Mutation gene causing 3-methylglutaconic aciduria type VII, its detection and application

By designing specific amplification primers and PCR amplification technology for CLPB gene mutation sites, the screening and diagnosis problems of 3-methylpentylamydia VII were solved, and rapid and accurate genetic diagnosis was achieved, providing a therapeutic basis and drug target.

CN116103391BActive Publication Date: 2025-08-26湖南家辉生物技术有限公司
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310280413.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-21
Publication Date
2025-08-26
Estimated Expiration
2043-03-21

AI Technical Summary

Technical Problem

The prior art is difficult to effectively screen and diagnose mutant genes leading to 3-methylpentylamydia type VII, and lacks rapid and accurate detection methods, which affects the genetic diagnosis and treatment guidance of the disease.

Method used

Design specific amplification primers to target specific mutation sites of the CLPB gene (c.1016T>G:p.L339R and c.130delG:p.E44Sfs*5), combine PCR amplification and DNA sequencing technology, and develop detection kits for detecting CLPB gene mutations to achieve rapid and accurate genetic diagnosis.

Benefits of technology

It has achieved the distinction between patients with 3-methylpentylamydia VII and normal population, provided a rapid and effective genetic diagnosis method, provided a theoretical basis and drug target for the treatment of the disease, and supported the screening and diagnosis of the disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116103391B_ABST
    Figure CN116103391B_ABST
Patent Text Reader

Abstract

The present invention provides a mutant gene, detection and application that causes 3-methylglutaconic aciduria type VII. The mutant gene that causes 3-methylglutaconic aciduria type VII includes a compound heterozygous mutation at the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site and the exon1:c.130delG:p.E44Sfs*5 site. The mutant gene can effectively distinguish patients with 3-methylglutaconic aciduria type VII from the normal population. Therefore, the pathogenic gene mutation of the present invention can be used as a biomarker for diagnosing 3-methylglutaconic aciduria type VII. The present invention can be used for screening or diagnosing the genetic diagnosis of 3-methylglutaconic aciduria type VII by detecting whether the subject carries the above-mentioned mutation. The detection kit provided by the present invention can be used to quickly and effectively predict or diagnose 3-methylglutaconic aciduria type VII.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of detection reagents, and in particular to a mutant gene causing 3-methylglutaconic aciduria type VII, as well as detection and application thereof. Background Art

[0002] 3-Methylglutaconic aciduria (MGCA), also known as CLPB deficiency, is a rare mitochondrial-related inherited metabolic disorder caused by impaired mitochondrial catabolism of the branched-chain amino acid L-leucine. Patients experience elevated levels of 3-methylglutaconic acid (3-MGA) and its bypass metabolites in their urine, leading to a range of clinical phenotypes such as mental retardation and seizures. The disease is primarily characterized by elevated urinary concentrations of the organic acids 3-MGA and 3-methylglutaric acid (3-MG). Currently, eight MGCA subtypes have been identified. Mutations in the CLPB gene can cause 3-methylglutaconic aciduria type VII with cataracts, neurologic involvement, and neutropenia (MEGCANN, OMI M 616271), which is inherited in an autosomal recessive manner. The main clinical phenotypes are neurodegeneration and neutropenia.

[0003] The CLPB gene (MIM 616254) is located on chromosome 11q13.4 and comprises 17 exons and 16 introns. The gene is 149.0 kb long with an open reading frame of 2124 bp, encoding a 707-amino acid sequence for caseinolytic peptidase B (CLPB). Its N-terminus contains four ankyrin-like repeats that mediate protein-protein interactions, while its C-terminus contains an ATP-binding motif. This C-terminal domain is similar to that found in other ATPases. CLPB is an oligomeric AAA+ ATPase and a key player in cellular quality control, degrading or reactivating misfolded proteins. These enzymes utilize the energy from ATP hydrolysis to generate the mechanical force required to reshape bound substrates. In cells, oligomeric CLPB reactivates aggregated proteins through its conserved threading activity, which refolds substrate proteins. Mutations in the CLPB gene can cause 3-methylglutaconic aciduria type VII.

[0004] Therefore, gene mutation is an important genetic basis for the occurrence and development of the disease, and genetic diagnosis is an important genetic standard for confirming 3-methylglutaconic aciduria type VII. Clinically, it is necessary to establish corresponding detection technologies for different mutations and use them to clarify the cause and diagnose the disease. This invention is the first to discover a new type of compound heterozygous mutation in CLPB, which can cause the mutant gene of 3-methylglutaconic aciduria type VII. Based on this, a corresponding detection kit has been developed to facilitate the screening and diagnosis of 3-methylglutaconic aciduria type VII gene mutations, and provide new technical support for its drug screening, efficacy evaluation and targeted treatment. Summary of the Invention

[0005] The main purpose of the present invention is to provide a mutant gene causing 3-methylglutaconic aciduria type VII, detection and application, so as to solve the technical problems of screening and diagnosis of 3-methylglutaconic aciduria type VII.

[0006] To achieve the above objectives, the present invention provides a mutant gene that causes 3-methylglutaconic aciduria type VII, wherein the mutant gene is mutated at the first site and / or the second site of the wild-type CLPB gene compared to the wild-type CLPB gene.

[0007] Among them, the first site is the site corresponding to the 1016th base of exon 8 of the wild-type CLPB gene, and the second site is the site corresponding to the 130th base G of exon 1 of the wild-type CLPB gene.

[0008] The present invention also provides a detection reagent for 3-methylglutaconic aciduria type VII caused by the above-mentioned mutant gene, and the detection reagent includes specific amplification primers designed for the site of the gene mutation.

[0009] According to an embodiment of the present application, the specific amplification primers include CLPB-1F, CLPB-1R, CLPB-2F, and CLPB-2R. The nucleotide sequence of CLPB-1F is shown in SEQ ID NO.1, the nucleotide sequence of CLPB-1R is shown in SEQ ID NO.2, the nucleotide sequence of CLPB-2F is shown in SEQ ID NO.3, and the nucleotide sequence of CLPB-2R is shown in SEQ ID NO.4.

[0010] The present invention also provides a detection kit for 3-methylglutaconic aciduria type VII, comprising the above-mentioned detection reagent.

[0011] According to the embodiments of the present application, it also includes reagents for PCR amplification reactions, and / or reagents and sequencing primers required for DNA sequencing.

[0012] According to an embodiment of the present application, the sequencing primers include CLPB-Seq1F, CLPB-1R, CLPB-2F and CLPB-2R, the nucleotide sequence of CLPB-Seq1F is shown as SEQ ID NO.5, the nucleotide sequence of CLPB-Seq1R is shown as SEQ ID NO.6, the nucleotide sequence of CLPB-Seq2F is shown as SEQ ID NO.7, and the nucleotide sequence of CLPB-Seq2R is shown as SEQ ID NO.8.

[0013] The present invention also provides use of the above detection reagent or the above detection kit in a method for detecting 3-methylglutaconic aciduria type VII.

[0014] According to an embodiment of the present application, the detection sample of the detection reagent includes blood and / or amniotic fluid.

[0015] The mutant gene that causes 3-methylglutaconic aciduria type VII proposed in this application can effectively distinguish patients with 3-methylglutaconic aciduria type VII from the normal population. Therefore, the pathogenic gene mutation of the present invention can be used as a biomarker for diagnosing 3-methylglutaconic aciduria type VII. The present invention can be used for screening or diagnosing the genetic diagnosis of 3-methylglutaconic aciduria type VII by detecting whether the subject carries the above mutation to guide treatment. The detection kit provided by the present invention can be used to quickly and effectively predict or diagnose 3-methylglutaconic aciduria type VII. The present invention lays an important foundation for the study of the pathogenesis of 3-methylglutaconic aciduria type VII and provides a new theoretical basis for the treatment of patients with 3-methylglutaconic aciduria type VII. The present invention can provide a possible drug target for the treatment of 3-methylglutaconic aciduria type VII. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying any creative work.

[0017] Figure 1 The genetic map of 3-methylglutaconic aciduria type VII family 1 is shown; Indicates male carriers, indicates female carriers, ■ indicates male patients, and ↗ indicates probands;

[0018] Figure 2The figure shows the results of Sanger sequencing for the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R locus. The proband and the proband's mother in family 1 were heterozygous for the c.1016T>G mutation, while the proband's father was wild-type (the arrow in the sequencing image indicates the mutation location);

[0019] Figure 3 The figure shows the results of Sanger sequencing detection of the genotype of the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 locus. The proband and the proband's father in family 1 were "c.130delG heterozygous mutations", while the proband's mother was wild-type (the arrow in the sequencing image indicates the mutation location);

[0020] Figure 4 The genetic map of 3-methylglutaconic aciduria type VII family 2 is shown; among them, Indicates male carriers, indicates female carriers, ● indicates female patients, and ↗ indicates probands;

[0021] Figure 5 The results of the kit-based genotyping of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R locus in Family 2 are shown. The proband and the proband's father in Family 2 were heterozygous for the c.1016T>G mutation, while the proband's mother was wild-type (the arrow in the sequencing image indicates the mutation location);

[0022] Figure 6 The figure shows the results of using the kit to detect the genotype of the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site of Family No. 2. The proband and the proband's mother of Family No. 2 were "c.130delG heterozygous mutations", and the proband's father was wild type (the arrow in the sequencing image indicates the location of the mutation).

[0023] The realization of the objectives, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0024] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0025] Moreover, the technical solutions between the various embodiments of the present invention may be combined with each other, but this must be based on the fact that ordinary technicians in this field can implement them. When the combination of technical solutions is mutually contradictory or cannot be implemented, it should be deemed that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0026] The term "diagnosis" as used herein includes the prediction of disease risk, the diagnosis of whether a disease has occurred, and the assessment of disease prognosis.

[0027] The term "mutation" herein refers to a change in a wild-type polynucleotide sequence to form a variant, which may be naturally occurring or non-naturally occurring.

[0028] In the present invention, the term "heterozygous mutation" refers to a mutation that exists in only one gene in a pair of alleles.

[0029] In the present invention, the term "compound heterozygous mutation" refers to a heterozygous mutation in which one or more alleles appear, that is, a biallelic mutation, with each chromosome mutated.

[0030] The term "prenatal diagnosis" in this article refers to the clear diagnosis of high-risk fetuses based on genetic counseling, mainly through genetic testing and imaging examinations, and the purpose of fetal selection is achieved through selective abortion of sick fetuses, thereby reducing the birth defect rate and improving the quality of eugenics and population quality.

[0031] In the present invention, "primer" refers to a polynucleotide fragment used to amplify a target nucleic acid in a PCR reaction, which is generally an oligonucleotide, for example, a polynucleotide fragment containing at least 5 bases, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases. The primer does not have to be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. As used herein,

[0032] The term "specific amplification" refers to the ability of a primer to amplify a target gene through a PCR reaction without amplifying other genes. For example, specifically amplifying the CLPB gene means that in a PCR reaction, the primer amplifies only the CLPB gene without amplifying other genes.

[0033] The research ideas of the present invention are as follows: first, exon sequencing is used to screen for pathogenic gene mutations that are highly correlated with 3-methylglutaconic aciduria type VII. In order to avoid false positive results, Sanger sequencing is then used for verification, and finally the pathogenic gene mutations of 3-methylglutaconic aciduria type VII are obtained, CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5.

[0034] The present invention provides a mutant gene causing 3-methylglutaconic aciduria type VII, wherein the mutant gene is mutated at the first site and / or the second site of the wild-type CLPB gene compared to the wild-type CLPB gene.

[0035] Among them, the first site is the site corresponding to the 1016th base of exon 8 of the wild-type CLPB gene, and the second site is the site corresponding to the 130th base G of exon 1 of the wild-type CLPB gene.

[0036] In some embodiments, the first site may also be CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site, and the second site may also be exon1:c.130delG:p.E44Sfs*5 site.

[0037] The compound heterozygous mutations of the pathogenic genes screened by the present invention can distinguish patients with 3-methylglutaconic aciduria type VII, carriers and normal people. Therefore, the compound heterozygous mutations of the pathogenic genes of the present invention can be used as biomarkers for diagnosing 3-methylglutaconic aciduria type VII.

[0038] Mutations occur at the first site and / or the second site of the wild-type CLPB gene, including three situations:

[0039] 1. A mutation occurs only at the first site of the wild-type CLPB gene, such as a heterozygous mutation.

[0040] 2. A mutation occurs only at the second site of the wild-type CLPB gene, such as a heterozygous mutation.

[0041] 3. Mutations occur at both the first and second sites of the wild-type CLPB gene, and this type of mutation is a compound heterozygous mutation.

[0042] Specifically, the c.1016T>G mutation described in the present invention refers to a mutation of the 1016th base of exon 8 of the wild-type CLPB gene from T to G, forming a CLPB gene mutant, and the nucleotide sequence of the CLPB gene mutant is preferably as shown in SEQ ID NO.71 (TCCCCCGGGAGCA). Compared with the protein encoded by the wild-type CLPB gene, the CLPB mutant protein described in the present invention has a mutation of amino acid 339 from leucine (L) to arginine (R), and a missense mutation occurs, that is, the CLPB mutant protein contains a p.L339R mutation, which is caused by the missense mutation of c.1016T>G; the amino acid sequence of the CLPB mutant protein is shown in SEQ ID NO.72 (RFPREQR).

[0043] The c.130delG mutation described in the present invention refers to the deletion of the G base at position 130 of exon 1 of the wild-type CLPB gene, forming a CLPB gene mutant. The nucleotide sequence of the CLPB gene mutant is preferably as shown in SEQ ID NO.73 (CTCGGGAGCCGC). Compared with the protein encoded by the wild-type CLPB gene, the CLPB mutant protein described in the present invention has a mutation from glutamic acid (E) to serine (S) at position 44, and a frameshift mutation occurs, that is, the CLPB mutant protein contains a mutation of p.E44Sfs*5, which is caused by the frameshift mutation of c.130delG; the amino acid sequence of the CLPB mutant protein is shown in SEQ ID NO.74 (SLGSRSG*).

[0044] The present invention also provides a detection reagent for 3-methylglutaconic aciduria type VII caused by the above-mentioned mutant gene, and the detection reagent includes specific amplification primers designed for the site of the gene mutation.

[0045] According to an embodiment of the present application, the specific amplification primers include CLPB-1F, CLPB-1R, CLPB-2F, and CLPB-2R. The nucleotide sequence of CLPB-1F is shown in SEQ ID NO.1, the nucleotide sequence of CLPB-1R is shown in SEQ ID NO.2, the nucleotide sequence of CLPB-2F is shown in SEQ ID NO.3, and the nucleotide sequence of CLPB-2R is shown in SEQ ID NO.4.

[0046] Specifically, the PCR primer base sequence for the c.1016T>G site is:

[0047] CLPB-1F:ACCAGCCTCCAGTGACCA

[0048] CLPB-1R:GTAGCGGACCAGATGACG

[0049] The PCR primer base sequences for the c.130delG site are:

[0050] CLPB-2F:TAATCGCCACGCCCCTT

[0051] CLPB-2R:CTCTCCCTTCCTCAAACCCA

[0052] The present invention also provides a detection kit for 3-methylglutaconic aciduria type VII, comprising the above-mentioned detection reagent.

[0053] According to the embodiments of the present application, it also includes reagents for PCR amplification reactions, and / or reagents and sequencing primers required for DNA sequencing.

[0054] According to an embodiment of the present application, the sequencing primers include CLPB-Seq1F, CLPB-1R, CLPB-2F and CLPB-2R, the nucleotide sequence of CLPB-Seq1F is shown as SEQ ID NO.5, the nucleotide sequence of CLPB-Seq1R is shown as SEQ ID NO.6, the nucleotide sequence of CLPB-Seq2F is shown as SEQ ID NO.7, and the nucleotide sequence of CLPB-Seq2R is shown as SEQ ID NO.8.

[0055] For the c.1016T>G site, the sequencing primer base sequence is:

[0056] CLPB-Seq1F:ACAGCTATGAAGCAGGACC

[0057] CLPB-Seq1R:CCTCAGCAGTAAAATGGG

[0058] For the c.130delG site, the sequencing primer base sequence is:

[0059] CLPB-Seq2F:AACTCCACCCTGTTCGC

[0060] CLPB-Seq2R:TGGACGGACTCTTGCTGT

[0061] Furthermore, other conventional reagents in the PCR amplification reaction include, but are not limited to, dNTPs, PCR buffer, magnesium ions, Tap polymerase, etc. The PCR buffer is 10× PCR buffer: 500 mmol / L KCl, 100 mmol / L Tris-Cl (pH 8.3), and 15 mmol / L MgCl2.

[0062] The present invention also provides the use of the above-mentioned detection reagent or the above-mentioned detection kit in a method for detecting 3-methylglutaconic aciduria type VII. The detection kit diagnoses whether an individual has 3-methylglutaconic aciduria type VII by detecting the genotype of the aforementioned mutation site in a sample.

[0063] According to an embodiment of the present application, the detection sample of the detection reagent includes blood and / or amniotic fluid.

[0064] The present invention also provides a method for detecting whether a CLPB gene has a gene mutation, the method comprising the following steps:

[0065] 1) Extracting genomic DNA from samples;

[0066] 2) Amplify the CLPB gene sequence;

[0067] 3) DNA sequencing;

[0068] 4) Compare the DNA sequencing results of the sample to be tested with the genomic DNA sequence of a normal person. If the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 loci is found to be a compound heterozygous mutation of "c.1016T>G+c.130delG", the individual is a patient; if a single heterozygous mutation "c.1016T>G heterozygous mutation" or "c.130delG heterozygous mutation" is present at the loci, the individual is a carrier; if there is no mutation at the locus, the CLPB gene is judged to be wild-type and the individual is a normal person.

[0069] The present invention also provides a method for diagnosing 3-methylglutaconic aciduria type VII, which comprises the following steps: detecting the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 sites; if the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 sites is a "c.1016T>G+c.130delG" compound heterozygous mutation, the subject is diagnosed as having 3-methylglutaconic aciduria type VII.

[0070] The present invention discovered for the first time through exome sequencing technology that compound heterozygous mutations at the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 sites can cause the onset of 3-methylglutaconic aciduria type VII. On the one hand, by detecting whether the subject carries the above mutation, it is used to screen or diagnose the genetic diagnosis of 3-methylglutaconic aciduria type VII to guide treatment. In particular, the detection kit provided by the present invention can be used to quickly and effectively predict or diagnose 3-methylglutaconic aciduria type VII. On the other hand, the present invention has laid an important foundation for the study of the pathogenesis of 3-methylglutaconic aciduria type VII and provides a new theoretical basis for the treatment of patients with 3-methylglutaconic aciduria type VII. On the third aspect, the present invention can provide possible drug targets for the treatment of 3-methylglutaconic aciduria type VII.

[0071] The present invention will be further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Experimental methods in the following examples, for which specific conditions are not specified, were generally performed under conventional conditions such as those described in Sambrook et al., Molecular Cloning A LABORATORY MANUAL 1 SECOND EDITION (New York: Cold Spring Harbor Laboratory Press, 2014), or according to the conditions recommended by the manufacturer.

[0072] Example 1 Sample acquisition

[0073] The inventors discovered a pedigree with 3-methylglutaconic aciduria type VII (referred to as Family 1). The clinical information of some members of this family is shown in Table 1. Figure 1 Family tree, including Indicates male carriers, indicates a female carrier, ■ indicates an affected child, and ↗ indicates a proband.

[0074] 1. Diagnostic criteria:

[0075] Please refer to the 2010 edition of "Human Single Gene Inherited Disorders".

[0076] 3-Methylglutaconic aciduria type VII (MGCA7) is an inborn error of metabolism characterized by elevated 3-methylglutaconic acid (3-MGA) levels, resulting in variable degrees of neurologic deficits and neutropenia. The syndrome is highly heterogeneous: most patients present in infancy with a severe, progressive encephalopathy accompanied by various motor abnormalities and psychomotor delays, but few patients have been reported to have normal neurodevelopment. Other common variable features include cataracts, epilepsy, recurrent infections caused by neutropenia, and abnormal brain imaging.

[0077] 1) In severe cases, neonates usually die within a few months of age due to severe neonatal neurological involvement (excessive or lack of voluntary movement, hypotonia or hypertonia, swallowing problems, respiratory insufficiency, and seizures) and life-threatening infections associated with severe neutropenia.

[0078] 2) In moderate cases, neurologic abnormalities in infancy are similar to but less severe than those observed in the severe phenotype (e.g., hypotonia and feeding problems), while later in childhood, spasticity, progressive movement disorders (ataxia, dystonia, and / or dyskinesia), epilepsy, and intellectual disability ranging from mild learning disabilities to limited development of all cognitive and motor functions may develop. The degree of neutropenia varies but is not life-threatening.

[0079] 3) Mild cases have no neurological involvement, normal intelligence, mild and intermittent neutropenia, and a normal life expectancy.

[0080] Diagnosis / Testing: The diagnosis is made in a proband with one or more suggestive clinical and / or radiologic findings and / or elevated urinary 3-methylglutaric acid (3-MGA) excretion and identification of biallelic pathogenic variants in the CLPB genes by molecular genetic testing.

[0081] Table 13 - Clinical information of family members with methylglutaconic aciduria type VII like Figure 1 As shown, the numbering is Ⅰ (first generation) and Ⅱ (second generation).

[0082] Peripheral blood DNA from family members Ⅰ1 (father of the proband), Ⅰ2 (mother of the proband), and Ⅱ1 (proband) were used for sequencing analysis.

[0083] Example 2 Exon Sequencing

[0084] 1. Instruments and equipment are shown in Table 2.

[0085] Table 2 List of instruments and equipment

[0086]

[0087] 2. Reagents and consumables

[0088] Human whole exome sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different types of pipette tips (Axygen), 200 μL centrifuge tubes (Eppendorf), 1.5 mL centrifuge tubes (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standards (Thermo), anhydrous ethanol (Thermo), BigDyeTerminatorV3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB staining solution (Amresco).

[0089] 3. Reagent Formulation

[0090] 5×TBE electrophoresis buffer stock solution was prepared according to Table 3.

[0091] Table 3 5×TBE electrophoresis buffer formula

[0092] Reagents Tris Boric acid EDTA (pH 8.0, 0.5 mol / L) <![CDATA[ddH2O]]> Volume / weight 5.4g 750mg 2mL 90mL

[0093] Adjust the final volume to 100 mL with ddH2O.

[0094] 0.5×TBE electrophoresis buffer working solution can be diluted 10 times with ddH2O.

[0095] 10× red blood cell lysis buffer was prepared according to Table 4.

[0096] Table 4 10× red blood cell lysis buffer formula

[0097]

[0098] Autoclave and store at 4°C.

[0099] 1× cell nuclear lysis buffer was prepared according to Table 5.

[0100] Table 5 1× Cell Nuclear Lysis Buffer Formula

[0101] Reagents 2M Tris-HCl, pH 8.2 4M NaCl 2mM EDTA Volume / weight 0.5mL 10mL 0.4mL

[0102] 4. Experimental Procedure

[0103] After the informed consent was signed, 3-5 mL of peripheral blood was collected from Ⅰ1 (father of the proband), Ⅰ2 (mother of the proband), and Ⅱ1 (proband) in family No. 1.

[0104] 4.1 Sample DNA extraction

[0105] 1) Place 3-5 mL of sample into a 15 mL centrifuge tube, add 2-3 volumes of 1× red blood cell lysis buffer, mix well, and incubate on ice for 30 minutes until the solution becomes transparent.

[0106] 2) Centrifuge at 3000 rpm at 4°C for 10 minutes and carefully discard the supernatant. Add 1 mL of 1× Nuclear Lysis Buffer to the pellet and mix thoroughly. Then add 2 mL of 1× Nuclear Lysis Buffer and 150 μL of 20% SDS and shake until a viscous, transparent solution is obtained. Add 10 μL of 20 mg / mL Proteinase K and shake thoroughly. Digest at 37°C for at least 6 hours or overnight.

[0107] 3) Add an equal volume of saturated phenol, shake gently to mix, and centrifuge at 3000 rpm for 10 minutes at room temperature.

[0108] 4) Carefully transfer the supernatant to another centrifuge tube, add an equal volume of phenol / chloroform (1:1 v / v), mix thoroughly, and centrifuge at 3000 rpm for 10 minutes at room temperature.

[0109] 5) Carefully remove the supernatant. If the supernatant is not clear and transparent, extract again with an equal volume of chloroform.

[0110] 6) Transfer the supernatant to another centrifuge tube, add two volumes of anhydrous ethanol, and shake well to reveal white flocculent DNA. Remove the DNA using a flame-sterilized glass hook. Wash twice with 70% ethanol, dry at room temperature for 5 minutes, then dissolve the DNA in 200 μL of 1× TE solution and drum dissolve overnight. Measure the OD value using a UV microscope.

[0111] 7) DNA dissolved in TE can be stored at 4°C for one year. For long-term storage, add 2 times the volume of anhydrous ethanol and store at -70°C.

[0112] 4.2 Exome Sequencing

[0113] Refer to the instructions of the Human Whole Exome Sequencing Kit (Agilent) and the operating instructions of Molecular Cloning A LABORATORY MANUAL 1 SECOND EDITION (New York: Cold Spring Harbor Laboratory Press, 2014).

[0114] 1) Take 2 μg of DNA, mechanically shear it to a fragment size of about 200 bp, and cut the gel to recover 150-250 bp fragments;

[0115] 2) DNA fragments are end-repaired and 3' end A is added;

[0116] 3) Ligating sequencing adapters, purifying the ligation products, and then performing PCR amplification and purification of the amplified products;

[0117] 4) The Agilent kit probe was added to the purified amplified product for hybridization capture. The hybridized product was recovered by elution and then amplified by PCR. The final product was recovered and a small sample was taken for quality control analysis by agarose gel electrophoresis.

[0118] 5) NextSeq500 sequencer sequencing and data analysis.

[0119] 4.3 Results

[0120] Finally, a pathogenic compound heterozygous mutation CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 was obtained; the c.1016T>G mutation was a mutation of T at the 1016th base to G, resulting in a missense mutation, causing the 339th amino acid to mutate from leucine (L) to arginine (R); the c.130delG mutation was a deletion of G at the 130th base, resulting in a mutation from glutamic acid (E) to serine (S) at the 44th base, and a frameshift mutation, terminating after the next 5 amino acids. In the patient (proband) of family No. 1, the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 sites was a compound heterozygous mutation of "c.1016T>G+c.130delG"; in the carrier of family No. 1, the genotype of this site was a heterozygous mutation of "c.1016T>G" or a heterozygous mutation of "c.130delG".

[0121] Example 3 Sanger sequencing verification

[0122] The exome sequencing results were further verified using Sanger sequencing at the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 loci. Genotyping at the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R and exon1:c.130delG:p.E44Sfs*5 loci was performed on three individuals from pedigree 1 described in Example 1: I1 (father of the proband), I2 (mother of the proband), and II1 (proband), as well as 100 healthy individuals outside the family.

[0123] The specific steps are as follows:

[0124] 1. DNA extraction

[0125] Genomic DNA was extracted according to the method of Example 1.

[0126] 2. Design, verification and optimization of candidate primers

[0127] 2.1 Candidate primer design was based on the human genome sequence database hg19 / build36.3 (https: / / www.ncbi.nlm.nih.gov / genome or http: / / genome.ucsc.edu / cgi-bin / hgGateway?redirect=manual&source=genome.ucsc.edu).

[0128] 2.2 Sixteen pairs of candidate primers were designed for the c.1016T>G and c.130delG sites (see Table 6), and PCR experiments were used to verify and evaluate the advantages and disadvantages of each pair of candidate primers.

[0129] Table 6 Basic information of each candidate primer pair and verification experiment results

[0130]

[0131]

[0132]

[0133]

[0134] Note: Normal PCR amplification results will only have one specific band after electrophoresis. If primer dimer bands or non-specific product bands appear, they are the result of abnormal primer reactions. Target primers should avoid such situations as much as possible. In addition, refer to the following principles to comprehensively evaluate and select the optimal primer pair:

[0135] ① Primer length is 15-30nt, usually around 20nt;

[0136] ② The G+C content should be 40-60%. Too little G+C will result in poor amplification, while too much G+C will easily produce non-specific bands. ATGC should be randomly distributed.

[0137] ③ Avoid references to strings of more than 5 purine or pyrimidine nucleotides;

[0138] ④ There should be no complementary sequence inside the primer;

[0139] ⑤ There should be no complementary sequences between the two primers, especially avoid complementary overlap at the 3' end;

[0140] ⑥ The sequence homology between the primer and the non-specific amplification region should not exceed 70%. The 8 consecutive bases at the 3' end of the primer should not have completely complementary sequences outside the region to be amplified, otherwise it will easily lead to non-specific amplification.

[0141] 2.3 Candidate primer PCR verification reaction

[0142] Perform PCR according to the reaction system in Table 7 and keep the reaction system on ice; set up 8 reaction test tubes for each pair of primers (serial numbers 1 to 8 in Table 7).

[0143] Table 7 Primer detection PCR reaction system

[0144]

[0145]

[0146] Reaction conditions: Place the above test reaction tube into the PCR instrument and perform the following reaction program:

[0147] Step 1: 95°C, 5 minutes;

[0148] Step 2: 30 cycles (95°C, 30 sec → Tm, 30 sec → 72°C, 60 sec); (Set PCR amplification parameters according to the Tm values ​​of each primer in Table 6. If a double primer is used, take the average Tm value).

[0149] Step 3: 72°C, 7 minutes;

[0150] Step 4: 4°C until sampling.

[0151] 2.4 The PCR results of candidate primers were tested by agarose gel electrophoresis to evaluate the effectiveness and specificity of the primer reaction:

[0152] 1) Seal both ends of the clean and dry gel sampler with tape, place it on a flat surface, and place a comb about 1 cm from one end of the sampler.

[0153] 2) Weigh 2 g of agar powder into a conical flask, add 100 mL of 0.5× TBE electrophoresis buffer, shake well, and heat in a microwave or on an electric stove (with asbestos mesh). When boiling, remove from the flask, shake well, and heat again until the gel is completely melted. Remove from the flask and cool to room temperature.

[0154] 3) After the gel cools to about 50°C, pour it into the sealed gel sampler to a thickness of about 5mm.

[0155] 4) After the gel solidifies, remove the tape and place the gel and sampler into the electrophoresis tank.

[0156] 5) Add electrophoresis buffer so that the liquid level is 1-2 mm above the gel surface, and pull the comb upwards. Use a micropipette to mix the sample and DNA size standard with the loading solution, and then add them to each well. Due to the high specific gravity of sucrose in the loading solution, the DNA will sink to the bottom of the well.

[0157] 6) Cover the electrophoresis tank, connect the power supply, adjust the voltage to the appropriate level, and begin electrophoresis. Use the bromophenol blue in the sample loading solution to determine the approximate position of the sample and decide whether to terminate the electrophoresis.

[0158] 7) Turn off the power, remove the gel, and place it in a 0.5 g / mL EB aqueous solution for staining for 10 to 15 minutes.

[0159] 8) Place the gel under a transmission UV irradiator to observe the results at a wavelength of 254 nm, and take photos with a camera equipped with a red filter or use a gel scanning system to record the electrophoresis results.

[0160] 2.5 Result evaluation:

[0161] 1) If only one bright and clear target band appears in tube 7 and no other bands are present, the primer pair and reaction system are considered to be highly effective and specific.

[0162] 2) If no target band appears in tube 7, the primer pair and reaction system are considered invalid;

[0163] 3) If primer-dimer bands other than the target band appear in tube 7 and also appear in some tubes 2, 3, 4, 5, and 6, then the effectiveness of this primer pair and reaction system is considered poor;

[0164] 4) If a nonspecific band other than the target band appears in tube 7 and also appears in some tubes 5 and 6, the primer pair and reaction system are considered to have poor specificity.

[0165] 5) If primer dimers and nonspecific bands outside the target band appear in tube 7, and primer dimers and nonspecific bands also appear in some tubes 2, 3, 4, 5, and 6, then the primer pair and reaction system are judged to have poor effectiveness and specificity.

[0166] 2.6 Based on the statistical results of the verification test in Table 6, the best pair (No. 1 in Table 6) was selected as the primer pair for mutation family detection.

[0167] The PCR primer sequences for the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site are as follows:

[0168] 5'-ACCAGCCTCCAGTGACCA-3'(SEQ ID NO.1)

[0169] 5'-GTAGCGGACCAGATGACG-3'(SEQ ID NO.2)

[0170] The primer sequences for the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site are as follows:

[0171] 5'-TAATCGCCACGCCCCTT-3'(SEQ ID NO.3)

[0172] 5'-CTCTCCCTTCCTCAAACCCA-3'(SEQ ID NO.4)

[0173] 3. PCR amplification of mutation sites in family No. 1 and 100 non-family members

[0174] Perform PCR according to the reaction system in Table 8 and keep the reaction system on ice.

[0175] Table 8 PCR reaction system for mutation sites

[0176]

[0177] Reaction conditions: Place the reaction system into the PCR instrument and perform the following reaction program:

[0178] For the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site, the reaction procedure is as follows:

[0179] Step 1: 95°C, 5 minutes;

[0180] Step 2: 30 cycles (95°C, 30 seconds → 55°C, 30 seconds → 72°C, 60 seconds);

[0181] Step 3: 72°C, 7 minutes;

[0182] Step 4: 4°C until sampling.

[0183] For the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site, the reaction procedure is as follows:

[0184] Step 1: 95°C, 5 minutes;

[0185] Step 2: 30 cycles (95°C, 30 seconds → 59°C, 30 seconds → 72°C, 60 seconds);

[0186] Step 3: 72°C, 7 minutes;

[0187] Step 4: 4°C until sampling.

[0188] 4. Agarose gel electrophoresis detection

[0189] Refer to step 2.4 above.

[0190] 5. Enzymatic purification of PCR products: Add 0.5 μL of exonuclease I (Exo I) and 1 μL of alkaline phosphatase (AIP) to 5 μL of PCR product, digest at 37°C for 15 minutes, and inactivate the enzyme at 85°C for 15 minutes.

[0191] 6. BigDye reaction

[0192] The BigDye reaction system is shown in Table 9.

[0193] Table 9 BigDye reaction system

[0194]

[0195]

[0196] Sequencing PCR cycling conditions:

[0197] Step 1: 96°C, 1 minute;

[0198] Step 2: 33 cycles (96°C, 30 seconds → 55°C, 15 seconds → 60°C, 4 minutes);

[0199] Step 3: 4℃ until sampling.

[0200] 7. Purification of BigDye reaction products:

[0201] 1) Add 1 μL of 125 mM EDTA (pH 8.0) to each tube until it reaches the bottom, then add 1 μL of 3 mol / L NaAc (pH 5.2);

[0202] 2) Add 70 μL of 70% alcohol, shake and mix four times, and let stand at room temperature for 15 minutes;

[0203] 3) Centrifuge at 3000g, 4°C for 30 minutes; immediately invert the 96-well plate and centrifuge at 185g for 1 minute;

[0204] 4) Allow the remaining alcohol to evaporate at room temperature for 5 minutes, add 10 μL of Hi-Di formamide to dissolve the DNA, denature at 96°C for 4 minutes, quickly place on ice for 4 minutes, and sequence.

[0205] 8. Sequencing

[0206] The purified BigDye reaction product was subjected to DNA sequencing. The sequencing primers were nested primers designed based on the above-mentioned preferred PCR primers (the second set of primers was designed within the sequence range of the product amplified by the first set of primers). The sequencing primer sequences for the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site are as follows:

[0207] 5'-ACAGCTATGAAGCAGGACC-3'(SEQ ID NO.5)

[0208] 5'-CCTCCAGCAGTAAAATGGG-3'(SEQ ID NO.6)

[0209] The sequencing primer sequences for the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site are as follows:

[0210] 5'-AACTCCACCCTGTTCGC-3'(SEQ ID NO.7)

[0211] 5'-TGGACGGACTCTTGCTGT-3'(SEQ ID NO.8)

[0212] 9. Results Analysis

[0213] Figure 2 The Sanger sequencing results showed that the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site in the two people in family 1 was "c.1016T>G heterozygous". Figure 2 The position indicated by the arrow in the sequencing image shows that the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site in layers A and C is the "c.1016T>G heterozygous" mutation; Figure 2 The position indicated by the arrow in the sequencing diagram shows that the genotype of the B layer individual is wild type.

[0214] Figure 3 The Sanger sequencing results showed that the genotype of the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site of the two members of family 1 was "c.1016T>G heterozygous". Figure 3 The position indicated by the arrow in the sequencing diagram shows that the genotype of the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site of individuals in layers B and C is the "c.130delG heterozygous" mutation; Figure 3The position indicated by the arrow in the sequencing diagram shows that the genotype of the individual in layer A is wild type.

[0215] Based on the above test results, the proband's CLPB genotype was a compound heterozygous mutation of c.1016T>G and c.130delG, indicating that the proband was a patient with 3-methylglutaconic aciduria type VII.

[0216] Example 4 CLPB gene c.1016T>G, c.130delG mutation detection kit and its application

[0217] 1. Kit composition:

[0218] 1) Amplification primers (1.2 μg each): as shown in Example 3

[0219] 2) Buffer (500 μL of 10× PCR buffer: 500 mmol / L KCl, 100 mmol / L Tris-Cl (pH 8.3), 15 mmol / L MgCl2)

[0220] 3) Taq enzyme (20U)

[0221] 4) dNTPs (4 mM each of the four dNTPs)

[0222] 5) CLPB: c.1016T>G, c.130delG positive mutation reference DNA. This reference is a double-stranded DNA. The specific sequence of the c.1016T>G positive mutation reference DNA is as follows:

[0223]

[0224]

[0225] The specific sequence of the c.130delG positive mutation reference DNA is as follows:

[0226]

[0227] Among them, the single underlined bases are the upstream and downstream primer positions of PCR amplification, the bases in the box are the mutation sites, and the double underlined bases are the upstream and downstream sequencing primer positions.

[0228] 6) Sequencing primers: as shown in Example 3

[0229] 2. Usage:

[0230] A total of 40 individuals from 12 metabolic disease families were screened and tested, and the following family was found again. This kit was used to test patients in family No. 2 (see Table 10).

[0231] Table 10 Clinical information of family members with 3-methylglutaconic aciduria type VII

[0232]

[0233] like Figure 4 As shown, the numbering is Ⅰ (first generation) and Ⅱ (second generation).

[0234] Peripheral blood DNA from family members Ⅰ1 (father), Ⅰ2 (mother) and Ⅱ1 (proband) was used for kit detection.

[0235] 1) Genomic DNA extraction: Extract genomic DNA from samples.

[0236] 2) First, a PCR amplification reaction is performed using the above-mentioned PCR amplification primers, Taq enzyme, buffer, dNTPs, sample genomic DNA, etc., as in Example 3;

[0237] 3) Purify the PCR amplification product;

[0238] 4) Using the above sequencing primers, the purified PCR product was subjected to a BigDye reaction;

[0239] 5) Purification of BiyDye reaction products;

[0240] 6) Sequence the BiyDye reaction product and compare the sequence with the normal sequence.

[0241] Figure 5 The test results of the test kit showed that the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site of the father and proband of family No. 2 was "c.1016T>G heterozygous". Figure 5 The position indicated by the arrow in the sequencing image shows that the genotype of the CLPB:NM_030813.6:exon8:c.1016T>G:p.L339R site in layers A and C is the "c.1016T>G heterozygous" mutation; Figure 5 The position indicated by the arrow in the sequencing diagram shows that the genotype of the B layer individual is wild type. Figure 6 The test results of the kit showed that the genotype of the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site of the mother and proband of family No. 2 was "c.130delG heterozygous". Figure 6 The position indicated by the arrow in the sequencing image shows that the genotype of the CLPB:NM_030813.6:exon1:c.130delG:p.E44Sfs*5 site in layers A and B is the "c.130delG heterozygous" mutation; Figure 6The arrow in the sequence map indicates that the individual in layer C has a wild-type genotype. The test results confirmed that the proband has 3-methylglutaconic aciduria type VII, and both his mother and father are carriers of the mutation. Genetic counseling indicated that the couple's chance of having another child with 3-methylglutaconic aciduria type VII is 1 / 4, the chance of having a carrier offspring is 1 / 2, and the chance of having a normal child is 1 / 4. The couple is advised to undergo preimplantation genetic diagnosis if planning further children and to seek prenatal diagnosis after pregnancy.

[0242] The above technical solutions of the present invention are only preferred embodiments of the present invention and do not limit the patent scope of the present invention. All equivalent structural transformations made by using the contents of the present invention's description and drawings under the technical concept of the present invention, or directly / indirectly applied in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. A detection reagent for 3-methylglutaconic aciduria type VII caused by a mutant gene, characterized in that: The detection reagent includes specific amplification primers designed for the site of gene mutation; the mutant gene is mutated at the first site and the second site of the wild-type CLPB gene compared to the wild-type CLPB gene; The first site is the site corresponding to the 1016th base of exon 8 of the wild-type CLPB gene, and the second site is the site corresponding to the 130th base G of exon 1 of the wild-type CLPB gene; the mutation at the first site is a mutation from base T to base G; the mutation at the second site is a deletion of base G; The specific amplification primers include CLPB-1F, CLPB-1R, CLPB-2F, and CLPB-2R. The nucleotide sequence of the CLPB-1F is shown in SEQ ID NO. 1, the nucleotide sequence of the CLPB-1R is shown in SEQ ID NO. 2, the nucleotide sequence of the CLPB-2F is shown in SEQ ID NO. 3, and the nucleotide sequence of the CLPB-2R is shown in SEQ ID NO.

4.

2. A detection kit for 3-methylglutaconic aciduria type VII, characterized in that: It comprises the detection reagent of claim 1, reagents for PCR amplification reaction, and reagents and sequencing primers required for DNA sequencing; the sequencing primers include CLPB-Seq1F, CLPB-1R, CLPB-2F and CLPB-2R, the nucleotide sequence of the CLPB-Seq1F is shown in SEQ ID NO.5, the nucleotide sequence of the CLPB-Seq1R is shown in SEQ ID NO.6, the nucleotide sequence of the CLPB-Seq2F is shown in SEQ ID NO.7, and the nucleotide sequence of the CLPB-Seq2R is shown in SEQ ID NO.8.

Citation Information

Patent Citations

  • Probe set and kit for detecting pathogenic gene of primary immunodeficiency disease

    CN109762882A

  • Methods and compositions for editing nucleotide sequences

    CN114729365A