dismutase, its preparation method, and its applications. Background Technology

[0002] To eliminate oxygen free radicals in the body, reduce their damage to the matrix, and restore matrix health, antioxidants are often used to remove harmful oxygen free radicals. Existing antioxidants include superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), catalase (CAT), and monoamine oxidase inhibitors. Among them, superoxide dismutase (SOD) is a commonly used enzymatic antioxidant with three major functions: anti-oxidation, anti-aging, anti-inflammation, and radiation protection. It can be widely used in cosmetics, health products, food, and medical fields.

[0003] Currently, domestically produced SOD is mainly extracted from natural organisms. Due to the difficulty in obtaining human blood, its widespread use is not advisable. To address this, Chinese patent CN103272223B discloses an antioxidant health capsule and its preparation method. The capsule, weighing 300g, consists of the following components: 20-30g of 80wt% ginsenoside powder, 0.8-1.5g of bovine blood extract SOD, 15-25g of vitamin C, 25-35g of vitamin E powder, and the remainder being filler. The SOD in this antioxidant is primarily derived from bovine blood and can provide antioxidant effects similar to those of human blood-derived SOD. However, non-human SOD products pose a risk of rejection in humans, and both SOD and human blood-derived SOD carry the risk of exogenous infection, limiting their application in various fields. In addition, natural SOD, as a functional protein, has the advantages of high efficacy, low irritation, low toxicity, high activity and strong specificity. However, oral administration of protein drugs will cause degradation in the gastrointestinal tract, and the gastrointestinal mucosa has poor penetration, large molecular weight, difficult preparation and antigenicity, which need to be improved.

[0004] Therefore, developing a recombinant human superoxide dismutase that possesses both antioxidant and cell-membrane-penetrating properties, and expanding its application in antioxidant preparations, is a pressing issue that needs to be addressed. Furthermore, a method for preparing recombinant human superoxide dismutase needs to be designed to improve its yield. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the first objective of this invention is to provide a recombinant human superoxide dismutase that has the advantages of both antioxidant properties and cell membrane penetration capabilities.

[0006] The second objective of this invention is to provide a method for preparing recombinant human superoxide dismutase, which has the advantages of high efficiency in vitro secretion and expression by Pichia pastoris and high yield.

[0007] The third objective of this invention is to provide an application of recombinant human superoxide dismutase, which expands its application in antioxidant agents.

[0008] To achieve the first objective mentioned above, the present invention provides the following technical solution:

[0009] A recombinant human superoxide dismutase, wherein the amino acid sequence of the recombinant human superoxide dismutase is characterized by SEQ ID NO:1.

[0010] By employing the above-mentioned technical approach, the Cys112 codon, which is the inactive center of the human Cu / Zn-SOD gene, was mutated to the Ser codon (both are hydrophilic neutral amino acids). The cysteine ​​residues at positions 6 and 57 were retained without affecting its activity. However, the mutation of Cys112 can prevent disulfide bond mismatches, thereby improving the stability of its spatial structure. Based on the codon preference of Pichia pastoris, the SOD gene codons were optimized, and a 6×His sequence was added to the N-terminus to facilitate affinity purification. A self-designed transmembrane peptide sequence (RRQRRQRRQRRQRRR, abbreviated as 15RQ) was added to the C-terminus to guide SOD to cross the membrane and enter the cell.

[0011] To achieve the second objective mentioned above, the present invention provides the following technical solution:

[0012] A method for preparing recombinant human superoxide dismutase includes the following steps:

[0013] S1 synthesized the nucleotide sequence SEQ ID NO:2 of the recombinant human superoxide dismutase using artificial whole-genome synthesis and inserted it between the EcoRI and XbaI restriction sites of the pPICZαA vector to obtain the recombinant vector pPICZαA-rhSOD;

[0014] S2 linearizes the recombinant vector obtained in S1 and introduces it into Pichia pastoris to screen for highly resistant transformants;

[0015] The transformant obtained from S2 was cultured in S3 and rhSOD was induced to express. After expression, it was post-processed to obtain the recombinant human superoxide dismutase.

[0016] By adopting the above technical solution, this invention uses recombinant engineered bacteria to express and produce human SOD, and links the artificially designed membrane-penetrating peptide 15RQ (RRQRRQRRQRRQRRR) to SOD. The resulting product has a uniform molecular weight and stable structure. It is expressed in vitro with high efficiency using Pichia pastoris, resulting in a high rhSOD yield. It also solves the problems of difficulty in obtaining human SOD and the risk of exogenous infection in blood products.

[0017] Furthermore, in S3, the temperature for inducing expression is 20~37℃, preferably 20, 25, 30, or 37℃.

[0018] Furthermore, in S3, the post-treatment includes Ni-NTA affinity chromatography, ultrafiltration desalting, pH adjustment, and cation exchange chromatography (SP-Sepharose FF).

[0019] To achieve the third objective mentioned above, the present invention provides the following technical solution:

[0020] The application of a recombinant human superoxide dismutase in the preparation of an antioxidant agent, wherein the antioxidant agent is an agent for scavenging free radicals and inhibiting the release of pro-inflammatory cytokines IL-6, IL-8 and TNF-α.

[0021] Furthermore, the free radicals include DPPH radical (1,1-diphenyl-2-trinitrophenylhydrazine), ABTS radical (2,2'-azido-bis-3-ethylbenzothiazoline-6-sulfonic acid), oxygen radical, and hydroxyl radical.

[0022] Furthermore, the antioxidant is an agent for the prevention or treatment of diseases or conditions associated with IL-6, IL-8, and TNF-α, including cancer, diseases or conditions associated with hypercoagulability, diseases or conditions associated with elevated serum CRP, diseases or conditions associated with hypoalbuminemia, inflammatory conditions, viral conditions, wasting syndrome, autoimmune diseases, or any combination thereof.

[0023] Furthermore, the antioxidant is a preparation used for the prevention or treatment of chronic obstructive pulmonary disease.

[0024] Chronic obstructive pulmonary disease (COPD) is a disease characterized by incompletely reversible airflow limitation, resulting from the combined effects of obliterative bronchiolitis and lung parenchymal destruction. By 2030, COPD is projected to become the third leading cause of death worldwide, after cardiovascular and cerebrovascular diseases and cancer. The prevalence of COPD is as high as 8.2% in people over 40 years of age. COPD not only has a high prevalence but also a high rate of disability and mortality. rhSOD can specifically eliminate harmful free radicals in the body, thereby relieving the damage caused by free radical oxidation of certain components in the body, reducing the oxidative stress response of the body, and inhibiting the release of pro-inflammatory cytokines IL-6, IL-8, and TNF-α, thus reducing the incidence of COPD and achieving the goal of treating and improving COPD.

[0025] And / or, the antioxidant is an agent for the prevention or treatment of leukemia caused by human leukemia cells U937.

[0026] rhSOD can enhance the antioxidant system by scavenging free radicals and inhibiting the release of inflammatory factors, thereby inhibiting endogenous tumor promoters and indirectly inhibiting the proliferation and inducing apoptosis of human leukemia cells U937 without damaging normal tissue cells, thus achieving the purpose of preventing and treating leukemia.

[0027] And / or, the antioxidant is a preparation for treating burns and / or skin inflammation caused by allergies.

[0028] rhSOD works by specifically eliminating harmful free radicals in the body, preventing oxidative damage to mast cells and basophils. This helps alleviate damage caused by free radical oxidation of certain bodily components, such as burns and / or skin inflammation caused by allergies, unlike topical calamine lotion or corticosteroid creams. While corticosteroids have multiple side effects, rhSOD application to the affected area results in healing three times faster than conventional treatments, is gentle and effective, and significantly reduces scarring.

[0029] Furthermore, the antioxidant is one of the following: cosmetics, health products, food, and pharmaceuticals.

[0030] Furthermore, the dosage form of the antioxidant preparation is one of the following: powder, tablet, granule, capsule, microcapsule, pill, drop pill, soft capsule, oral liquid, syrup, dispersible tablet, spray, aerosol, suppository, intravenous injection, intramuscular injection, ointment, inhaler, and gel.

[0031] Furthermore, the antioxidant preparation is in the form of an inhaler, and the antioxidant preparation is made by filling and pressurizing the following raw materials containing parts by weight with propellant carbon dioxide: 1.5 parts recombinant human superoxide dismutase, 5 parts sucrose, 1 part polyethylene glycol, 0.02 parts ethylparaben, 5 parts propylene glycol, and deionized water to 100 parts.

[0032] The recombinant human superoxide dismutase (rhSOD) inhalant of the present invention has the following advantages: (1) The protein structure is more stable and has a good membrane penetration effect, making it easy to enter the cell and play a role in scavenging oxygen free radicals; (2) The drug is sealed in a container, which can keep the drug clean and sterile and increase the stability of the drug; (3) It is convenient to use, and the drug can avoid damage to the gastrointestinal tract and the first-pass effect of the liver, thus improving the bioavailability of the drug; (4) The dosage can be accurately controlled by a metering valve; (5) The external aerosol has little mechanical irritation to the wound when used; (6) For diseases treated locally in the oral cavity, airway and lungs, the drug can directly reach the lesion site, which can reduce the dosage and toxic side effects.

[0033] Alternatively, the antioxidant preparation may be in the form of a spray, and the antioxidant preparation may be made from the following raw materials in parts by weight: 1.0 part recombinant human superoxide dismutase, 5 parts glycerol, 1 part sorbitol, 0.10 part vitamin C, 0.10 part vitamin E, 0.2 part parabens, 0.1 part menthol, 0.1 part fragrance, and 10 mM copper chloride in PBS buffer to 100 parts.

[0034] The present invention has the following advantages by preparing rhSOD into a spray: (1) the drug directly reaches the site of action and has a membrane-penetrating effect, is evenly distributed, and has a fast onset of action; (2) it is convenient to use and has a rapid effect; (3) it can keep the drug clean and sterile and improve the stability of the drug. Since the drug is sealed in an opaque container, it can avoid contact with air, moisture and light, thus reducing the possibility of contamination and deterioration and making it less susceptible to contamination; (4) it does not pass through the gastrointestinal system, thus completely avoiding the destructive effect of the gastrointestinal tract and the first-pass effect of the liver, and improving the bioavailability of the drug; (5) it reduces the pain (such as burns and patients with sensitive skin diseases) and infection of local application; (6) since the drug in the aerosol is sprayed in a mist, it can reduce the irritation to the wound; (7) the sprayed mist particles are small and can directly reach the site of action or absorption, and are evenly distributed, and the dosage is small, so the side effects are also small; (8) the quantitative valve controls the dosage more accurately and can administer single or multiple doses.

[0035] In summary, the beneficial technical effects of the present invention are as follows:

[0036] 1. The recombinant human superoxide dismutase of the present invention mutates the Cys112 codon of the non-active center in the human Cu / Zn-SOD gene to the Ser codon, adds 6×His at the N-terminus, and adds a self-designed transmembrane peptide sequence (RRQRRQRRQRRQRRR, abbreviated as 15RQ) at the C-terminus, which can guide SOD to cross the membrane and enter the cell, and has the advantages of both antioxidant properties and cell transmembrane properties;

[0037] 2. The method of the present invention uses recombinant engineered bacteria to express and produce human SOD, and links the artificially designed membrane-penetrating peptide 15RQ (RRQRRQRRQRRQRRR) to SOD. The resulting product has a uniform molecular weight and stable structure. It uses Pichia pastoris for efficient in vitro secretion expression, resulting in high rhSOD yield. It also solves the problems of difficult source of human SOD and the risk of exogenous infection in blood products.

[0038] 3. This invention expands the application of recombinant human superoxide dismutase in cosmetics, health products, food, and pharmaceuticals in the fields of scavenging free radicals and inhibiting the release of pro-inflammatory cytokines IL-6, IL-8, and TNF-α. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of the structure of the recombinant human superoxide dismutase in Example 1 of the present invention;

[0040] Figure 2 This is a flowchart of the preparation method of Embodiment 2 of the present invention;

[0041] Figure 3 This is an SDS-PAGE electrophoresis image of recombinant human superoxide dismutase eluted with different concentrations of imidazole in Example 3 of the present invention; wherein, M is a protein marker, 1 is eluted with 50mM imidazole, 2 is eluted with 100mM imidazole, 3 is eluted with 200mM imidazole, and 4 is eluted with 300mM imidazole.

[0042] Figure 4 These are (A) electrophoresis and (B) Western-blotting identification diagrams of recombinant human superoxide dismutase expression and purification in Example 3 of this invention; wherein, M is a protein marker, 1 and 4 are supernatants after cell lysis; 2 and 5 are 200mM imidazole elution buffer, and 3 and 6 are 300mM imidazole elution buffer;

[0043] Figure 5 This is a diagram showing the membrane penetration effect of recombinant human superoxide dismutase in Example 3 of the present invention; wherein, a protein concentration of 0.5 mg / ml was used to treat PC12 cells, A and B are 15RQ-SOD-EGFP used to treat PC12 cells (4h, 8h); C and D are SOD-EGFP without the membrane-penetrating peptide used to treat PC12 cells (4h, 8h).

[0044] Figure 6 This is a graph showing the changes in the levels of IL-6, IL-8, and TNF-α in the lung tissue of rats in each group in Example 4 of this invention. Detailed Implementation

[0045] To make the technical means, creative features, objectives and effects of this invention clearer and easier to understand, the invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0046] Example 1: Refer to Figure 1 This invention discloses a recombinant human superoxide dismutase, whose amino acid sequence is SEQ ID NO:1.

[0047] Example 2: Refer to Figure 2 This invention discloses a method for preparing recombinant human superoxide dismutase, which differs from Example 1 in that it includes the following steps:

[0048] S1 synthesized the nucleotide sequence SEQ ID NO:2 of the recombinant human superoxide dismutase using artificial whole-genome synthesis and inserted it between the EcoRI and XbaI restriction sites of the pPICZαA vector to obtain the recombinant vector pPICZαA-rhSOD;

[0049] Specifically, the Cys112 codon, representing the inactive center of the human Cu / Zn-SOD gene, was mutated to the Ser codon (both are hydrophilic neutral amino acids). Cysteine ​​residues at positions 7 and 58 were retained without affecting activity, but the Cys112 mutation prevented disulfide bond mismatches, thus improving the stability of its spatial structure. Based on the codon preference of Pichia pastoris, the rhSOD gene codons were optimized, and SOD was obtained using a whole-gene synthesis method. C112S pUC57-rhSOD C112S The plasmid was prepared, and a 6×His sequence was added to the N-terminus using overlap extension PCR to facilitate affinity purification. A self-designed transmembrane peptide sequence (RRQRRQRRQRRQRRR, or 15RQ for short) was added to the C-terminus to guide SOD transmembrane entry into the cell. Three primers were designed for this purpose:

[0050] Primer 1 (TGAATTCAAAAGACACCATCATCATCATCACATGGCGACCAAAGCAGTTT)

[0051] Primer 2 (CTGTCTGCGCTGTCTTCTTTGCCGTCGTTGGGCGATTCCTATAAC)

[0052] Primer 3 (GTTCTAGATCAACGCCTCCGCTGGCGACGCTGTCTGCGCTGTC)

[0053] The rhSOD gene codon was optimized, and a gene containing SOD was obtained by Sangon Biotech (Shanghai) Co., Ltd. using a whole-genome synthesis method. C112S Recombinant plasmid pUC57-rhSOD of the gene C112S pUC57-rhSOD C112S Using the plasmid as a template, PCR amplification was performed using Primer 1 and Primer 2 to obtain the PCR product 6×His-rhSOD. C112S ; In the PCR product 6×His-rhSOD C112S Using this as a template, PCR amplification was performed using Primer 1 and Primer 3 to obtain 6×His-rhSOD. C112S -15RQ gene fragment;

[0054] EcoRI and XbaI were used to target 6×His-rhSOD C112S The -15RQ gene fragment and the empty vector pPICZαA were double-digested with enzymes, and the digestion products were recovered by gel extraction and ligated with T4 ligase 16. o C was ligated overnight to obtain the recombinant plasmid pPICZαA-rhSOD. C112S ;

[0055] The fusion fragment and the empty vector pPICZαA were double-digested with ECORI and XbaI, respectively. The digestion products were recovered by gel extraction and ligated overnight at 16°C with T4 ligase to obtain the recombinant plasmid pPICZαA-rhSOD.

[0056] S2 linearizes the recombinant vector obtained in S1 and introduces it into Pichia pastoris to screen for highly resistant transformants;

[0057] The recombinant plasmid was digested with Sac I and then transformed into Pichia pastoris X-33 host cells by electroporation (1500 V, 4 mS). The cells were then cultured on YPDS plates containing 0.1 mg / ml Zeocin at 30°C. After single colonies grew, they were screened using gradient concentrations of Zeocin (0.2, 0.4, 0.6, 0.8, 1.0, 1.2 mg / ml) plates. High-resistance clones were retained and identified by colony PCR.

[0058] S3 cultured the transformants obtained from S2 and induced the expression of rhSOD. After expression, post-processing was performed to obtain the recombinant human superoxide dismutase.

[0059] Specific steps for seed culture and scale-up culture in a 300L pilot tank: Pick single clones and inoculate them into four 1L Erlenmeyer flasks containing 250ml of BMGY as primary seed culture, and culture for 17-20 h; then inoculate secondary seed culture into a 30L fermenter at a 1:10 ratio, with an actual volume of 10L, and culture for about 4-8 h. Then, inoculate all 10L of secondary seed culture into the fermenter at a 1:10 ratio (initial fermentation volume is 100L-120L). During fermentation, maintain the following conditions during the initial culture phase: pH 5.0, temperature 30℃, DO > 30%. After dissolved oxygen rises, add 50% glycerol at 10-15 rpm. After dissolved oxygen rises again, begin induction with 100% methanol at 1 rpm. Initially, set the pH to 6.0, keeping other parameters unchanged. Gradually increase the induction rate during the induction process, and add 1% (M:V) of Polypeptone as a protective agent at 0 and 24 hours of induction. Take samples every 2 hours after induction. Induction lasts for 72 hours. At the end of h, the sample was analyzed by SDS-PAGE (and scanned) and protein content was determined.

[0060] The supernatant of the fermentation broth was collected by centrifugation (4℃, 8000 rpm, 30 min), and then subjected to Ni-NTA affinity chromatography (0.5M NaCl, 20mM Tris-HCl, pH 8.0 / 0.4M imidazole, 0.5M NaCl, 20mM Tris-HCl, pH 8.0), 5K ultrafiltration (20mM Tris-HCl, pH 8.0), cation exchange chromatography (SP-Sepharose FF, 20mM Tris-HCl, pH 8.0 / 0.15M NaCl, 20mM Tris-HCl, pH 8.0), 3K ultrafiltration desalting (10mM PBS, pH 7.4), and concentration. The final sample buffer was disodium hydrogen phosphate / sodium dihydrogen phosphate buffer (10mM PB, pH 7.4).

[0061] In S3, the constructed transformants were induced to express at different temperatures (20, 25, 30, 37℃), and the precipitate and supernatant after transformant fragmentation were subjected to protein electrophoresis. The expression product was mainly in the supernatant, with a molecular weight of 19kD, consistent with the theoretical molecular weight. Furthermore, the amount of expressed protein increased with increasing induction temperature.

[0062] Because six His tags were designed at the N-terminus of recombinant human superoxide dismutase, Ni-NTA affinity chromatography can be used, followed by ultrafiltration desalting. The solution pH was adjusted to 8.0. Since the PI of the recombinant protein is 9.2, the recombinant human superoxide dismutase is positively charged. Therefore, SP-Sepharose FF packing material can be used for cation exchange chromatography, followed by ultrafiltration concentration and salt exchange to obtain relatively pure recombinant human superoxide dismutase. The results are as follows... Figure 3 As shown.

[0063] Reference Figure 4 Recombinant human superoxide dismutase was expressed, purified, and then transferred to a membrane, hybridized with primary and secondary antibodies, and then developed. The results showed that there was a very obvious hybridization band at 19kD, which was consistent with the position of the SDS-PAGE band.

[0064] To verify the membrane-penetrating effect of recombinant human superoxide dismutase, PC12 cells were used as a model. Recombinant 15RQ-SOD-EGFP fusion protein diluted with DMEM (SOD-EGF without the membrane-penetrating peptide served as a control) was added to a final concentration of 0.5 mg / ml. Cells were cultured at 37℃ and 5% CO2, and observed under a fluorescence microscope at 4 h and 8 h. Cells were then washed three times with PBS, fixed with 4% paraformaldehyde for 15 min, permeabilized with PBS (v / v) containing 0.5% Triton X for 5 min, stained with 0.1 μg / ml DAPI for 1 min, washed with PBS, and the entry of the recombinant protein into the cells was observed under a fluorescence microscope. Observations showed that some cells emitted green fluorescence after 4 h, and the intracellular green fluorescence significantly increased after 8 h. However, SOD-EGFP without the membrane-penetrating peptide did not exhibit green fluorescence. Figure 5 As shown, this indicates that 15RQ-SOD has a good membrane penetration effect.

[0065] Example 3: This example illustrates the application of the recombinant human superoxide dismutase disclosed in this invention in the preparation of antioxidant agents. The difference from Example 2 is that the antioxidant agent is used to scavenge free radicals and inhibit the release of pro-inflammatory cytokines IL-6, IL-8, and TNF-α.

[0066] Among them, free radicals include DPPH radical (1,1-diphenyl-2-trinitrophenylhydrazine), ABTS radical (2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid), oxygen radical and hydroxyl radical.

[0067] Antioxidants are preparations used to prevent or treat diseases or conditions associated with IL-6, IL-8, and TNF-α. Diseases or conditions include cancer, diseases or conditions associated with hypercoagulability, diseases or conditions associated with elevated serum CRP, diseases or conditions associated with hypoalbuminemia, inflammatory conditions, viral conditions, wasting syndrome, autoimmune diseases, or any combination thereof.

[0068] Antioxidants are a type of product found in cosmetics, health supplements, food, and pharmaceuticals.

[0069] Antioxidant preparations are available in one of the following dosage forms: powder, tablet, granule, capsule, microcapsule, pill, drop pill, soft capsule, oral liquid, syrup, dispersible tablet, spray, aerosol, suppository, intravenous injection, intramuscular injection, ointment, inhaler, and gel.

[0070] Example 4: This example illustrates the application of the recombinant human superoxide dismutase disclosed in this invention in the preparation of an antioxidant preparation. The difference from Example 3 is that the antioxidant preparation is used for the prevention or treatment of chronic obstructive pulmonary disease.

[0071] The antioxidant preparation is in the form of an inhaler, which is made by filling and pressurizing the following raw materials with propellant carbon dioxide in parts by weight: 1.5 parts recombinant human superoxide dismutase, 5 parts sucrose, 1 part polyethylene glycol, 0.02 parts ethylparaben, 5 parts propylene glycol, and deionized water to 100 parts.

[0072] The preparation steps of the above-mentioned recombinant human superoxide dismutase inhaler include:

[0073] 1) Equipment and raw material pretreatment;

[0074] 2) Quality inspection and control of raw and auxiliary materials; preparation of propellants and sterile water for injection; handling and assembly of containers and valve systems;

[0075] 3) Preparation of the main components;

[0076] 4) Weighing and preparation;

[0077] 5) Canning;

[0078] 6) Packaging of propellants;

[0079] 7) The jointing of the lid;

[0080] 8) Leakage check; weight and pressure check; product packaging.

[0081] Utilizing the antioxidant properties of human superoxide dismutase inhalers, this study aims to treat or improve chronic obstructive pulmonary disease by relieving or reducing oxidative stress. Anti-inflammatory performance was assessed, and the test data are as follows: Figure 6 As shown.

[0082] Normal group: 8-week-old mice were selected and fed normally.

[0083] COPD mouse model: Eight-week-old mice were selected and exposed to smoke for 3 hours a day, 7 days a week, for a total of 2 weeks to establish a COPD mouse model.

[0084] Experimental groups: Except for the control group, which received nebulized saline, the other eight groups received the rhSOD inhaler of this invention. The levels of inflammatory factors in the lungs of mice in each group were measured 3 days after inhalation treatment.

[0085] Results: Compared with the normal group, the levels of pro-inflammatory cytokines IL-6, IL-8, and TNF-α in the lung tissue homogenate of the model group were significantly increased (P<0.01); compared with the model group, the levels of IL-8 and TNF-α in the lung tissue homogenate of the rhSOD treatment group were significantly decreased (P<0.01).

[0086] Example 5: This example illustrates the application of the recombinant human superoxide dismutase disclosed in this invention in the preparation of an antioxidant preparation. The difference from Example 3 is that the antioxidant preparation is used to prevent or treat leukemia caused by human leukemia cells U937.

[0087] The antioxidant preparation is in the form of a spray, which is made from the following raw materials in parts by weight: 1.0 part recombinant human superoxide dismutase, 5 parts glycerol, 1 part sorbitol, 0.10 part vitamin C, 0.10 part vitamin E, 0.2 parts parabens, 0.1 part menthol, 0.1 part fragrance, and 10 mM copper chloride in PBS buffer to 100 parts.

[0088] The preparation steps of the above-mentioned recombinant human superoxide dismutase spray include,

[0089] 1) Raw material pretreatment: preparation of sterile water for injection, quality inspection and control of raw materials;

[0090] 2) Pretreatment of containers: Clean the emulsification pot thoroughly, sterilize and dry it for later use; sterilize and disinfect the spray bottles;

[0091] 3) Weighing and preparation (concentrated and diluted preparation);

[0092] 4) Filtration: The material is filtered using an 800-mesh filter cloth. pH and content are then measured.

[0093] 5) Filling and sealing: Clarity and sample quantity testing; leak detection; light inspection; outer packaging.

[0094] The proliferation of leukemia cells U937 was inhibited by recombinant human superoxide dismutase spray, and the detection data are shown in Table 1.

[0095] Human leukemia U937 cells were cultured and passaged in a 37°C incubator containing 5% CO2, using RMPI-1640 medium containing 10% fetal bovine serum and 100 U / ml penicillin and 100 U / ml streptomycin. Cells were then passaged by digestion with 0.25% trypsin and 0.02% EDTA. Logarithmic growth phase U937 cells were digested with trypsin and directly diluted to the appropriate concentration, then seeded into 96-well plates at 100 μL per well. The next day, 3000 U / ml rhSOD and the corresponding fresh medium were added at 100 μL per well, with a solvent control group included. Each group had at least three parallel wells. After culturing at 37°C for 48 h, 20 μL of 5 mg / ml MTT solution was added to each well. The culture medium in the wells was removed by centrifugation, and then 100 μL of DMSO was added. The mixture was shaken at room temperature for 15 min to dissolve the intracellular formazan crystals in DMSO and transfer them to the extracellular space, staining the colorless DMSO blue-purple. The optical density (OD) of each well was measured at 490 nm using a spectrophotometer. The cell viability of each well can be represented by the optical density (OD) value. Cell proliferation rate % = (absorbance of experimental group / absorbance of control group) * 100%; inhibition rate (%) = (average OD value of control group - average OD value of drug group) / average OD value of control group * 100%. The OD value was measured using a microplate reader at a reference wavelength of 630 nm and a detection wavelength of 570 nm. Tumor cells treated with solvent control were used as the control group.

[0096] Table 1

[0097] 48 h, U937 proliferation rate (%) 96 h, U937 proliferation rate (%) control group 100±1.9 100±2.1 rhSOD experimental group 42.1±1.7 25±1.5 Inhibition rate % 57.9% 75 %

[0098] Results: The proliferation rate of U937 leukemia cells in the control group was higher than that in the rhSOD-treated group; with the extension of treatment time, the inhibition rate of U937 cell proliferation by rhSOD showed an increasing trend. rhSOD can significantly inhibit the proliferation of U937 leukemia cells.

[0099] Example 6: This example illustrates the application of the recombinant human superoxide dismutase disclosed in this invention in the preparation of an antioxidant preparation. The difference from Example 3 is that the antioxidant preparation is for treating burns and / or skin inflammation caused by allergies. Applying rhSOD to the affected area resulted in healing three times faster than conventional treatments; it was gentle yet effective, and significantly reduced scarring.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

[0101] sequence list

[0102] <110> Hangzhou Putai Biotechnology Co., Ltd.

[0103] <120> A recombinant human superoxide dismutase, its preparation method and application

[0104] <130> 2022

[0105] <160> 2

[0106] <170> PatentIn version 3.5

[0107] <210> 1

[0108] <211> 175

[0109] <212> PRT

[0110] <213> Artificial Sequence

[0111] <400> 1

[0112] His His His His His Met Ala Thr Lys Ala Val Cys Val Leu Lys 1 5 10 15

[0114] Gly Asp Gly Pro Val Gln Gly Ile Ile Asn Phe Glu Gln Lys Glu Ser 20 25 30

[0116] Asn Gly Pro Val Lys Val Trp Gly Ser Ile Lys Gly Leu Thr Glu Gly 35 40 45

[0118] Leu His Gly Phe His Val His Glu Phe Gly Asp Asn Thr Ala Gly Cys 50 55 60

[0120] Thr Ser Ala Gly Pro His Phe Asn Pro Leu Ser Arg Lys His Gly Gly 65 70 75 80

[0122] Pro Lys Asp Glu Glu Arg His Val Gly Asp Leu Gly Asn Val Thr Ala 85 90 95

[0124] Asp Lys Asp Gly Val Ala Asp Val Ser Ile Glu Asp Ser Val Ile Ser 100 105 110

[0126] Leu Ser Gly Asp His Ser Ile Ile Gly Arg Thr Leu Val Val His Glu 115 120 125

[0128] Lys Ala Asp Asp Leu Gly Lys Gly Gly Asn Glu Glu Ser Thr Lys Thr 130 135 140

[0130] Gly Asn Ala Gly Ser Arg Leu Ala Cys Gly Val Ile Gly Ile Ala Gln 145 150 155 160

[0132] Arg Arg Gln Arg Arg Gln Arg Arg Gln Arg Arg Gln Arg Arg Arg 165 170 175

[0134] <210> 2

[0135] <211> 528

[0136] <212> DNA

[0137] <213> Artificial Sequence

[0138] <400> 2

[0139] caccatcatc atcatcacat ggcgaccaaa gcagtttgtg tacttaaggg cgacggccca 60

[0140] gtacaggaa ttataattt tgagcagaa gatccaacg gcccggtcaa ggtgtggggg 120

[0141] tcaatcaag gggctgactga gggactacac ggatttcacg tacatgagtt cggtgataac 180

[0142] actgcgggct gcacctcggc aggtccacac ttcaaccct tgagcagga gcatggtggt 240

[0143] cctaaggacg agagcgaca cgtcggggat ttaggtatg tcacagccga caggacggt 300

[0144] gtcgctgacg tgtcaattga agactccgtt atttcgttgt ctggcgatca tagcatcata 360

[0145] ggccgtacat tagtggttca cgagaaagca gatgatctgg ggaaaggggg aatgaagaa 420

[0146] tctacgaaaa cgggaaatgc tggcagtcgg ctcgcgtgtg gggttatagg atcgcccaa 480

[0147] cgacggcaaa gagacagcg cagacagcgt cgccagcgga ggcgttga 528

Claims

1. A recombinant human superoxide dismutase, characterized in that: The amino acid sequence of the recombinant human superoxide dismutase is SEQ ID NO:

1.

2. The method for preparing recombinant human superoxide dismutase according to claim 1, characterized in that: Includes the following steps, S1 synthesized the nucleotide sequence SEQ ID NO:2 of the recombinant human superoxide dismutase using artificial whole-genome synthesis and inserted it between the EcoRI and XbaI restriction sites of the pPICZαA vector to obtain the recombinant vector pPICZαA-rhSOD; S2 linearizes the recombinant vector obtained in S1 and introduces it into Pichia pastoris to screen for highly resistant transformants; The transformant obtained from S2 was cultured in S3 and rhSOD was induced to express. After expression, it was post-processed to obtain the recombinant human superoxide dismutase.

3. The application of the recombinant human superoxide dismutase according to claim 1 in the preparation of antioxidant agents, characterized in that: The antioxidant is a formulation used to scavenge free radicals and inhibit the release of pro-inflammatory cytokines IL-6, IL-8 and TNF-α.

4. The application of the recombinant human superoxide dismutase according to claim 3, characterized in that: The free radicals include DPPH free radicals, ABTS free radicals, oxygen free radicals, and hydroxyl free radicals.

5. The application of the recombinant human superoxide dismutase according to claim 4, characterized in that: The antioxidant preparation is a preparation for the prevention or treatment of chronic obstructive pulmonary disease, leukemia caused by human leukemia cells U937, skin inflammation caused by burns and / or allergies, or any combination thereof.

6. The application of the recombinant human superoxide dismutase according to claim 3, characterized in that: The antioxidant is one of the following: cosmetics, food, and pharmaceuticals.

7. The application of the recombinant human superoxide dismutase according to claim 3, characterized in that: The antioxidant preparation is a health supplement.

8. The application of the recombinant human superoxide dismutase according to claim 3, characterized in that: The dosage form of the antioxidant preparation is one of the following: powder, tablet, granule, microcapsule, pill, soft capsule, oral liquid, syrup, dispersible tablet, spray, aerosol, suppository, intravenous injection, intramuscular injection, ointment, inhaler, and gel.

9. The application of the recombinant human superoxide dismutase according to claim 8, characterized in that: The antioxidant preparation is in the form of an inhaler. The antioxidant preparation is made by filling and pressing in carbon dioxide propellant into raw materials containing the following parts by weight: 1.5 parts recombinant human superoxide dismutase, 5 parts sucrose, 1 part polyethylene glycol, 0.02 parts ethylparaben, 5 parts propylene glycol, and deionized water to 100 parts.

10. The application of the recombinant human superoxide dismutase according to claim 8, characterized in that: The antioxidant preparation is in the form of a spray, and is made from the following raw materials in parts by weight: 1.0 part recombinant human superoxide dismutase, 5 parts glycerol, 1 part sorbitol, 0.10 part vitamin C, 0.10 part vitamin E, 0.2 part parabens, 0.1 part menthol, 0.1 part fragrance, and 10 mM copper chloride in PBS buffer to 100 parts.

Citation Information

Patent Citations

  • Oxidation prevention health care capsule and preparation method thereof

    CN103272223B

  • Recombinant superoxide dismutase as well as construction method and application thereof

    CN113321742A

  • Preparation and application of human superoxide dismutase hSOD1 mutant

    CN114480445A