Methods for simultaneous preparation of D-allulose and D-allulose 3-epimerase and their applications

Abstract

This invention relates to the field of microbial fermentation and discloses a method for simultaneously preparing D-allulose and D-allulose 3-epimerase (DPEase) and its applications. The method preferably utilizes inexpensive waste molasses as a carbon source, based on a self-constructed DPEase expression strain, and employs online feeding, determining the feeding time and flow rate based on changes in dissolved oxygen and pH in the culture system. While achieving high-density fermentation, this invention simultaneously obtains D-allulose and highly active DPEase through a "one-pot" method. When using waste molasses as a carbon source, the D-allulose concentration can reach above 15 g / L, and the DPEase enzyme activity can reach above 800 U / mL, achieving low-cost and high-efficiency production of DPEase while simultaneously obtaining a high yield of D-allulose.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation, specifically to a method for the simultaneous preparation of D-allulose and D-allulose 3-epimerase and its application. Background Technology

[0002] D-Allulose is the C-3 epimer of D-fructose and is a rare monosaccharide found in small quantities in nature. Allulose tastes similar to sucrose, and its processing and textural properties are also nearly identical. Recent studies have shown that allulose has beneficial effects in antioxidation, blood sugar control, and obesity prevention, making it one of the most promising sucrose alternatives.

[0003] However, the chemical synthesis of D-allulose is difficult, produces numerous byproducts, and poses safety concerns for food production. Therefore, D-allulose is currently primarily prepared through biotransformation. This involves collecting D-allulose 3-epimerase (DPEase) secreted by microbial expression vectors, and then using DPEase to catalyze the conversion of D-fructose to obtain D-allulose. Consequently, research on the efficient expression of DPEase is a current hot topic in allulose production. For example, Jiangnan University established DPEase strains from different Clostridium sources and conducted in-depth studies on the catalytic effects of the constructed and expressed enzymes. However, this production process, which involves DPEase production followed by D-allulose conversion, is lengthy and involves enzyme preservation, packaging, and transportation, placing high demands on the entire production chain. Furthermore, although some researchers have developed engineered bacterial strains capable of heterologously expressing DPEase, their expression efficiency or enzyme activity in production remains unsatisfactory. In addition, the existing culture of engineered bacteria generally uses conventional commercially available culture media, which are costly for large-scale production and are not conducive to large-scale and industrial-scale promotion.

[0004] Achieving one-step conversion of allulose is one effective way to solve the problem of long processing times mentioned above. For example, the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, developed a Bacillus subtilis heterologous expression system with the DPEase gene inserted from Ruminococcus, and through full-pathway metabolic engineering, formed a process for the direct synthesis of D-allulose. However, the stability of the strains used in this method still needs to be verified, the production performance needs to be improved, and the problem of culture cost remains unresolved. Summary of the Invention

[0005] The purpose of this invention is to overcome the problems of unsatisfactory DPEase expression efficiency or enzyme activity, difficulty in enzyme solution preservation and transportation, high production costs, long process flow, and high requirements for the industrial chain in the production of allulose. This invention provides a method for the simultaneous preparation of D-allulose and D-allulose 3-epimerase, and its applications. The method provided by this invention has advantages such as short production cycle, easy process control, and high efficiency in D-allulose 3-epimerase expression.

[0006] To achieve the above objectives, the present invention provides a method for preparing D-allulose and D-allulose 3-epimerase. The method includes inoculating engineered bacteria into a culture medium for cultivation to obtain a culture medium containing D-allulose and D-allulose 3-epimerase. The carbon source in the culture medium provides both the carbohydrates required for the growth and metabolism of the engineered bacteria and the substrate for the enzymatic reaction of D-allulose 3-epimerase to obtain D-allulose.

[0007] The second aspect of the present invention provides D-allulose and D-allulose 3-epimerase prepared by the method described above.

[0008] A third aspect of the present invention provides the application of the method described above in the industrial production of D-allulose and / or D-allulose 3-epimerase.

[0009] Through the above technical solution, the present invention can achieve the following beneficial effects:

[0010] (1) In the method provided by the present invention, the culture medium components simultaneously provide nutrient support to the engineered bacteria and provide substrate for the enzymatic conversion of D-allulose, thereby realizing the "one-pot production" of D-allulose 3-epimerase and D-allulose.

[0011] (2) The preferred engineered bacterial strain of this invention can utilize some components of molasses (reducing sugars such as sucrose and glucose) to grow and efficiently express D-allulose 3-epimerase. The fructose component in molasses can be used as a raw material for the production of D-allulose. The DPEase expressed by this strain is converted into D-allulose. Based on the "one-pot production" of D-allulose 3-epimerase and D-allulose, the utilization rate of raw materials is improved, the raw material cost is reduced, and the culture medium preparation process for the bioconversion method to produce allulose and DPEase is simplified. This achieves the high-value conversion of effective components in molasses in one step. Moreover, molasses is widely available and inexpensive. Using it as the main raw material greatly reduces production costs. At the same time, it makes reasonable use of by-products of the sugar industry, improves the industrial structure, and is very suitable for large-scale promotion and application.

[0012] (3) In the preferred method provided by the present invention, the culture process is divided into two stages, growth and expression, by controlling the culture temperature, which takes into account both the growth and enzyme production efficiency of the engineered bacteria and results in a shorter production cycle. At the same time, by regulating the conditions throughout the culture process, the expression of D-allulose 3-epimerase is made more efficient.

[0013] (4) In the preferred method provided by the present invention, feeding is implemented and controlled according to the changes in pH value and dissolved oxygen in the culture system. Compared with the most commonly used method based on the residual amount of raw materials such as reducing sugar, it can achieve the purpose of "low-frequency sampling and accurate detection", simplify the control and management process in the production process, and make it easier to realize industrial production. Detailed Implementation

[0014] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0015] In this invention, "DPEase" is the abbreviation for "D-allulose 3-epimerase". The two terms have the same meaning and can be used interchangeably.

[0016] In this invention, unless otherwise specified, "fructose" refers to D-fructose and "alokulose" refers to D-alokulose.

[0017] In this invention, "molasses" refers to a byproduct of the sugar industry, specifically the viscous liquid residue that cannot be further concentrated and crystallized after repeated concentration and separation of crystallized sugars during the sugar-making process. Industrially, it is also known as "waste molasses." It is typically brown, dark brown, or blackish-brown. Depending on the raw materials, it can be further classified into several types, such as sugarcane molasses, beet molasses, glucose molasses, and corn molasses. Unless otherwise specified, "molasses" and "waste molasses" have the same meaning and can be used interchangeably.

[0018] In this invention, unless otherwise specified, the term "culture process" refers to the entire culture process from the inoculation of engineered bacteria to the end of the culture.

[0019] The inventors of this invention ingeniously discovered during their research that when engineered bacteria are used for DPEase expression and production, if a DPEase conversion substrate (such as fructose) is present in the culture system, the enzymatic reaction of converting the conversion substrate in the culture medium into allulose can be completed simultaneously with the expression of DPEase by the engineered bacteria, thus achieving the simultaneous preparation of DPEase and allulose. Furthermore, since DPEase exists within the bacterial cells while allulose dissolves in the fermentation broth, DPEase and allulose in the fermentation broth can be separated through simple solid-liquid separation. Further purification processes then yield the corresponding products.

[0020] The present invention provides a method for simultaneously preparing D-allulose and D-allulose 3-epimerase. The method includes inoculating engineered bacteria into a culture medium for cultivation to obtain a culture solution. The carbon source in the culture medium can provide both the sugars required for the growth and metabolism of the engineered bacteria and the substrates for the enzymatic reaction of D-allulose 3-epimerase to obtain D-allulose.

[0021] In this invention, there are no particular restrictions on the specific components and content of each component of the culture medium, as long as the carbon source in the culture medium has the aforementioned characteristics and can be utilized by engineered bacteria to achieve the purpose of simultaneous production of D-allulose and DEPase.

[0022] Considering factors such as bacterial growth and DEPase expression efficiency, according to a preferred embodiment of the present invention, the culture medium comprises a carbon source, a nitrogen source, inorganic salts, and water. Preferably, the carbon source contains fructose (used as a conversion substrate) and sugars (e.g., sucrose, glucose, glycerol, etc.) required for the growth and metabolism of the engineered bacteria. More preferably, the carbon content provided by the sugars in the carbon source in the culture medium is 4-15 g / L. The "sugars" include sugars required for the growth and metabolism of the engineered bacteria and fructose (a reaction substrate for the enzymatic reaction of D-allulose-3-epimerase). Furthermore, depending on the characteristics and needs of the engineered bacteria used, the carbon source may contain other substances that can be used as a carbon source during microbial culture (e.g., oils, organic acids, organic acid esters, small molecule alcohols, etc.) in addition to the aforementioned sugars.

[0023] According to a preferred embodiment of the present invention, the carbon source may be sucrose and / or a mixture of glucose and fructose. Preferably, it is a mixture of sucrose, glucose, and fructose.

[0024] In order to achieve higher allulose yield while ensuring DEPase production and productivity, and to balance the carbon source required for growth metabolism with the substrate (fructose) required for enzymatic reactions, preferably, the weight ratio of sucrose and / or glucose to fructose in the carbon source is 3-5:1.

[0025] Preferably, the weight ratio of sucrose, glucose and fructose in the carbon source is 2-5:1-2:1.

[0026] More preferably, the weight ratio of sucrose, glucose and fructose in the carbon source is 2-3.5:1-1.5:1.

[0027] Molasses is a byproduct of the sugar industry, inexpensive and widely available. It contains various sugars (such as sucrose, glucose, and fructose), resulting in a high total sugar content. Molasses also contains small amounts of crude protein, colloidal substances, minerals, and ash. These components do not adversely affect the growth of engineered bacteria during cultivation, and some can even be utilized by the bacteria. Furthermore, molasses contains substances like biotin that promote the growth of engineered bacteria. The inventors of this invention ingeniously discovered during their research that using molasses as a (primary) carbon source to cultivate certain engineered bacteria not only improves the growth of the bacteria but also achieves efficient expression of DEPase without the addition of other substances that promote the expression of exogenous proteins (such as DEPase). In addition, the fructose in molasses can be converted into allulose during the cultivation process.

[0028] According to another preferred embodiment of the present invention, the carbon source is molasses.

[0029] Preferably, the molasses contains 45-55% by weight total sugar, 2-3% by weight crude protein, 3-10% by weight soluble colloids, 10-15% by weight ash, 3-10% by weight minerals, and 2.5-3.5% by weight biotin. In addition, the molasses also contains a certain amount of water, preferably 20-30% by weight.

[0030] More preferably, the molasses contains 46-52% by weight of total sugar, 2-3% by weight of crude protein, 3-10% by weight of soluble colloids, 10-15% by weight of ash, 3-10% by weight of minerals, 2.7-3.2% by weight of biotin, and 24-26% by weight of moisture.

[0031] In this invention, there are no particular restrictions on the source and type of molasses. It can be any one or a combination of any of the common molasses in the sugar industry, such as sugarcane molasses, beet molasses, glucose molasses, and corn molasses, as long as it has the above-mentioned characteristics.

[0032] According to a preferred embodiment of the present invention, the nitrogen source content in the culture medium is 2-5 g / L (calculated as N element).

[0033] In this invention, there are no particular restrictions on the specific selection of the nitrogen source; any existing nitrogen source used for microbial culture in the art can be used in this invention. Preferably, the nitrogen source is selected from at least one of yeast powder, peptone, corn steep liquor, cottonseed protein, fish paste (preferably deep-sea fish paste, such as tuna paste), and soybean meal hydrolysate.

[0034] In this invention, the inorganic salts in the culture medium are used to provide the nutrients required for the growth of engineered bacteria and / or the expression of DPEase. According to a preferred embodiment of the invention, the inorganic salts in the culture medium are used to provide at least one of K, P, S, and Mg.

[0035] More preferably, in the culture medium, the inorganic salts provide K 5.5-8 g / L, P 3-4.5 g / L, S 0.3-0.8 g / L, and Mg 0.1-0.3 g / L.

[0036] Any inorganic salt possessing the above-mentioned characteristics and capable of being used for microbial culture and exogenous protein expression is applicable to this invention. Preferably, the inorganic salt includes at least one of K2HPO4, KH2PO4, (NH4)2SO4, and MgSO4.

[0037] In this invention, there are no particular restrictions on the engineered bacteria, as long as the strain can produce DPEase using the above-mentioned culture medium and can convert the conversion substrate (fructose) in the culture medium into allulose.

[0038] According to a preferred embodiment of the present invention, the engineered bacteria are selected from genetically engineered Bacillus species. Preferably, they are genetically engineered Bacillus subtilis.

[0039] Preferably, the Bacillus subtilis contains the sequence shown in SEQ ID NO:1 (i.e., the nucleotide sequence of the DPEase encoding gene introduced through genetic engineering).

[0040] ATGAACAAGATCGGAGTTCATTTTGGATATTTTAACAGAGATTGGAACACAGATTTCATTAAAAGAATCGAACAGGTTAAGAAGATCGGACTGGATATTCTTGAAGTGGCACCGGCACCGCTGCTTGCACTTACAAAATTTCAGAGAGATGAAATTGCAGCAGCGGCAAAAGCAAATGATATTGAACTGACATTTAGCGTGGGACTTAGCGCAAATCAAGATCTTGCGAGCGAAGATGAAGAAATTAGAAAAAATGGAATCAAGTTCACGACAGATACATTTCAGATTATGTCAGAAATGGGAGGAAAAACATATAGCGGCGTTGATATTGCAGCGTGGAATAAAACATTTATGGAAGGAATTACGGACAAATCAGCAACATGGGAAAGATCAATTAGCGCGGTTAAAGAAATTATGAAAGTTGCAGAAGACAAGGGAATTACATTTGCGGTTGAAGTTGTTAATAGATATGAATCAAGCCTTGTGAATACAGCAGAAGAAGCAGTTAAATATGTGGATGAAGTTGGAAGCCCGAATTGTAAAATTCTTCTTGATACATACCACATGAACATTGAAGAAGATAGCTTTGCGGGCGCGATTAAACTGGTGGGCAATAGACTTGGCCATTTTCATGTTGGAGAAAGCAATAGAAGACCGCCGTGTGAAAATGGAAAAATGCCGTGGAATGAAATTACAAATGCACTTAAAGAGATCGATTACCAAGGAGCGATTGTGATGGAACCGTTTATTAAAATGGGCGGAGAAGTTGGCAGAGATATTAAAGTGTGGAGAGATATTAGCGAAGGCGCGTCAGAAAGCGAAATGGAACAGCTTCTTGCAGATGCAGCAATGATGCTGAGAAAAAAAATGCAAAGACATCATCATCACCATCATTAA(SEQ IDNO:1)

[0041] More preferably, the Bacillus subtilis is (genetically engineered) Bacillus subtilis 1012.

[0042] The inventors of this invention also discovered that by controlling the culture temperature, it is possible to regulate both bacterial growth efficiency and exogenous protein expression efficiency, dividing the entire culture process into two parts: growth culture and expression culture. This allows for efficient bacterial proliferation during the growth culture stage and efficient expression of DPEase during the expression culture stage. Through further research, the inventors of this invention have further improved the simultaneous production efficiency of DPEase and allulose by switching the culture stages at specific times.

[0043] It is important to note that in this invention, "growth culture (stage)" and "expression culture (stage)" are merely naming conventions to facilitate the description of stages using different culture conditions during the culture process, and do not represent the culture state of the bacteria at the corresponding culture stages (for example, in the growth culture stage, the bacteria do not only grow and proliferate). Since the aforementioned preferred strains used in this invention are constitutive expression strains, they can efficiently express the inserted exogenous DPEase gene without induction. Therefore, in practice, the growth culture stage involves adjusting the culture conditions to be more suitable for bacterial growth, promoting faster bacterial proliferation. However, DPEase expression also occurs simultaneously during this process, although the expression efficiency and amount are far less than in the expression culture stage. Similarly, the culture conditions in the expression culture stage are more suitable for DPEase expression, but the bacteria also grow and proliferate during this process, just at a much slower rate than in the growth culture stage. Furthermore, the enzymatic conversion of fructose in the culture medium to generate allulose occurs in both the growth and expression culture stages, but the allulose conversion amount and rate are higher in the expression culture stage.

[0044] According to a preferred embodiment of the present invention, the cultivation method includes inoculating the engineered bacteria into a culture medium, performing growth culture under growth culture conditions, and then performing expression culture under expression culture conditions.

[0045] Preferably, the inoculum size of the engineered bacteria is such that the initial OD of the engineered bacteria in the growth culture system is [value missing]. 600 The value reaches 0.05-0.5.

[0046] Preferably, the growth and culture conditions include: temperature 35-37℃, pH 6.9-7.1, initial stirring rate such that the linear velocity of the stirring blade tip is 40-60m / s, aeration rate of 0.5-1.2vvm, and dissolved oxygen content maintained above 30% during the culture process.

[0047] As the number of bacteria increases during cultivation, the nutrients in the culture medium are continuously consumed, causing changes in pH and dissolved oxygen levels. To maintain dissolved oxygen levels above 30% during cultivation, the method provided by this invention preferably includes a step of adjusting the aeration rate and / or stirring speed to regulate the dissolved oxygen level in the culture system.

[0048] Specifically, the regulation method may include: when the dissolved oxygen content in the culture system is below 30%, increasing the stirring speed and / or aeration rate to increase the dissolved oxygen content; when the dissolved oxygen content in the culture system is too high (e.g., exceeding 75%), decreasing the stirring speed and / or aeration rate. Preferably, during the regulation process, the stirring speed is controlled within a range of 40-60 m / s, resulting in a stirring impeller tip linear velocity. Preferably, the aeration rate is controlled within a range of 0.5-1.2 vvm.

[0049] To improve production efficiency, expression culture is preferably carried out in the middle and late stages of fermentation. The "middle and late stages of fermentation" refers to the middle and late stages of the entire culture process.

[0050] More preferably, the middle and late stages of fermentation occur when the engineered bacteria in the culture system reach the logarithmic growth phase.

[0051] More preferably, the middle and late stages of fermentation can be 6-15 hours after the start of the initial culture.

[0052] Preferably, the culture temperature for expression culture is 5-10°C lower than the culture temperature for initial culture.

[0053] Apart from temperature, this invention does not impose particular limitations on pH, stirring speed, and aeration rate in the expression culture conditions. According to a preferred embodiment of the invention, the expression culture conditions include a temperature of 25-30°C and dissolved oxygen levels maintained above 30%.

[0054] Preferably, the expression culture process also includes the regulation of dissolved oxygen levels. The regulation method is the same as that described above.

[0055] According to a preferred embodiment of the present invention, the method further includes feeding during the cultivation process.

[0056] Preferably, the feeding method is feed-in feeding.

[0057] Preferably, the feed solution contains sugars necessary for the growth and metabolism of the engineered bacteria, as well as an enzymatic reaction substrate for obtaining D-allulose via D-allulose 3-epimerase. That is, the feed solution contains the carbon source as described above.

[0058] According to a preferred embodiment of the present invention, the feed solution used is an aqueous solution of sucrose and / or glucose and fructose. More preferably, it is an aqueous solution of sucrose, glucose and fructose.

[0059] According to another preferred embodiment of the present invention, the feed liquid used is molasses (concentrated liquid). That is, the molasses used for feeding does not contain any additional water (or any other additional substances).

[0060] In this invention, the feed solution used for the replenishment can be the same as or different from the carbon source in the culture medium. For example, when using a mixture of sucrose and / or glucose and fructose as the carbon source, either an aqueous solution of sucrose and / or glucose and fructose can be used as the feed solution, or molasses (stock solution) can be used, and vice versa. Considering production costs and efficiency, molasses (stock solution) is preferred as the feed solution.

[0061] The inventors of this invention ingeniously discovered during their research that the timing and rate of feed addition can be determined by observing changes in pH and dissolved oxygen levels within the culture system. This avoids the frequent sampling and testing required when using the remaining amount of raw materials such as reducing sugars as a reference, simplifying the control and management process during production.

[0062] According to a preferred embodiment of the present invention, the method further includes a step of initiating feeding based on changes in dissolved oxygen levels in the culture system.

[0063] Preferably, feeding is initiated when the dissolved oxygen level in the culture system gradually decreases and then suddenly increases sharply.

[0064] Specifically, during the cultivation process, the dissolved oxygen level in the culture system will slowly decrease from its initial level. When it drops to 30%, the stirring speed and / or aeration rate are adjusted as described above to maintain the dissolved oxygen level at 30% (i.e., the dissolved oxygen level is controlled to ensure it does not fall below 30%). Subsequently, the dissolved oxygen level in the culture system will experience a sharp increase, suddenly rising to a higher level (e.g., above 75%) within a very short time (sometimes almost instantaneously). When this sudden increase in dissolved oxygen occurs, feeding is initiated.

[0065] More preferably, when the dissolved oxygen content of the culture system increases from 30% to over 75% within 10-60 seconds, feeding should be started immediately.

[0066] According to a preferred embodiment of the present invention, the feeding method further includes controlling the flow rate of the feed solution used for feeding based on the pH value of the culture system.

[0067] Specifically, when feeding is initiated and the feed solution is first added to the culture system, the pH and other conditions will fluctuate for a period of time, and the dissolved oxygen level will gradually decrease to 30%. It will then gradually stabilize due to acid-base and dissolved oxygen regulation. Subsequently, as the culture process continues, the pH and other conditions in the culture system may change again. At this point, the feed solution flow rate is adjusted accordingly based on the pH changes. This controls the pH in the culture system to remain in a relatively stable state until the culture ends (preferably when the reducing sugars in the culture system are completely depleted).

[0068] Preferably, the control method includes: an initial feed flow rate of 2-5 mL / h / L, a flow rate of 5-10 mL / h / L after the culture system stabilizes, then maintaining the flow rate constant when the pH of the culture system is 7 (i.e., maintaining the flow rate after the culture system stabilizes), adjusting the feed flow rate to 3-5 mL / h / L when the pH of the culture system is below 7, and adjusting the feed flow rate to 7-13 mL / h / L when the pH of the culture system is above 7. The unit "mL / h / L" represents the volume of feed solution added per unit time (h) in a unit volume of culture medium (L).

[0069] More preferably, the flow rate after the culture system has stabilized is 1-5 mL / h / L higher than the initial flow rate.

[0070] More preferably, the flow rate when the pH of the culture system is below 7 is 1-5 mL / h / L lower than the flow rate after the culture system has stabilized.

[0071] More preferably, the flow rate when the pH of the culture system is higher than 7 is 1-5 mL / h / L higher than the flow rate after the culture system has stabilized.

[0072] According to a preferred embodiment of the present invention, the culture time is 18-30 hours.

[0073] Preferably, the method further includes the step of separating D-allulose from the culture medium.

[0074] Preferably, the method further includes the step of isolating D-allulose 3-epimerase from the culture medium.

[0075] In this invention, there are no particular limitations on the specific method for isolating D-allulose and D-allulose 3-epimerase from the culture medium. Any separation method existing in the art can be applied to this invention. Since the D-allulose obtained in the method provided by this invention is dissolved in the culture medium, while the D-allulose 3-epimerase exists in the bacterial cells, the culture medium and bacterial cells can be separated by solid-liquid separation (e.g., centrifugation, filtration, etc.), and then the D-allulose and D-allulose 3-epimerase can be separated and purified separately from them.

[0076] The second aspect of the present invention provides D-allulose and D-allulose 3-epimerase prepared by the method described above.

[0077] A third aspect of the present invention provides the application of the method described above in the industrial production of D-allulose and / or D-allulose 3-epimerase.

[0078] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0079] In the following examples, unless otherwise specified, the Bacillus subtilis used is an engineered Bacillus subtilis strain obtained by inserting the DPEase encoding gene shown in SEQ ID NO:1 into Bacillus subtilis 1012 through genetic engineering technology. For specific preparation methods, please refer to CN201911072202.6.

[0080] The sugarcane molasses used in the following examples was purchased from COFCO Sugar Industry Yingkou Branch, containing 50±5% by weight of total sugar (of which the weight ratio of sucrose, glucose and fructose is approximately 3.5:1:1), 2.5±0.5% by weight of crude protein, 6±3% by weight of soluble colloids, 12±2% by weight of ash, 6±2% by weight of minerals, 3±0.5% by weight of biotin, and 25±5% by weight of moisture. Unless otherwise specified, all other reagents used were purchased from reputable chemical / biological reagent suppliers and were of analytical or chemical purity.

[0081] The LB medium preparation method used in the following examples is as follows: The raw materials for the medium were weighed according to the dosages of 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride, and dissolved in deionized water. The pH was adjusted to 7.2 ± 0.2, and the medium was sterilized at 121°C for 20 min. This yielded the LB liquid medium. Before sterilization, 10 g / L agar was added. After sterilization, dispensing, and cooling, the LB solid medium was obtained.

[0082] In the following examples, the seed culture was obtained as follows: a single colony of Bacillus subtilis engineered bacteria cultured on LB solid medium was picked and inoculated into LB liquid medium (250 mL shake flask, 50 mL volume). The culture was carried out overnight (approximately 16 ± 1 h) at 37°C and 200 rpm to obtain the seed culture.

[0083] Example 1

[0084] Culture medium components:

[0085] Carbon source: a mixture of sucrose, glucose and fructose (weight ratio 3:1:1), used in an amount that makes the carbon content in the culture medium 8 g / L;

[0086] Nitrogen source: yeast extract, used in an amount that makes the nitrogen content in the culture medium 2.5 g / L;

[0087] Inorganic salts: a mixture of K2HPO4, KH2PO4, (NH4)2SO4 and MgSO4, in amounts such that the culture medium contains 6 g / L K, 5 g / L P, 0.5 g / L S and 0.2 g / L Mg;

[0088] The remainder is deionized water. Autoclave at 121℃ for 20 minutes.

[0089] Feed solution: A mixed aqueous solution of sucrose, glucose, and fructose (weight ratio 3:1:1), with a total sugar concentration of 400 g / L. Autoclave at 121°C for 20 min.

[0090] Dissolved oxygen control during cultivation: During the cultivation process, the dissolved oxygen level of the cultivation system is monitored throughout. When the dissolved oxygen level slowly decreases to 30%, the stirring speed and / or aeration rate are adjusted to maintain the dissolved oxygen level at 30%. The stirring speed is controlled within the range of 40-50 m / s to ensure the linear velocity of the stirring impeller tip is within the range of 0.5-1.2 vvm.

[0091] Feeding method during cultivation: During cultivation, if the dissolved oxygen level slowly decreases to 30% and then suddenly increases sharply (rising to 90% within 30 seconds, occurring approximately 4 hours after the start of growth cultivation), feeding should be initiated immediately. The feed flow rate is controlled as follows: Initially, the feed flow rate is 10 mL / h. After approximately 30 minutes, once the cultivation system stabilizes, the feed flow rate is adjusted to 25 mL / h. Subsequently, when the pH of the cultivation system reaches 7, the feed flow rate is maintained at 25 mL / h. When the pH of the cultivation system falls below 7, the feed flow rate is reduced to 15 mL / h. When the pH of the cultivation system rises above 7, the feed flow rate is increased to 33 mL / h.

[0092] Cultivation process: Fermentation was carried out in a 5L fermenter with a liquid volume of 3.3L. Seed culture was added to the culture medium at an inoculum volume of 5% (v / v), the inoculum volume being such that the initial OD... 600 The value was 0.15. After inoculation, the following growth conditions were established: temperature 37℃, pH 7, initial stirring speed resulting in a stirrer tip linear velocity of 40 m / s, initial aeration rate of 1 vvm, and initial dissolved oxygen level of 93%. After 12 hours of growth culture, *Bacillus subtilis* entered mid-logarithmic growth phase. The culture temperature was then lowered to 28℃ for expression culture. After 4 hours of expression culture, the reducing sugars in the culture system were exhausted, and the culture was stopped, yielding culture medium A1. The total production cycle was 26 hours.

[0093] Example 2

[0094] Culture medium components:

[0095] Carbon source: sugarcane molasses, used in such a quantity that the carbon provided by the sugars in the culture medium is 10 g / L;

[0096] Nitrogen source: yeast extract, used in an amount that makes the nitrogen content in the culture medium 4 g / L;

[0097] Inorganic salts: a mixture of K2HPO4, KH2PO4, (NH4)2SO4 and MgSO4, used in amounts such that the culture medium contains 8 g / L K, 4.5 g / L P, 0.8 g / L S and 0.3 g / L Mg;

[0098] The remainder is deionized water. Autoclave at 121℃ for 20 minutes.

[0099] Feed solution: Molasses stock solution, with a total fermentation sugar concentration (i.e., sugars that can be utilized during cultivation, such as sucrose, glucose, fructose, etc.) of approximately 413 g / L. Autoclave at 121℃ for 20 min.

[0100] Dissolved oxygen control during cultivation: During the cultivation process, the dissolved oxygen level of the cultivation system is monitored throughout. When the dissolved oxygen level slowly decreases to 30%, the stirring speed and / or aeration rate are adjusted to maintain the dissolved oxygen level at 30%. The stirring speed is controlled within the range of 50-60 m / s to ensure the linear velocity of the stirring impeller tip is within the range of 0.5-1.2 vvm.

[0101] Feeding method during cultivation: During cultivation, if the dissolved oxygen level slowly decreases to 30% and then suddenly increases sharply (rising to 85% within 60 seconds, occurring approximately 4.5 hours after the start of growth cultivation), feeding should be initiated immediately. The feed flow rate is controlled as follows: Initially, the feed flow rate is 8 mL / h. After approximately 30 minutes, once the cultivation system stabilizes, the feed flow rate is adjusted to 23 mL / h. Subsequently, when the pH of the cultivation system reaches 7, the feed flow rate is maintained at 23 mL / h. When the pH of the cultivation system falls below 7, the feed flow rate is reduced to 12 mL / h. When the pH of the cultivation system rises above 7, the feed flow rate is increased to 30 mL / h.

[0102] Cultivation process: Fermentation was carried out in a 5L fermenter with a liquid volume of 3.5L. Seed culture was added to the culture medium at an inoculum rate of 10% (v / v), the inoculum amount being such that the initial OD... 600 The value was 0.45. After inoculation, the following growth conditions were established: temperature 37℃, pH 7.1, initial stirring speed resulting in a stirrer tip linear velocity of 40 m / s, initial aeration rate of 0.5 vvm, and initial dissolved oxygen level of 88%. After 15 hours of growth culture, Bacillus subtilis entered mid-logarithmic growth phase. The culture temperature was then lowered to 25℃ for expression culture. After 15 hours of expression culture, the reducing sugar content in the culture system was exhausted, and the culture was stopped to obtain culture medium A2. The total production cycle was 30 hours.

[0103] Example 3

[0104] The method described in Example 1 was used, except that 3‰ biotin (purchased from Sigma) was added to the culture medium.

[0105] Approximately 3.5 hours after the start of growth culture, a sharp increase in dissolved oxygen occurred, prompting the initiation of feed replenishment. Around 11 hours after the start of growth culture, Bacillus subtilis entered mid-logarithmic growth, and expression culture began. After 13 hours of expression culture, the reducing sugars in the culture system were exhausted, and culture was stopped, yielding culture medium A3. The total production cycle was 24 hours.

[0106] Example 4

[0107] The method described in Example 2 was used, except that the culture temperature was lowered to 25°C 5 hours after the start of growth culture to begin expression culture (i.e., expression culture was started before Bacillus subtilis reached the logarithmic growth phase).

[0108] Approximately 15 hours after the start of growth culture, Bacillus subtilis entered the logarithmic mid-growth phase. About 4.5 hours after the start of growth culture, a sharp increase in dissolved oxygen occurred, prompting the initiation of feed supplementation. After 20 hours of expression culture, the reducing sugar content in the culture system was completely depleted, and culture was stopped, yielding culture medium A4. The total production cycle was 35 hours.

[0109] Example 5

[0110] The method described in Example 2 was used, except that the culture temperature was lowered to 25°C 20 hours after the start of growth culture, and expression culture was started (i.e., expression culture was started some time after Bacillus subtilis reached the logarithmic growth phase).

[0111] Approximately 15 hours after the start of growth culture, Bacillus subtilis entered the mid-logarithmic growth phase. About 4.5 hours after the start of growth culture, a sharp increase in dissolved oxygen occurred, prompting the initiation of feed supplementation. After 13 hours of expression culture, the reducing sugar content in the culture system was completely depleted, and culture was stopped, yielding culture medium A5. The total production cycle was 28 hours.

[0112] Example 6

[0113] The method described in Example 2 is used, except that the growth culture temperature is maintained throughout the entire culture process (i.e., there is no expression culture phase during the culture process).

[0114] Approximately 15 hours after the start of cultivation, Bacillus subtilis enters the mid-logarithmic growth phase. About 4.5 hours after cultivation begins, a sharp increase in dissolved oxygen occurs, prompting the initiation of feed supplementation. Cultivation is stopped once the reducing sugar content in the culture system is completely depleted, yielding culture medium A6. The total production cycle is 24 hours.

[0115] Example 7

[0116] The method described in Example 2 is used, except that the composition of the feed solution is as follows:

[0117] A mixed aqueous solution of sucrose, glucose, and fructose (weight ratio 3.5:1:1), with a total sugar concentration of 413 g / L. Autoclaved at 121°C for 20 min.

[0118] Approximately 5 hours after the start of growth culture, a sharp increase in dissolved oxygen occurred, prompting the initiation of feed replenishment. Around 14 hours after the start of growth culture, Bacillus subtilis entered mid-logarithmic growth, and expression culture began. After 18 hours of expression culture, the reducing sugar content in the culture system was depleted, and culture was stopped, yielding culture medium A7. The total production cycle was 32 hours.

[0119] Example 8

[0120] The method described in Example 2 was used, except that the amount of seed liquid used increased the initial OD of Bacillus subtilis in the culture system. 600 The value is 0.6.

[0121] Approximately 4 hours after the start of growth culture, a sharp increase in dissolved oxygen occurred. Around 14 hours after the start of growth culture, Bacillus subtilis entered mid-logarithmic growth and expression culture began. After 15 hours of expression culture, the reducing sugar content in the culture system was exhausted, and culture was stopped, yielding culture medium A8. The total production cycle was 29 hours.

[0122] Example 9

[0123] The method described in Example 2 was used, except that a pure glucose solution with a concentration of 600 g / L was used for feeding.

[0124] Approximately 4.5 hours after the start of growth culture, a sharp increase in dissolved oxygen occurred, prompting the initiation of feed replenishment. About 10 hours after the start of growth culture, Bacillus subtilis entered the logarithmic growth phase, and expression culture began. After 9 hours of expression culture, the reducing sugar content in the culture system was exhausted, and culture was stopped, yielding culture medium A9. The total production cycle was 19 hours.

[0125] Example 10

[0126] Culture medium components:

[0127] Carbon source: a mixture of sucrose, glucose and fructose (weight ratio 3.5:1.5:1), used in an amount that makes the carbon content in the culture medium 15 g / L;

[0128] Nitrogen source: corn steep liquor, used in an amount that makes the nitrogen content in the culture medium 5 g / L;

[0129] Inorganic salts: a mixture of K2HPO4, KH2PO4, (NH4)2SO4 and MgSO4, in amounts such that the culture medium contains 8 g / L K, 5 g / L P, 0.8 g / L S and 0.3 g / L Mg;

[0130] The remainder is deionized water. Autoclave at 121℃ for 20 minutes.

[0131] Feed solution: A mixed aqueous solution of sucrose, glucose, and fructose (weight ratio 3.5:1.5:1), with a total sugar concentration of 600 g / L. Autoclave at 121℃ for 20 min.

[0132] Dissolved oxygen control during cultivation: During the cultivation process, the dissolved oxygen level of the cultivation system is monitored throughout. When the dissolved oxygen level slowly decreases to 30%, the stirring speed and / or aeration rate are adjusted to maintain the dissolved oxygen level at 30%. The stirring speed is controlled within the range of 45-55 m / s to keep the tip velocity of the stirring paddle at 0.5-1.2 vvm.

[0133] Feeding method during cultivation: During cultivation, if the dissolved oxygen level slowly decreases to 30% and then suddenly increases sharply (rising to 78% within 20 seconds, occurring approximately 5 hours after the start of growth cultivation), feeding should be initiated immediately. The feed flow rate is controlled as follows: Initially, the feed flow rate is 16 mL / h. After approximately 25 minutes, once the cultivation system stabilizes, the feed flow rate is adjusted to 30 mL / h. Subsequently, when the pH of the cultivation system reaches 7, the feed flow rate is maintained at 30 mL / h. When the pH of the cultivation system falls below 7, the feed flow rate is reduced to 20 mL / h. When the pH of the cultivation system rises above 7, the feed flow rate is increased to 40 mL / h.

[0134] Cultivation process: Fermentation was carried out in a 5L fermenter with a liquid volume of 3.3L. Seed culture was added to the culture medium at an inoculum rate of 10% (v / v), the inoculum amount being such that the initial OD... 600 The value was 0.15. After inoculation, the following growth conditions were established: temperature 35℃, pH 7, initial stirring speed resulting in a stirrer tip linear velocity of 40 m / s, initial aeration rate of 1 vvm, and initial dissolved oxygen level of 90%. After 13 hours of growth culture, Bacillus subtilis entered mid-logarithmic growth phase. The culture temperature was then lowered to 30℃ for expression culture. After 15 hours of expression culture, the reducing sugar content in the culture system was depleted, and the culture was stopped, yielding culture medium A10. The total production cycle was 28 hours.

[0135] Example 11

[0136] Culture medium components:

[0137] Carbon source: a mixture of sucrose, glucose and fructose (weight ratio 3:1.5:1), used in an amount that makes the carbon content in the culture medium 5 g / L;

[0138] Nitrogen source: a mixture of corn steep liquor and tuna extract (weight ratio 1:1), used in an amount that makes the nitrogen content in the culture medium 3 g / L;

[0139] Inorganic salts: a mixture of KH2PO4, (NH4)2SO4 and MgSO4, used in amounts such that the culture medium contains 5.5 g / L K, 3 g / L P, 0.3 g / L S and 0.1 g / L Mg;

[0140] The remainder is deionized water. Autoclave at 121℃ for 20 minutes.

[0141] Feed solution: A mixed aqueous solution of sucrose, glucose, and fructose (weight ratio 3:1.5:1), with a total sugar concentration of 600 g / L. Autoclave at 121℃ for 20 min.

[0142] Dissolved oxygen control during cultivation: During the cultivation process, the dissolved oxygen level of the cultivation system is monitored throughout. When the dissolved oxygen level slowly decreases to 30%, the stirring speed and / or aeration rate are adjusted to maintain the dissolved oxygen level at 30%. The stirring speed is controlled within the range of 45-55 m / s to keep the tip velocity of the stirring paddle at 0.5-1.2 vvm.

[0143] Feeding method during cultivation: During cultivation, when the dissolved oxygen level slowly decreases to 30% and then suddenly increases sharply (rising to 82% within 45 seconds, occurring approximately 3.5 hours after the start of growth cultivation), feeding should be initiated immediately. The feed flow rate is controlled as follows: Initially, the feed flow rate is 8 mL / h. After approximately 25 minutes, once the cultivation system stabilizes, the feed flow rate is adjusted to 18 mL / h. Subsequently, when the pH of the cultivation system reaches 7, the feed flow rate is maintained at 18 mL / h. When the pH of the cultivation system falls below 7, the feed flow rate is reduced to 12 mL / h. When the pH of the cultivation system rises above 7, the feed flow rate is increased to 28 mL / h.

[0144] Cultivation process: Fermentation was carried out in a 5L fermenter with a liquid volume of 3.3L. Seed culture was added to the culture medium at an inoculum rate of 10% (v / v), resulting in an initial OD of [missing value]. 600 The value was 0.15. After inoculation, the following growth conditions were established: temperature 36℃, pH 7, initial stirring speed resulting in a stirrer tip linear velocity of 40 m / s, initial aeration rate of 1 vvm, and initial dissolved oxygen level of 87%. After 10 hours of growth culture, Bacillus subtilis entered mid-logarithmic growth phase. The culture temperature was then lowered to 27℃ for expression culture. After 12 hours of expression culture, the reducing sugar content in the culture system was exhausted, and the culture was stopped to obtain culture medium A11. The total production cycle was 22 hours.

[0145] Comparative Example 1

[0146] The method described in Example 1 was used, except that the carbon source in the culture medium was a mixture of sucrose and glucose (weight ratio 3:1), and the amount was such that the carbon element in the culture medium was 8 g / L.

[0147] Approximately 5 hours after the start of growth culture, a sharp increase in dissolved oxygen occurred, prompting the initiation of feed replenishment. Around 12 hours after the start of growth culture, Bacillus subtilis entered the logarithmic growth phase, and expression culture began. After 13 hours of expression culture, the reducing sugar content in the culture system was depleted, and culture was stopped, yielding culture medium D1. The total production cycle was 25 hours.

[0148] Test Example 1

[0149] The culture media obtained in the above examples and comparative examples were subjected to solid-liquid separation (centrifugation at 8000 rpm for 15 min). The obtained solid phase was fresh bacterial cells containing DPEase, and the liquid phase was the supernatant containing allulose. The D-allulose content in the obtained supernatant was detected by liquid chromatography. The DPEase enzyme activity in each culture medium was detected by the following method. The results are detailed in Table 1.

[0150] Pretreatment for enzyme activity detection: Take a certain amount of culture medium (30-40 mL), centrifuge at 9000 rpm for 10 min, discard the supernatant, weigh the culture medium and subtract the weight of the empty tube to obtain the cell mass. Add deionized water (cell mass × 10) to the centrifuge tube and shake on a shaker until completely resuspended. Take 10 mL of the resuspended liquid into the centrifuge tube, sonicate for 15 min, centrifuge at 9000 rpm for 10 min, and obtain the supernatant after disruption. Pipette 4.5 mL of fructose solution with a concentration of 300 mg / mL and a trace amount of cobalt chloride added into a glass test tube. Add 500 μL of the supernatant after disruption of the fermentation cells to the fructose solution. Immediately place the test tube in a 55℃ water bath for 5 min. After the reaction is complete, remove the test tube and place it in boiling water to inactivate the inoculum. Dilute 10 times and perform liquid chromatography detection. Calculate the enzyme activity value based on the peak area of ​​allulose in the liquid chromatography.

[0151] Liquid chromatography detection conditions: Column: Waters Sugar-Pak I; Specifications: 10μm 6.5mm × 300mm; Column temperature: 80℃; Detector: RID; Detection temperature: 55℃; Sample volume: 10μL; Mobile phase: Water; Flow rate: 0.4mL / min; Fructose and allulose peaked at 15 and 22 min, respectively.

[0152] Enzyme activity calculation method: Let the standard curve of allulose be Y = aX + b, where Y is the peak area of ​​allulose, X is the concentration of allulose (mg / mL), and a and b are constants.

[0153] The mass (g) of allulose produced is given by m = v·k(Yb) / a (Equation 1).

[0154] In Equation 1, Y is the peak area of ​​allulose in the enzyme-catalyzed reaction solution in high-yield liquid chromatography, v is the volume (mL) of the reaction system (enzyme solution + substrate), and k is the dilution factor of the solution during high-performance liquid chromatography detection.

[0155] Enzyme activity E = z·m / t (Equation 2)

[0156] In Equation 2, z is the dilution factor when resuspending cells, and t is the reaction time (in minutes, typically 5 minutes).

[0157] Combining Equations 1 and 2, we get: E=z·k·v(Yb) / a·t (Equation 3)

[0158] Table 1

[0159] Culture medium number Enzyme activity (U / mL) D-Allulose (g / L) A1 883 10 A2 1012 17 A3 998 16 A4 802 12 A5 831 8 A6 890 9 A7 940 14 A8 933 12 A9 880 1 A10 923 18 A11 890 7 D1 912 3

[0160] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention. SEQUENCE LISTING <110> Jilin COFCO Biochemical Co., Ltd. COFCO Nutrition and Health Research Institute Co., Ltd. <120> Methods for the simultaneous preparation of D-allulose and D-allulose 3-epimerase and their applications <130> I71381COF <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 897 <212> DNA <213> Artificial sequence <400> 1 atgaacaaga tcggagttca ttttggatat tttaacagag attggaacac agatttcatt 60 aaaagaatcg aacaggttaa gaagatcgga ctggatattc ttgaagtggc accggcaccg 120 ctgcttgcac ttacaaaatt tcagagagat gaaattgcag cagcggcaaa agcaaatgat 180 attgaactga catttagcgt gggacttagc gcaaatcaag atcttgcgag cgaagatgaa 240 gaaattagaa aaaatggaat caagttcacg acagatacat ttcagattat gtcagaaatg 300 ggaggaaaaa catatagcgg cgttgatatt gcagcgtgga aaaacatt tatggaagga 360 attacggaca attacgcac attacgac attacgaa 420 gttgcagaag acaagggaat tacattgcg gttgaagttg ttaatagata tgaatcaagc 480 cttgtgaata cagcagaaga agcagttaaa tatgtgtg aagttgaag cccgaattgt 540 aaaattcttc ttgatacata ccacatgaac attgagaag atagctttgc gggcgcgatt 600 aaactggtgg gcaatagact tggccatttt catgttggag aaagcaatag aagaccgccg 660 tgtgaaaatg gaaaaatgcc gtgaatgaa attackaatg cacttaaga gatcgattac 720 caggagcga ttgtgatgga accgtttatt aaatggggcg gagaagttgg cagagatatt 780 aaagtgtgga gagatattag cgaggcggcg tcagaagcg aaatggaaca gcttcttgca 840 gatgcagcaa tgatgctgag aaaaaaaatg siaagacatc atcatcacca tcattaa 897

Claims

1. A method for simultaneously preparing D-allulose and D-allulose 3-epimerase, characterized in that, The method includes inoculating engineered bacteria into a culture medium for cultivation to obtain a culture solution, wherein the carbon source in the culture medium provides both the sugars required for the growth and metabolism of the engineered bacteria and the substrates for the enzymatic reaction of D-allulose 3-epimerase to obtain D-allulose. The carbon source is sucrose and / or a mixture of glucose and fructose; or the carbon source is molasses; the carbon content provided by the sugars in the carbon source is 8-16 g / L; The cultivation method includes inoculating the engineered bacteria into a culture medium, then growing the bacteria under growth culture conditions, and then expressing the bacteria under expression culture conditions; and expressing the bacteria in the later stage of the culture, wherein the later stage of the culture is when the engineered bacteria in the culture system reach the logarithmic growth phase. The growth and culture conditions include: temperature 35-37℃, pH 6.9-7.1, initial stirring rate such that the linear velocity of the stirring blade tip is 40-60m / s, aeration rate of 0.5-1.2vvm, and dissolved oxygen content maintained above 30% during the culture process. The expression culture conditions include a temperature of 25-30℃ and dissolved oxygen levels maintained above 30%. The method further includes feeding during the cultivation process; the feed solution used for feeding is a mixture of sucrose and / or glucose and fructose; or, the feed solution used for feeding is molasses. The engineered bacteria is Bacillus subtilis 1012 containing the nucleotide sequence shown in SEQ ID NO:

1.

2. The method according to claim 1, wherein, The culture medium contains a carbon source, a nitrogen source, inorganic salts, and water.

3. The method according to claim 2, wherein, The nitrogen source content, calculated as N element, is 2-5 g / L.

4. The method according to claim 2, wherein, The inorganic salt is used to provide at least one of K, P, S and Mg.

5. The method according to claim 1, wherein, The molasses contains 45-55% by weight of total sugar, 2-3% by weight of crude protein, 3-10% by weight of soluble colloids, 10-15% by weight of ash, 3-10% by weight of minerals, and 2.5-3.5% by weight of biotin.

6. The method according to claim 2, wherein, The nitrogen source is selected from at least one of yeast powder, peptone, corn steep liquor, cottonseed protein, fish paste, and soybean meal hydrolysate.

7. The method according to claim 2, wherein, In the culture medium, the inorganic salts provide K 5.5-8 g / L, P 3-5 g / L, S 0.3-0.8 g / L, and Mg 0.1-0.3 g / L.

8. The method according to claim 2, wherein, The inorganic salt includes at least one of K2HPO4, KH2PO4, (NH4)2SO4 and MgSO4.

9. The method according to claim 1, wherein, The inoculation amount of the engineered bacteria resulted in an initial OD of the engineered bacteria in the growth culture system. 600 The value reaches 0.05-0.

5.

10. The method according to claim 1, wherein, The middle and late stages of cultivation refer to 6-15 hours after the start of growth culture.

11. The method according to claim 1, wherein, The culture temperature for expression culture is 5-10℃ lower than that for growth culture.

12. The method according to claim 1, wherein, The feeding method is feed-in feeding.

13. The method according to claim 1, wherein, The method also includes a step of initiating feeding based on changes in dissolved oxygen levels in the culture system.

14. The method according to claim 13, wherein, When the dissolved oxygen level in the culture system gradually decreases and then suddenly spikes, start feeding.

15. The method according to claim 13, wherein, Feeding should begin when the dissolved oxygen level in the culture system rises from 30% to over 75% within 10-60 seconds.

16. The method according to claim 1, wherein, The feeding method also includes controlling the flow rate of the feed solution used for feeding according to the pH value of the culture system.

17. The method according to claim 16, wherein, The control method includes: the initial flow acceleration rate of the feed solution is 2-5 mL / h / L, the flow acceleration rate after the culture system stabilizes is 5-10 mL / h / L, and then when the pH value of the culture system is 7, the flow acceleration rate is kept constant; when the pH value of the culture system is lower than 7, the flow acceleration rate of the feed solution is adjusted to 3-5 mL / h / L; and when the pH value of the culture system is higher than 7, the flow acceleration rate of the feed solution is adjusted to 7-13 mL / h / L.

18. The method according to claim 1, wherein, The incubation period is 18-30 hours.

19. The method according to claim 1, wherein, The method also includes the step of separating D-allulose from the culture medium.

20. The method according to claim 1, wherein, The method further includes the step of isolating D-allulose 3-epimerase from the culture medium.

21. The use of the method according to any one of claims 1-20 in the industrial production of D-allulose and / or D-allulose 3-epimerase.