Modified phosphoenolpyruvate carboxylase and its application in improving amino acid production in Corynebacterium glutamicum

Abstract

The present invention provides a modified phosphoenolpyruvate carboxylase, and compared with the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, the amino acid at position 771 and / or position 931 and / or position 943 of the amino acid sequence of the modified phosphoenolpyruvate carboxylase is substituted. The present invention performs specific site mutation on the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, and the obtained modified phosphoenolpyruvate carboxylase has a great influence on the metabolism of amino acid carbon flow. The coding gene of the modified phosphoenolpyruvate carboxylase is expressed in Corynebacterium glutamicum, and the amino acid yield can be efficiently improved, and the application prospect is good.

Description

Technical Field

[0001] The present invention relates to the biological field, and in particular to a modified phosphoenolpyruvate carboxylase and its application in improving the amino acid yield of Corynebacterium glutamicum. Background Art

[0002] Amino acids are the basic building blocks of proteins, and these key nutritional compounds are widely used in the preparation of feed additives, food ingredients, nutritional supplements and medicines. In recent years, the world's amino acid production has grown steadily. In particular, aspartic acid family amino acids (including L-lysine and L-threonine) have been widely used worldwide and have occupied an increasing share in the amino acid market by fermentation using Corynebacterium glutamicum or Escherichia coli.

[0003] Previous studies have shown that the yield of oxaloacetate (OAA)-derived amino acids such as L-lysine or L-threonine depends mainly on the carbon flux through the anaplerotic pathway. Corynebacterium glutamicum has phosphoenolpyruvate carboxylase (PEPC) and pyruvate carboxylase (PYC) to supplement the consumed oxaloacetate.

[0004] Phosphoenolpyruvate carboxylase is an enzyme found in most bacteria and all plants. Phosphoenolpyruvate (PEP) is an intermediate product of glycolysis. After PEP is carboxylated to oxaloacetate by PEPC, it is quickly converted into malate by malate dehydrogenase, thus supplementing the intermediate product for the tricarboxylic acid cycle (TCA cycle). Many intermediate products in the TCA cycle are substrates required for amino acid synthesis, so in most organisms, the main function of PEPC is to divert glycolysis and provide raw materials for the synthesis of amino acids. Some intermediate products in the TCA cycle are precursors for the synthesis of many important organic substances, such as OAA, which is the carbon frame for the synthesis of aspartic acid family amino acids. α-Ketoglutarate is the carbon frame for the synthesis of glutamate family amino acids. Phosphoenolpyruvate carboxylase catalyzes the reaction of phosphoenolpyruvate and CO2 to produce oxaloacetate. The reaction equation is as follows: PEP+CO2=OAA+Pi. The enhanced activity of phosphoenolpyruvate carboxylase helps to increase the accumulation of oxaloacetate. As an important precursor in the synthesis of aspartic acid and glutamic acid amino acids, sufficient supply of oxaloacetate can ensure the efficient synthesis of related amino acids. Therefore, enhancing the supply of the precursor oxaloacetate is also very important for the high production of aspartic acid and glutamic acid amino acids.

[0005] Phosphoenolpyruvate carboxylase was first discovered in spinach leaves. In vivo, it exists as a homotetramer with a monomer size of 100-110 kDa. PEP carboxylase also undergoes various regulation in terms of its activity expression. Studies have reported the isolation and purification of PEPC enzymes from many different bacteria, and found that their activities are regulated by many metabolites. In Escherichia coli, PEPC enzyme activity can be activated by acetyl-CoA and fructose 1,6-bisphosphate, and can produce a synergistic activation effect, but is severely inhibited by aspartic acid and malic acid. In Acetobacter aceti, PEPC enzyme activity is inhibited by aspartic acid and some TCA cycle metabolites, especially succinic acid. In Corynebacterium glutamicum, the regulation of PEPC is different from that of Escherichia coli PEPC, and its enzyme activity cannot be activated by acetyl-CoA, but can also be strongly inhibited by aspartic acid. In addition, compared with Brevibacterium flavum, glutamate has a more obvious inhibition on the enzyme activity of Corynebacterium glutamicum PEPC. These fine regulations of the PEPC enzyme indicate that PEPC is an important regulatory node in the metabolic flow from carbon sources to amino acids, making it an important target for the modification of amino acid-producing strains.

[0006] In the prior art, a variety of technologies have been developed to effectively produce amino acids in fermentation, among which modification of phosphoenolpyruvate carboxylase is the main method. However, the modification of phosphoenolpyruvate carboxylase is generally performed by overexpressing the phosphoenolpyruvate carboxylase encoding gene of the bacteria itself or by mutation modification thereof, thereby increasing the accumulation of oxaloacetate, and the effect of increasing acid production is not significant, which is difficult to meet industrial needs, and so far, no patent reports heterologously expressing the phosphoenolpyruvate carboxylase encoding gene in plants to improve the CO2 fixation capacity of Corynebacterium glutamicum, thereby increasing the accumulation of oxaloacetate and then increasing acid production.

[0007] Therefore, it remains to be studied how to obtain high-amino acid-producing strains by modifying phosphoenolpyruvate carboxylase. Summary of the invention

[0008] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, the present invention provides a modified phosphoenolpyruvate carboxylase, a nucleic acid encoding the modified phosphoenolpyruvate carboxylase, a recombinant expression vector, a genetically engineered bacterium, a kit, a method for obtaining the modified phosphoenolpyruvate carboxylase and its application, a method for improving the amino acid yield of Corynebacterium glutamicum and a method for producing amino acids, by codon optimization and mutation of specific amino acid sites of wild-type phosphoenolpyruvate carboxylase, the obtained modified phosphoenolpyruvate carboxylase has a great influence on the amino acid carbon flux, and the coding gene of the modified phosphoenolpyruvate carboxylase is expressed in Corynebacterium glutamicum, which can efficiently improve the amino acid yield and has good application prospects.

[0009] In one aspect of the present invention, the present invention proposes a modified phosphoenolpyruvate carboxylase. According to an embodiment of the present invention, compared with the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, the 771st and / or 931st and / or 943rd amino acids in the amino acid sequence of the modified phosphoenolpyruvate carboxylase are substituted; the wild-type phosphoenolpyruvate carboxylase has an amino acid sequence as shown in SEQ ID NO: 1 or has an amino acid sequence with at least 80% homology to the amino acid sequence shown in SEQ ID NO: 1. By mutating the three amino acid residues in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, the activity of the phosphoenolpyruvate carboxylase will be significantly affected, and the carbon flow in the amino acid metabolic pathway of Corynebacterium glutamicum will be further enhanced, thereby helping to increase the amino acid yield of Corynebacterium glutamicum, and the application prospect is good.

[0010] According to an embodiment of the present invention, the modified phosphoenolpyruvate carboxylase may also have the following additional technical features:

[0011] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase is derived from a plant.

[0012] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase is derived from sorghum.

[0013] According to an embodiment of the present invention, in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, serine at position 771 is replaced by tyrosine and / or lysine at position 931 is replaced by glutamine and / or aspartic acid at position 943 is replaced by asparagine.

[0014] According to an embodiment of the present invention, the 931st lysine in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by glutamine and the 943rd aspartic acid is replaced by asparagine.

[0015] In another aspect of the present invention, the present invention proposes a nucleic acid encoding a modified phosphoenolpyruvate carboxylase. According to an embodiment of the present invention, compared with the nucleotide sequence encoding the wild-type phosphoenolpyruvate carboxylase, the nucleotide sequence encoding the modified phosphoenolpyruvate carboxylase is pre-codon optimized, and the 2312th base, the 2791st base and / or the 2827th base of the optimized nucleotide sequence have mutations, and the nucleotide sequence encoding the wild-type phosphoenolpyruvate carboxylase has a nucleotide sequence as shown in SEQ ID NO: 2 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 2. Thus, the nucleic acid according to the embodiment of the present invention expresses phosphoenolpyruvate carboxylase in Corynebacterium glutamicum, which helps to increase amino acid production.

[0016] According to an embodiment of the present invention, the optimized nucleotide sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence having at least 80% homology with the nucleotide sequence as shown in SEQ ID NO: 3.

[0017] According to an embodiment of the present invention, the optimized nucleotide sequence has mutations of c.2312C>A, c.2791C>A and / or c.2827G>A.

[0018] According to an embodiment of the present invention, the optimized nucleotide sequence has c.2791C>A and c.2827G>A mutations.

[0019] In order to facilitate the purification of PEPC, a 6×HIS tag can be connected to the C-terminus of the protein consisting of the amino acid residue sequence shown in SEQ ID NO: 1.

[0020] In another aspect of the present invention, the present invention proposes a recombinant expression vector. According to an embodiment of the present invention, the recombinant expression vector is selected from the expression vector containing nucleic acid described above. Thus, the recombinant expression vector according to the embodiment of the present invention expresses phosphoenolpyruvate carboxylase in Corynebacterium glutamicum, which helps to improve amino acid production.

[0021] According to an embodiment of the present invention, the expression vector is selected from an Escherichia coli-Corynebacterium glutamicum shuttle expression vector.

[0022] In another aspect of the present invention, the present invention provides a genetically engineered bacterium. According to an embodiment of the present invention, the genetically engineered bacterium is obtained by transforming the aforementioned recombinant expression vector into a recipient bacterium. Thus, the genetically engineered bacterium according to an embodiment of the present invention can produce high amino acids.

[0023] According to an embodiment of the present invention, the recipient bacteria is selected from Corynebacterium glutamicum.

[0024] In another aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the aforementioned recombinant expression vector or the aforementioned genetically engineered bacteria. Thus, the purpose of high amino acid production can be achieved by using the kit according to the embodiment of the present invention.

[0025] In another aspect of the present invention, the present invention proposes a method for obtaining a modified phosphoenolpyruvate carboxylase. According to an embodiment of the present invention, the method comprises: mutating the 771st and / or 931st and / or 943rd amino acid in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase to obtain the modified phosphoenolpyruvate carboxylase, wherein the wild-type phosphoenolpyruvate carboxylase has an amino acid sequence as shown in SEQ ID NO: 1 or has an amino acid sequence with at least 80% homology to the amino acid sequence shown in SEQ ID NO: 1. By mutating three amino acid residues in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, the activity of the phosphoenolpyruvate carboxylase will be significantly affected, and the amino acid yield of Corynebacterium glutamicum will be further affected. Furthermore, by performing amino acid substitution on these three sites, it is helpful to increase the amino acid yield of Corynebacterium glutamicum, and the application prospect is good.

[0026] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase is derived from a plant, preferably sorghum.

[0027] According to an embodiment of the present invention, in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, serine at position 771 is replaced by tyrosine and / or lysine at position 931 is replaced by glutamine and / or aspartic acid at position 943 is replaced by asparagine.

[0028] In another aspect of the present invention, the present invention proposes the application of the phosphoenolpyruvate carboxylase of the aforementioned transformation, the nucleic acid of the phosphoenolpyruvate carboxylase of the described coding transformation, the recombinant expression vector, and the genetic engineering bacteria in improving amino acid production. Thus, the phosphoenolpyruvate carboxylase of the transformation according to the embodiment of the present invention, the nucleic acid encoding it, the recombinant expression vector, and the genetic engineering bacteria help to improve the amino acid production of Corynebacterium glutamicum fermentation, and has a good application prospect.

[0029] In another aspect of the present invention, the present invention proposes a kind of method that improves Corynebacterium glutamicum amino acid production.According to embodiments of the present invention, described method comprises: the aforementioned recombinant expression vector is transformed in the Corynebacterium glutamicum, and the genetic engineering bacteria after the conversion is carried out fermentation culture.Thus, in the genetic engineering bacteria fermentation process, express phosphoenolpyruvate carboxylase, help to improve Corynebacterium glutamicum amino acid production.

[0030] According to an embodiment of the present invention, the amino acids include aspartic acid family amino acids and / or glutamic acid family amino acids.

[0031] According to an embodiment of the present invention, the aspartate family amino acids include aspartic acid, lysine, threonine, methionine and / or isoleucine; the glutamate family amino acids include glutamic acid, glutamine, proline and / or arginine.

[0032] In another aspect of the present invention, the present invention provides a method for producing amino acids. According to an embodiment of the present invention, the method comprises: fermenting and culturing the genetically engineered bacteria as described above. As described above, the amino acid yield of the genetically engineered bacteria is high, and thus, fermenting and culturing the genetically engineered bacteria can achieve the purpose of high amino acid yield.

[0033] According to an embodiment of the present invention, the amino acids include aspartic acid family amino acids and / or glutamic acid family amino acids.

[0034] According to an embodiment of the present invention, the aspartate family amino acids include aspartic acid, lysine, threonine, methionine and / or isoleucine; the glutamate family amino acids include glutamic acid, glutamine and / or arginine.

[0035] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0037] Figure 1A plasmid map according to one embodiment of the present invention is shown. DETAILED DESCRIPTION

[0038] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0039] The present invention provides a modified phosphoenolpyruvate carboxylase, a nucleic acid encoding the modified phosphoenolpyruvate carboxylase, a recombinant expression vector, a genetically engineered bacterium, a kit, a method for obtaining the modified phosphoenolpyruvate carboxylase, uses, a method for increasing the amino acid yield of Corynebacterium glutamicum and a method for producing amino acids, which will be described in detail below.

[0040] Modified phosphoenolpyruvate carboxylase

[0041] In one aspect of the invention, the present invention proposes a modified phosphoenolpyruvate carboxylase. According to an embodiment of the present invention, compared with the amino acid sequence of wild-type phosphoenolpyruvate carboxylase, the amino acid sequence of the modified phosphoenolpyruvate carboxylase has an optimized codon, and the 771st and / or the 931st and / or the 943rd amino acid of the amino acid sequence of the enzyme with the optimized codon is substituted.

[0042] The inventors found that the 771st, 931st and 943rd amino acid residues in the amino acid sequence of wild-type phosphoenolpyruvate carboxylase significantly affect the activity of phosphoenolpyruvate carboxylase, further affecting the amino acid production of Corynebacterium glutamicum. Furthermore, site-directed mutagenesis of the amino acids at these three sites can help increase the amino acid production of Corynebacterium glutamicum, and the application prospect is good.

[0043] In the terminology of the present invention, codon optimization refers to the redesign of gene sequences according to the codon preferences of protein systems of different species, so as to achieve high-level expression of proteins. The present invention optimizes the phosphoenolpyruvate carboxylase encoding gene derived from sorghum to make it suitable for expression in Corynebacterium glutamicum.

[0044] Site-directed mutagenesis is a conventional technique in the art, and site-directed mutagenesis refers to the introduction of desired changes (usually changes that characterize a favorable direction) into a target DNA fragment (which can be a genome or a plasmid) by methods such as polymerase chain reaction (PCR), including addition, deletion, and point mutation of bases. Site-directed mutagenesis can rapidly and efficiently improve the properties and characterization of the target protein expressed by DNA, and is a very useful method in genetic research.

[0045] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase is derived from a plant.

[0046] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase is derived from sorghum. Sorghum belongs to C4 plants. Compared with other C3 plants, the PEPC of C4 plants has a higher affinity for its substrate HCO3. - It has a higher affinity. In the photosynthetic pathway, it catalyzes the primary fixation of CO2 and concentrates CO2, making it have a higher photosynthetic capacity. The inventor analyzed the primary structure of PEPC by Uniprot and ExPASy, found its binding sites with aspartic acid and malic acid, and simulated by Pymol software, mutated Ser at the 771st position of Ser- to Tyr, and found that the conformation of the protein changed greatly, and its intermolecular force with malic acid was weakened. It is speculated that this mutation may affect the activity of phosphoenolpyruvate carboxylase to a great extent; at the same time, it is analyzed that Lys931 may be the key site for binding with PEP. The mutation of Lys931 to Gln enhances its intermolecular force with PEP, and the overall energy becomes lower. It is speculated that this mutation can enhance the affinity with PEP and make the protein structure more stable; the mutation of aspartic acid at the 943rd position to asparagine reduces its active cavity for binding with glycine, and it is speculated that the sensitivity to glycine can be reduced.

[0047] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase has an amino acid sequence as shown in SEQ ID NO: 1 or an amino acid sequence having at least 80% homology to the amino acid sequence as shown in SEQ ID NO: 1. The wild-type phosphoenolpyruvate carboxylase having an amino acid sequence as shown in SEQ ID NO: 1 is derived from sorghum phosphoenolpyruvate carboxylase, and the enzyme and the enzyme having at least 80% homology thereto can be expressed in microorganisms to increase amino acid production.

[0048] MASERHHSIDAQLRALAPGKVSEELIQYDALLVDRFLDILQDLHGPSLREFVQECYEVSADYEGKKDTSKLGELGAKLTGLAPADAILVASSILHMLNLANLAEEVELAHRRRNSKLKHGDFSDEGSATTESDIEETLKRLVSLGKTPAEVFEALKNQSVDLVFTAHPTQSARRSLLQKNARIRNCLTQLSAKDVTVEDKKELDEALHREIQAAFRTDEIRRAQPTPQDEMRYGMSYIHETVWNGVPKFLRRVDTALKNIGINERLPYDVPLIKFCSWMGGDRDGNPRVTPEVTRDVCLLSRMMAANLYINQVEDLMFELSMWRCNDELRARAEEVQSTPASKKVTKYYIEFWKQIPPNEPYRVILGAVRDKLYNTRERARHLLATGFSEISEDAVFTKIEEFLEPLELCYKSLCECGDKAIADGSLLDLLRQVFTFGLSLVKLDIRQESERQTDVIDAITTHLGIGSYRSWPEDKRMEWLVSELKGKRPLLPPDLPMTEEIADVIGAMRVLAELPIDSFGPYIISMCTAPSDVLAVELLQRECGIRQTLPVVPLFERLADLQAAPASVEKLFSTDWYINHINGKQQVMVGYSDSGKDAGRLSAAWQLYVAQEEMAKVAKKYGVKLTLFHGRGGTVGRGGGPTHLAILSQPPDTINGSIRVTVQGEVIEFMFGEENLCFQSLQRFTAATLEHGMHPPVSPKPEWRKLMEEMAVVATEEYRSVVVKEPRFVEYFRSATPETEYGKMNIGSRPAKRRPGGGITTLRAIPWIFSWTQTRFHLPVWLGVGAAFKWAIDKDIKNFQKLKEMYNEWPFFRVTLDLLEMVFAKGDPGIAGLYDELLVAEELKPFGKQLRDKYVETQQLLLQIAGHKDILEGDPYLKQGLRLRNPYITTLNVFQAYTLKRIRDPSFKVTPQPPLSKEFADENKPAGLVKLNGERVPPGLEDTLILTMKGIAAGMQNTG(SEQ ID NO:1)

[0049] According to an embodiment of the present invention, the 771st serine in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by tyrosine, thereby effectively alleviating the inhibitory effect of malic acid and improving the enzyme activity.

[0050] According to an embodiment of the present invention, the 931st lysine in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by glutamine, thereby increasing the affinity for phosphoenolpyruvate carboxylase and improving the enzyme activity.

[0051] According to an embodiment of the present invention, the aspartic acid at position 943 of the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by asparagine, thereby reducing the sensitivity to glycine and improving the enzyme activity.

[0052] According to an embodiment of the present invention, the 771st serine of the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by tyrosine and the 931st lysine is replaced by glutamine. Thus, the inhibitory effect of malic acid is alleviated while the affinity for phosphoenolpyruvate carboxylase is increased, thereby improving the enzyme activity.

[0053] According to an embodiment of the present invention, the 771st serine of the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by tyrosine and the 943rd aspartic acid is replaced by asparagine, thereby alleviating the inhibitory effect of malic acid and reducing the sensitivity to glycine, thereby improving the enzyme activity.

[0054] According to an embodiment of the present invention, the 931st lysine of the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by glutamine and the 943rd aspartic acid is replaced by asparagine. Thus, the affinity for phosphoenolpyruvate carboxylase is increased while the sensitivity to glycine is reduced, thereby increasing the enzyme activity.

[0055] According to an embodiment of the present invention, in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, the 771st serine is replaced by tyrosine, the 931st lysine is replaced by glutamine, and the 943rd aspartic acid is replaced by asparagine.

[0056] The inventors found that among the above three mutation sites, the combined effect of the two mutations, that is, the replacement of lysine at position 931 by glutamine and the replacement of aspartic acid at position 943 by asparagine, was better and resulted in higher amino acid production.

[0057] Nucleic acid encoding modified phosphoenolpyruvate carboxylase

[0058] In another aspect of the present invention, the present invention proposes a nucleic acid encoding a transformed phosphoenolpyruvate carboxylase. According to an embodiment of the present invention, compared with the nucleotide sequence encoding wild-type phosphoenolpyruvate carboxylase, the nucleotide sequence encoding the transformed phosphoenolpyruvate carboxylase has been codon-optimized for Corynebacterium glutamicum, and the 2312th base, the 2791st base and / or the 2827th base of the optimized nucleotide sequence have mutations.

[0059] At present, adopting microbial fermentation (such as Corynebacterium glutamicum or Escherichia coli) to produce amino acid has occupied more and more high proportion.Because the carbon fixation ability of plant is stronger, so the phosphoenolpyruvate carboxylase of plant origin is preferentially selected as research object.Because the enzyme of plant origin is difficult to realize heterologous expression in microorganism, so, according to the characteristic of target microorganism, the nucleotide sequence of the phosphoenolpyruvate carboxylase of encoding wild type is carried out codon optimization in advance, so that it can realize heterologous expression better.Further, the inventor finds that the 2312th base, the 2791st base and / or the 2827th base on the nucleotide sequence obtained by codon optimization can significantly affect the activity of phosphoenolpyruvate carboxylase, further affect the amino acid yield of Corynebacterium glutamicum, and then, by carrying out site-directed mutagenesis to the base in these 3 sites, contribute to improving the amino acid yield of Corynebacterium glutamicum, good application prospect.

[0060] According to an embodiment of the present invention, the nucleotide sequence encoding the wild-type phosphoenolpyruvate carboxylase has the nucleotide sequence shown in SEQ ID NO: 2 or has a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 2.

[0061]

[0062] According to an embodiment of the present invention, the optimized nucleotide sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence having at least 80% homology with the nucleotide sequence as shown in SEQ ID NO: 3. The nucleotide sequence can be efficiently heterologously expressed in a microorganism. Further, by modifying at least one of the above three nucleotide sites, the enzyme encoded by the nucleotide can increase the amino acid production.

[0063]

[0064] According to an embodiment of the present invention, the optimized nucleotide sequence has mutations of c.2312C>A, c.2791C>A and / or c.2827G>A. At least one of the three mutations of the 2312th C base mutated to the A base, the 2791st C base mutated to the A base, and the 2827th G base mutated to the A base in the nucleotide sequence with optimized codons can improve the enzyme activity and further increase the amino acid yield. The two mutations of the 2791st C base mutated to the A base and the 2827th G base mutated to the A base exist at the same time, and the amino acid yield is higher.

[0065] According to an embodiment of the present invention, the codon-optimized nucleotide sequence is as shown in SEQ ID NO: 2 or has at least 80% homology with SEQ ID NO: 2. Thus, the codon-optimized enzyme can be efficiently expressed in microorganisms, especially Corynebacterium glutamicum.

[0066] Recombinant expression vector

[0067] In another aspect of the present invention, the present invention proposes a recombinant expression vector. According to embodiments of the present invention, this recombinant expression vector is selected from the expression vector containing nucleic acid described above. Thus, the recombinant expression vector according to the embodiment of the present invention expresses phosphoenolpyruvate carboxylase in Corynebacterium glutamicum, which helps to improve amino acid production.

[0068] According to an embodiment of the present invention, the expression vector is selected from the Escherichia coli-Corynebacterium glutamicum shuttle expression vector.

[0069] Escherichia coli-Corynebacterium glutamicum shuttle expression vector refers to a vector that can replicate and stably exist in Escherichia coli and Corynebacterium, and contains a promoter with transcription initiation function and a terminator with transcription termination function in both Escherichia coli and Corynebacterium. Constitutive expression vector is a vector that adds expression elements (such as promoters, terminators, etc.) to the basic skeleton of the cloning vector to enable the expression of the target gene. Among them, the promoter is a specific DNA sequence that RNA polymerase binds to and initiates transcription, and the terminator is a DNA sequence that gives RNA polymerase a transcription termination signal. Inducible expression vectors are used to achieve secretory expression of exogenous proteins. The most direct method is to insert the gene behind the expression element (promoter and secretion signal peptide sequence) of the host secretory protein. Introducing a strictly regulated strong promoter into the expression vector can enable the target gene to be expressed under low inducer concentration conditions. The induction method is usually chemical induction and environmental induction.

[0070] According to an embodiment of the present invention, the Escherichia coli-Corynebacterium glutamicum shuttle expression vector is a constitutive expression vector PVcaseG, and the constitutive expression vector includes gapa derived from Corynebacterium glutamicum itself as a promoter and rrnB terminator derived from the Escherichia coli-Corynebacterium glutamicum shuttle vector PXMJ19. The nucleic acid sequence encoding the modified phosphoenolpyruvate carboxylase described above (referred to as pepcTB) is inserted into the PVcaseG vector to construct a PVcaseG-pepcTB recombinant expression vector (see plasmid map) Figure 1 ), and at the same time, mutating the 931st lysine to glutamine, and the 943th aspartic acid to asparagine, and electroporating into Corynebacterium glutamicum, and inducing expression by IPTG in Corynebacterium glutamicum, the activity of phosphoenolpyruvate carboxylase can be increased.

[0071] Those skilled in the art will appreciate that the features and advantages described above for the nucleic acid encoding the modified phosphoenolpyruvate carboxylase are also applicable to the recombinant expression vector and will not be described in detail here.

[0072] Genetically engineered bacteria

[0073] In another aspect of the present invention, the present invention provides a genetically engineered bacterium. According to an embodiment of the present invention, the genetically engineered bacterium is obtained by transforming the aforementioned recombinant expression vector into a recipient bacterium. Thus, the genetically engineered bacterium according to an embodiment of the present invention can produce high amino acids.

[0074] According to an embodiment of the present invention, the recipient bacteria is selected from Corynebacterium glutamicum.

[0075] Those skilled in the art will appreciate that the features and advantages described above for the recombinant expression vector are also applicable to the genetically engineered bacteria and will not be described in detail here.

[0076] Reagent test kit

[0077] In another aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the aforementioned recombinant expression vector or the aforementioned genetically engineered bacteria. Thus, the purpose of high amino acid production can be achieved by using the kit according to the embodiment of the present invention.

[0078] Those skilled in the art will appreciate that the features and advantages described above for the recombinant expression vector and genetically engineered bacteria are also applicable to the kit and will not be described in detail herein.

[0079] Method for obtaining modified phosphoenolpyruvate carboxylase

[0080] Another aspect of the present invention, the present invention proposes a method for the phosphoenolpyruvate carboxylase that obtains transformation. According to embodiments of the present invention, the method comprises: the 771st, the 931st and / or the 943rd amino acid in the amino acid sequence of wild-type phosphoenolpyruvate carboxylase are mutated to obtain the phosphoenolpyruvate carboxylase of the transformation. The activity of phosphoenolpyruvate carboxylase can be significantly affected by mutating 3 amino acid residues on the amino acid sequence of wild-type phosphoenolpyruvate carboxylase, further affecting the amino acid yield of Corynebacterium glutamicum fermentation. And then, by replacing at least one of the three sites of amino acids, contribute to improve the amino acid yield of Corynebacterium glutamicum fermentation, good application prospects.

[0081] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase is derived from plants, preferably sorghum. Thus, the modified phosphoenolpyruvate carboxylase helps to improve the amino acid carbon flux of Corynebacterium glutamicum fermentation and achieve high amino acid yield.

[0082] According to an embodiment of the present invention, the wild-type phosphoenolpyruvate carboxylase has an amino acid sequence as shown in SEQ ID NO: 1 or an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1; the 771st serine of the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by tyrosine, the 931st lysine is replaced by glutamine, and / or the 943rd aspartic acid is replaced by asparagine. Thus, the modified phosphoenolpyruvate carboxylase helps to improve the amino acid carbon flux of Corynebacterium glutamicum fermentation and achieve high amino acid production.

[0083] Those skilled in the art will appreciate that the features and advantages described above for phosphoenolpyruvate carboxylase are also applicable to the method for obtaining the modified phosphoenolpyruvate carboxylase, and will not be described in detail here.

[0084] use

[0085] In another aspect of the present invention, the present invention proposes the application of the phosphoenolpyruvate carboxylase of the aforementioned transformation, the nucleic acid of the phosphoenolpyruvate carboxylase of the described coding transformation, the recombinant expression vector, and the genetic engineering bacteria in improving amino acid production. Thus, the phosphoenolpyruvate carboxylase of the transformation according to the embodiment of the present invention, the nucleic acid encoding it, the recombinant expression vector, and the genetic engineering bacteria help to improve the amino acid production of Corynebacterium glutamicum fermentation, and has a good application prospect.

[0086] Those skilled in the art will appreciate that the features and advantages described above for the modified phosphoenolpyruvate carboxylase, the nucleic acid encoding the modified phosphoenolpyruvate carboxylase, the recombinant expression vector, and the genetically engineered bacteria are also applicable to this use and will not be described in detail herein.

[0087] Method for increasing amino acid production of Corynebacterium glutamicum

[0088] In another aspect of the present invention, the present invention proposes a kind of method that improves Corynebacterium glutamicum amino acid production.According to embodiments of the present invention, described method comprises: the aforementioned recombinant expression vector is transformed in the Corynebacterium glutamicum, and the genetically engineered bacteria after the conversion is carried out fermentation culture.Thus, the recombinant expression vector expresses phosphoenolpyruvate carboxylase in the Corynebacterium glutamicum fermentation process, and the enzyme activity is high, helps to improve amino acid production.

[0089] According to an embodiment of the present invention, the amino acids include aspartic acid family amino acids and glutamic acid family amino acids. The inventors have found that the production of aspartic acid family amino acids and glutamic acid family amino acids can be significantly increased by transforming the aforementioned recombinant expression vector into Corynebacterium glutamicum.

[0090] According to an embodiment of the present invention, aspartic acid family amino acids include aspartic acid, lysine, threonine, methionine and / or isoleucine; glutamic acid family amino acids include glutamic acid, proline, glutamine, and arginine. The inventors have found that the production of the above-mentioned aspartic acid family amino acids and glutamic acid family amino acids can be significantly increased by transforming the aforementioned recombinant expression vector into Corynebacterium glutamicum.

[0091] Those skilled in the art will appreciate that the features and advantages described above for the recombinant expression vector are also applicable to the method for increasing the amino acid production of Corynebacterium glutamicum, and will not be described in detail here.

[0092] Method for producing amino acids

[0093] In another aspect of the present invention, the present invention proposes a method for producing amino acid. According to an embodiment of the present invention, the method comprises: the genetically engineered bacteria described above are subjected to fermentation culture. Thus, the recombinant expression vector expresses phosphoenolpyruvate carboxylase in the fermentation process of Corynebacterium glutamicum, and the enzyme activity is high, which helps to improve the amino acid yield.

[0094] According to an embodiment of the present invention, the amino acids include aspartic acid family amino acids and glutamic acid family amino acids. The inventors have found that the use of the aforementioned genetically engineered bacteria can significantly increase the production of aspartic acid family amino acids and glutamic acid family amino acids.

[0095] According to an embodiment of the present invention, aspartic acid amino acids include aspartic acid, lysine, lysine, threonine, methionine and / or isoleucine; glutamic acid amino acids include glutamic acid, proline, glutamine, and arginine. The inventors have found that the use of the aforementioned genetically engineered bacteria can significantly increase the production of the above-mentioned aspartic acid amino acids and glutamic acid amino acids.

[0096] Those skilled in the art will appreciate that the features and advantages described above for genetically engineered bacteria are also applicable to the method for producing amino acids, and will not be described in detail herein.

[0097] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0098] Plasmid pk18mobsacB was purchased from Wuhan Miaoling Biotechnology Co., Ltd., shuttle plasmid PXMJ19 was purchased from Protin Biotechnology (Beijing) Co., Ltd., and Escherichia coli DH5α was commonly used in the field; DNA polymerase (Q5 High-Fidelity DNA Polymerase) was purchased from Gene Co., Ltd.; restriction endonucleases (EcoRI, SalI, EcoRV), DNA marker, plasmid extraction kit, DNA gel recovery and purification kit were all purchased from Takara Bioengineering (Dalian) Co., Ltd.; bacterial genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., and Onestep clonning cloning and recombination kit was purchased from NEB Beijing Company; kanamycin sulfate was purchased from Biosharp Company; sucrose and other chemical reagents were all of Chinese medicine analytical grade. The plasmid extraction operation steps refer to the instructions of the plasmid mini-extraction kit; the DNA gel recovery operation steps refer to the instructions of the DNA gel recovery kit; the glutamicum genome extraction operation steps refer to the instructions of the bacterial genome DNA extraction kit; the DNA fragment recombination and connection operation steps refer to the instructions of the Onestep clonning cloning recombination kit; the preparation and transformation method of Corynebacterium glutamicum competent state refer to the method of van der Rest et al. (ME vander Rest, C. Lange, D. Molenaar. A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biotechnol. 1999, 52: 541-545). The amino acid content in the fermentation broth was detected by an amino acid analyzer (Hitachi 8800).

[0099] In the following examples, the enzyme activity is catalyzed by PEPC to generate oxaloacetate and hydrogen phosphate ions from phosphoenolpyruvate and carbon dioxide, and malate dehydrogenase further catalyzes oxaloacetate and NADH to generate malic acid and NAD+, and the NADH reduction rate is measured at 340nm to calculate the PEPC activity. The consumption of 1 nmol NADH per minute per mg of tissue protein is defined as one enzyme activity unit. The method for determining protein content used in the present invention is the BCA kit detection method.

[0100] The formula of isoleucine seed culture medium is: 3.0% glucose, 2.5% ammonium sulfate, 3.5% corn steep liquor, 0.3% yeast extract, 0.3% silk peptide powder, 0.1% dipotassium hydrogen phosphate, 0.05% magnesium sulfate, 4% calcium carbonate, and the balance is deionized water, with a pH of 7; the % is weight-volume (g / mL) percentage.

[0101] The formula of isoleucine fermentation medium is: 16.0% glucose, 0.8% ammonium sulfate, 3.5% corn steep liquor, 0.3% yeast extract, 0.3% silk peptide powder, 0.1% dipotassium hydrogen phosphate, 0.05% magnesium sulfate, and the balance is deionized water, with a pH of 7; the percentage is weight-volume (g / mL) percentage.

[0102] The formula of arginine seed culture medium is: glucose 3.0%, dipotassium hydrogen phosphate 0.2%, urea 0.12%, ammonium sulfate 0.5%, yeast extract 0.5%, corn steep liquor 5.5%, magnesium sulfate 0.04%, biotin 50ug / L, silk peptide powder 1.0%, corn oil 10 drops / L, light calcium carbonate 1%.

[0103] The formula of arginine fermentation medium is: 12.5% ​​glucose, 0.15% dipotassium hydrogen phosphate, 0.1% urea, 4.5% ammonium sulfate, 0.5% yeast extract, 5.5% corn steep liquor, 0.05% magnesium sulfate, 0.05% biotin, 0.1% vitamin B1, 10 drops / L of corn oil, 4.0% molasses, 0.3% silk peptide powder, 0.5% light calcium carbonate, and the balance is deionized water, with a pH of 7; the % is the weight volume (g / mL) percentage.

[0104] Example 1

[0105] Based on the characteristics of Corynebacterium glutamicum, codon optimization was performed on the phosphoenolpyruvate carboxylase encoding sorghum (SEQ ID NO: 2) to obtain the nucleotide sequence shown in SEQ ID NO: 3.

[0106] Example 2

[0107] Site-directed mutagenesis of phosphoenolpyruvate carboxylase gene (PEPC) and construction of recombinant vector pet28a-pepcTB capable of expressing in Escherichia coli

[0108] Using the synthetic PEPC vector as a template, the following primers were used to amplify the mutant phosphoenolpyruvate carboxylase encoding gene PEPC by inverse PCR, and a 6×HIS tag was added to the C-terminus of the gene for the convenience of subsequent purification. The enzyme used was Q5 high-fidelity enzyme.

[0109] For the mutation of serine to tyrosine at the 771st phosphorylation site at the N-terminus, the primers are as follows:

[0110] 5'-CTTCTACTGGACCCAGACCCGCTTCCACCTGCCAGTTTGGCTGGG-3' (SEQ ID NO: 4)

[0111] 3'-TGGGTCCAGTAGAAGATCCATGGGATAGCGCGCAGGGTGGTGATG-5' (SEQ ID NO: 5)

[0112] The 931st lysine was mutated to glutamine, and the primers were as follows:

[0113] 5'-CCTGGTTCAGCTGAACGGCGAGCGCGTTCCACCAGGCCTGGAGAA-3' (SEQ IDNO: 6)

[0114] 3'-TTCAGCTGAACCAGGCCAGCTGGCTTGTTCTCGTCAGCGAACTCC-5' (SEQ ID NO: 7)

[0115] The aspartic acid at position 943 was mutated to asparagine, and the primers were as follows:

[0116] 5'-CCTGGAGAACACCCTGATCCTGACCATGAAGGGCATCGCTGCTGG-3' (SEQ ID NO: 8)

[0117] 3'-AGGGTGTTCTCCAGGCCTGGTGGAACGCGCTCCGCCGTTCAGCTGA-5' (SEQ ID NO: 9)

[0118] PEPC amplification primers:

[0119] 5'-CAATTCCCCTCTAGAATGGCTTCCGAGCGCCACCAC-3' (SEQ ID NO: 10)

[0120] 5'-TTAGTGGTGGTGGTGGTGGTG-3' (SEQ ID NO: 11)

[0121] High-fidelity Q5 High-Fidelity DNA Polymerase polymerase PCR amplified the nucleotide fragment pepc of about 2.9kb. The PCR reaction system (50μl) is: 5×Q5 reaction buffer 10μl, 10mM dNTP 1μl, primers 2.5μl each, template depending on sample concentration, Q5 enzyme 0.5μl, add water to 50μl. The reaction conditions are: 98℃30s, 98℃10s, 55℃-72℃30s, 72℃1.5min, 33 cycles; 72℃2min. 1% agarose gel electrophoresis detection and DNA gel recovery kit purification and recovery of 2.9kb 4 PCR products.

[0122] When the 771st and 931st positions mutated at the same time, the 931st mutated PEPC gene vector was used as a template, and the 771st position mutation primer was used to perform reverse PCR at the 771st position. The obtained product was detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit, and then the 771st and 931st mutated phosphoenolpyruvate carboxylase gene was amplified with Pepc amplification primers. The final product was detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit.

[0123] When the 771st and 943rd positions are mutated at the same time, the PEPC gene vector with the 771st position mutation is used as a template, and the 943th position mutation primer is used to perform reverse PCR at the 943rd position, and the obtained product is detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit, and then the 771st and 943rd position mutated phosphoenolpyruvate carboxylase gene is amplified with the Pepc amplification primer. The final product is detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit.

[0124] When the 931st and 943rd positions are mutated at the same time, the 931st mutated PEPC gene vector is used as a template, and the 943th position mutation primer is used to perform reverse PCR at the 943rd position. The obtained product is detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit, and then the 931st and 943rd mutated phosphoenolpyruvate carboxylase gene is amplified with Pepc amplification primers. The final product is detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit.

[0125] When the 771st, 931st and 943rd positions are mutated simultaneously, the PEPC gene vector with the 771st and 931st positions mutated simultaneously is used as a template, and the 943th position mutation primer is used to perform reverse PCR at the 943rd position, and the obtained product is detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit, and then the 771st, 931st and 943rd positions mutated phosphoenolpyruvate carboxylase gene is amplified by Pepc amplification primers. The final product is detected by 1% agarose gel electrophoresis and purified and recovered by a DNA gel recovery kit.

[0126] Plasmid pet28a (plasmid pet28a purchased from Wuhan Miaoling Biotechnology Co., Ltd.) was double-digested with XbaI / BamHI, and the reaction system was: 1 μg of plasmid, 5 μl of 10× buffer, 1 μl of XbaI, 1 μl of BamHI, and water was added to 50 μl. Enzyme digestion was carried out at 37°C for 2 h. Detection was performed by 1% agarose gel electrophoresis and a 5.3 kb nucleotide fragment was recovered using a DNA gel recovery and purification kit.

[0127] The Onestep clonning cloning and recombination kit was used to recombinant the double-enzyme digestion products (i.e., XbaI / BamHI double-enzyme digestion plasmid pet28a) and the mutated pepc fragment. The recombinant products were transformed into Escherichia coli BL21 and plated on a plate containing kanamycin sulfate. After overnight culture at 37°C, transformants were selected for sequencing verification. The correctly sequenced transformants contained the recombinant plasmid pet28a-pepcTB, which were named pet28a-pepcTB1 (serine at position 771 was mutated to tyrosine), pet28a-pepcTB2 (lysine at position 931 was mutated to glutamine), pet28a-pepcTB3 (lysine at position 943 was mutated to glutamine), and pet28a-pepcTB4 (lysine at position 943 was mutated to glutamine). Aspartic acid mutated to asparagine), pet28a-pepcTB12 (serine mutated to tyrosine at position 771 and lysine mutated to glutamine at position 931), pet28a-pepcTB13 (serine mutated to tyrosine at position 771 and aspartic acid mutated to asparagine at position 943), pet28a-pepcTB23 (lysine mutated to glutamine at position 931 and aspartic acid mutated to asparagine at position 943), and pet28a-pepcTB123 (serine mutated to tyrosine at position 771 and lysine mutated to glutamine at position 931 and aspartic acid mutated to asparagine at position 943).

[0128] Example 3

[0129] According to the conventional protocol, the recombinant vectors pet28a-pepcTB1, pet28a-pepcTB2, pet28a-pepcTB3, pet28a-pepcTB12, pet28a-pepcTB13, pet28a-pepcTB23, and pet28a-pepcTB123 were transformed into the E. coli strain BL21 (DE3) CodonPlus RIPL. The recombinant E. coli strains generated by the transformation experiments were designated as: E. coli pepc1, E. coli pepc2, E. coli pepc3, E. coli pepc12, E. coli pepc13, E. colipe pepc23, and E. coli pepc123.

[0130] The above recombinant E. coli strain was cultured in LB medium containing 50 mg / L kanamycin at 37°C until OD600 reached 0.4-1.0. Then, 0.1-0.5 Mm / L IPTG was added to the medium, and the bacteria were cultured at 30°C for another 4-16 hours. The cells were collected by centrifugation, washed and suspended with buffer (20 mM Tris-HCl, Ph6.8). Ultrasonic disruption was performed at 100 W, 30 min, 4°C, 12 000 r / min centrifugation for 2 min, and the resulting supernatant was the crude enzyme solution.

[0131] Example 4

[0132] Analysis of enzymatic properties of Escherichia coli mutant phosphoenolpyruvate carboxylase:

[0133] According to the conventional scheme, the crude enzyme solution was separated by SDS-PAGE electrophoresis. The target protein was about 102KDa in size, and the protein content was detected by BCA protein detection kit. The target protein was purified by nickel column affinity chromatography. The principle is that polyhistidine can bind to a variety of transition metals and transition metal chelates, so the protein with exposed 6X His-tag can bind to the solidified Ni2+ resin, thereby distinguishing the fusion protein with his-tag histidine tag from other proteins. When we elute with a high concentration of imidazole solution, imidazole competes with the imidazole ring of the fusion protein his-tag and finally elutes the fusion protein. The purified protein was detected by SDS-PAGE electrophoresis again.

[0134] The enzyme activity was determined by the phosphoenolpyruvate carboxylase enzyme activity detection kit. The principle is that PEPC catalyzes phosphoenolpyruvate and carbon dioxide to generate oxaloacetate and hydrogen phosphate ions, and malate dehydrogenase further catalyzes oxaloacetate and NADH to generate malic acid and NAD+, and the change in absorbance at 340nm is measured by a UV spectrophotometer. The consumption of 1 nmol NADH per minute per mg of protein is defined as one unit of enzyme activity.

[0135] The effects of mutations at different sites on the activity of phosphoenolpyruvate carboxylase are different, and the results of enzyme activity determination are shown in Table 1. It can be seen that the activity of phosphoenolpyruvate carboxylase has different degrees of change after mutation. The 771st phosphorylation site serine mutates to tyrosine, which ultimately increases the enzyme activity by 1.96 times on the original basis; the 931st lysine mutates to glutamine, which increases the affinity for phosphoenolpyruvate, and ultimately increases the enzyme activity by 3.79 times on the original basis; the 943rd aspartic acid mutates to asparagine, which reduces the sensitivity to glycine, and ultimately increases the enzyme activity by 6.3 times on the original basis; the 771st phosphorylation site serine mutates to tyrosine, and the 931st lysine mutates to glutamine, which is the most The enzyme activity was ultimately increased by 5.44 times on the original basis; the serine at the 771st phosphorylation site mutated into tyrosine, and the aspartic acid at the 943rd position mutated into asparagine, which ultimately increased the enzyme activity by 3.41 times on the original basis; the lysine at the 931st position mutated into glutamine, and the aspartic acid at the 943rd position mutated into asparagine, which ultimately increased the enzyme activity by 12.05 times on the original basis; the serine at the 771st phosphorylation site mutated into tyrosine, and the lysine at the 931st position mutated into glutamine, and the aspartic acid at the 943rd position mutated into asparagine, which ultimately increased the enzyme activity by 6.41 times on the original basis.

[0136] Table 1 Enzyme activity determination of Escherichia coli mutant strains

[0137]

[0138] Example 5

[0139] Construction of Corynebacterium glutamicum expression vectors for single-point mutation and combined mutation PEPC genes

[0140] First, in the basic plasmid PVcase (plasmid map as Figure 1 The constitutive expression vector PVcaseG with gapa as the promoter and rrnB as the terminator was constructed on the basis of the above-mentioned primers. The amplification of the promoter and terminator was carried out using the genome of the existing strain m13 in the laboratory as a template, and the primers used were as follows:

[0141] Gapa amplification

[0142] 5'-ATTCGAGCTCGGTACCCCGAAGATCTGAAGATTCCTG-3' (SEQ ID NO: 12)

[0143] 5'-ACAGCCATGGAGATCTGGTGTGTCTCCTCTAAAGATTG-3' (SEQ ID NO: 13)

[0144] RrnB amplification

[0145] 5'-TTAGAGGAGACACACCAGATCTCCATGGCTGTTTTG-3' (SEQ ID NO: 14)

[0146] 5'-TGCCTGCAGGTCGACATGAAAGAGTTTGTAGAAACGC-3' (SEQ ID NO: 15)

[0147] The plasmid PVcase was double-digested with KpnI / SalI and the constitutive expression vector PVcaseG was constructed by the one-step cloning method as described above.

[0148] Using plasmid PVcaseG as a template, the target product obtained by inverse PCR amplification is a linear vector after gel recovery. The amplification primers are as follows:

[0149] 5'-CACCACCACCACTAAAGATCTCCATGGCTGTTTTG-3'(SEQ ID NO: 16)

[0150] 5'-GCGCTCGGAAGCCATGGTGTGTCTCCTCTAAAGATTG-3' (SEQ ID NO: 17)

[0151] Plasmids pet28a-pepcTB1, pet28a-pepcTB2, pet28a-pepcTB3, pet28a-pepcTB12, pet28a-pepcTB13, pet28a-pepcTB23, and pet28a-pepcTB123 were used as templates to amplify single point mutation and combined mutation PEPC genes. The amplification primers are as follows:

[0152] 5'-TAGAGGAGACACACCATGGCTTCCGAGCGCCACCAC-3' (SEQ ID NO: 18)

[0153] 5'CAGCCATGGAGATCTTTAGTGGTGGTGGTGGTGGTGGCCGGTGTTCTGCATGCCAG-3' (SEQ IDNO: 19)

[0154] The linear vector and the mutated pepc fragment were recombined by Onestep clonning recombination kit. The recombinant products were transformed into Escherichia coli DH5α and spread on plates containing kanamycin sulfate. After overnight culture at 37°C, transformants were selected for sequencing verification. The correctly sequenced transformants contained the recombinant plasmid PVcaseG-pepcTB and were named PVcaseG-pepcTB1, PVcaseG-pepcTB2, PVcaseG-pepcTB3, PVcaseG-pepcTB12, PVcaseG-pepcTB13, PVcaseG-pepcTB23, and PVcaseG-pepcTB123, respectively.

[0155] According to the conventional protocol, different PVcaseG-pepcTB vectors were simultaneously electroporated into C. glutamicum H5 and C. glutamicum H1. The recombinant C. glutamicum produced by the transformation experiment were named: H5-Vpepc1, H5-Vpepc2, H5-Vpepc3, H5-Vpepc12, H5-Vpepc13, H5-Vpepc23, H5-Vpepc123; H1-Vpepc1, H1-Vpepc2, H1-Vpepc3, H1-Vpepc12, H1-Vpepc13, H1-Vpepc23, H1-Vpepc123.

[0156] Example 6

[0157] Expression and activity determination of phosphoenolpyruvate carboxylase in recombinant strains

[0158] The control strains C.glutamicum H5 and C.glutamicum H1 and the above-mentioned recombinant Corynebacterium glutamicum were inoculated into isoleucine and arginine fermentation medium, respectively, and cultured at 30°C for 36 hours. The fermentation broth was collected by centrifugation at 4°C and 10,000 r / min for 2 minutes, washed twice with 0.1 mol HCL, and then washed 3 times with pH 7.5, 0.1 mol / L phosphate buffer, and then resuspended and ultrasonically disrupted. The disruption conditions were 300W for 1 hour. The supernatant was centrifuged at 4°C and 10,000 r / min for 2 minutes to measure the enzyme activity. The enzyme activity was measured by the phosphoenolpyruvate carboxylase enzyme activity detection kit. The results are shown in Table 1. Compared with the control strain C.glutamicum H5, the enzyme activities of the recombinant strains H5-Vpepc1, H5-Vpepc2, H5-Vpepc3, H5-Vpepc12, H5-Vpepc13, H5-Vpepc23, and H5-Vpepc123 were all improved to varying degrees, especially H5-Vpepc23, which was increased by 7.68 times. Compared with the control strain C.glutamicum H1, the enzyme activities of the recombinant strains H1-Vpepc1, H1-Vpepc2, H1-Vpepc3, H1-Vpepc12, H1-Vpepc13, H1-Vpepc23, and H1-Vpepc123 were also improved to varying degrees, and the enzyme activity of H1-Vpepc23 was the most significantly improved, with the final enzyme activity increased by 7.49 times.

[0159] Table 2 Determination of enzyme activity of mutant strains of Corynebacterium glutamicum

[0160]

[0161] Note: C. glutamicum H5 was deposited in China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on November 1, 2016. The strain name is Corynebacterium glutamicum, the strain number is H5, and the deposit number is CCTCC NO: M2016609.

[0162] C. glutamicum H1 was deposited in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on October 26, 2020. The strain name is Corynebacterium glutamicum H1, the classification number is Corynebacterium glutamicum H1, and the preservation number is CCTCC NO: M 2020644.

[0163] Example 7

[0164] Taking strain C. glutamicum H5 as control, recombinant bacteria H5-Vpepc1, H5-Vpepc2, H5-Vpepc3, H5-Vpepc12, H5-Vpepc13, H5-Vpepc23, and H5-Vpepc123 were placed in a 5L fermenter for culture. 1 ml of glycerol strains of the control bacteria and the recombinant bacteria were streaked on a solid activation medium, and cultured at 30° C. for 16 hours; an inoculated loop of the activated medium was transferred to, for example, 100 ml of seed culture medium, and cultured at 30° C. and 200 rpm for 12 to 16 hours. The seeds were inoculated into a 5L fermentation tank containing 3L fermentation medium at a volume ratio of 10%, the temperature was controlled at 30°C, the pH was controlled at 7.0 with ammonia water, the dissolved oxygen was maintained at 30% by adjusting the rotation speed and ventilation volume, and when the residual sugar content was lower than 1.5%, 80% glucose was added to maintain the residual sugar content at 1.5-2.5%, and the fermentation time was more than 55h, and the fermentation time in this embodiment was 65h. After the fermentation was completed, the fermentation liquid was centrifuged and the supernatant was derivatized, and the main amino acids were analyzed using HPLC. The experimental results are shown in Table 3. The results show that enhancing the PEPC enzyme activity can significantly change the production of aspartic acid amino acids and glutamic acid amino acids. Compared with the control strain, the production of aspartic acid amino acids and glutamic acid amino acids of the recombinant bacteria increased to varying degrees. The effect of the recombinant bacteria H5-Vpepc23 was the most obvious. The total production of aspartic acid amino acids increased from 46.5g / L to 54.94g / L, an increase of 18.15%, especially isoleucine, the production increased from 38.83g / L to 42.95g / L, an increase of 10.61%; glutamic acid amino acids increased from 3.81g / L to 9.48g / L, an increase of 1.49 times.

[0165] Table 3 Amino acid analysis in fermentation broth

[0166]

[0167]

[0168] Example 8

[0169] With strain C. glutamicum H1 as a control, the recombinant bacteria H1-Vpepc1, H1-Vpepc2, H1-Vpepc3, H1-Vpepc12, H1-Vpepc13, H1-Vpepc23, and H1-Vpepc123 were placed in a 5L fermenter for culture. A single colony was picked from the plate and inoculated into the seed culture medium, and the culture was shaken for 12 hours at a temperature of 32° C. and a speed of 200 r / min to obtain a seed solution; the seed culture solution was merged into a feed bottle according to a 5% inoculation amount, and the feed pipe was connected, and the seed culture solution was inoculated into the fermentation medium to start fermentation culture. The temperature was controlled at 30°C, the tank pressure was 0.03-0.08Mpa, the pH was controlled at 7.0 by ammonia water, the dissolved oxygen was maintained at 30% by adjusting the rotation speed and ventilation volume, and when the residual sugar content was lower than 3.0%, 80% glucose was added to maintain the residual sugar content at 1.5-3.0%, and the fermentation time was more than 72h. After the fermentation, the fermentation liquid was centrifuged and the supernatant was derivatized, and the main amino acids were analyzed by HPLC. The experimental results are shown in Table 4. The results show that enhancing the PEPC enzyme activity can significantly change the carbon flux of aspartic acid amino acids and glutamic acid amino acids. Compared with the control strain, the production of aspartic acid amino acids and glutamic acid amino acids of the recombinant bacteria increased to varying degrees. The effect of the recombinant bacteria H1-Vpepc23 was the most obvious. The total production of aspartic acid amino acids increased from 21.02g / L to 33.89g / L, an increase of 61.23%; the production of glutamic acid amino acids increased from 98.61g / L to 127.94g / L, an increase of 29.74%. In particular, the production of arginine increased from 66.83g / L to 83.67g / L, an increase of 25.20%.

[0170] Table 4 Amino acid yield

[0171]

[0172] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0173] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Wuhan Yuanda Hongyuan Co., Ltd. <120> Modified phosphoenolpyruvate carboxylase and its application in improving amino acid production in Corynebacterium glutamicum <130> PIDC3205449PCN <160> 19 <170> PatentIn version 3.3 <210> 1 <211> 960 <212> PRT <213> Artificial <220> <223> 1 <400> 1 Met Ala Ser Glu Arg His His Ser Ile Asp Ala Gln Leu Arg Ala Leu 1 5 10 15 Ala Pro Gly Lys Val Ser Glu Glu Leu Ile Gln Tyr Asp Ala Leu Leu 20 25 30 Val Asp Arg Phe Leu Asp Ile Leu Gln Asp Leu His Gly Pro Ser Leu 35 40 45 Arg Glu Phe Val Gln Glu Cys Tyr Glu Val Ser Ala Asp Tyr Glu Gly 50 55 60 Lys Lys Asp Thr Ser Lys Leu Gly Glu Leu Gly Ala Lys Leu Thr Gly 65 70 75 80 Leu Ala Pro Ala Asp Ala Ile Leu Val Ala Ser Ser Ile Leu His Met 85 90 95 Leu Asn Leu Ala Asn Leu Ala Glu Glu Val Glu Leu Ala His Arg Arg 100 105 110 Arg Asn Ser Lys Leu Lys His Gly Asp Phe Ser Asp Glu Gly Ser Ala 115 120 125 Thr Thr Glu Ser Asp Ile Glu Glu Thr Leu Lys Arg Leu Val Ser Leu 130 135 140 Gly Lys Thr Pro Ala Glu Val Phe Glu Ala Leu Lys Asn Gln Ser Val 145 150 155 160 Asp Leu Val Phe Thr Ala His Pro Thr Gln Ser Ala Arg Arg Ser Leu 165 170 175 Leu Gln Lys Asn Ala Arg Ile Arg Asn Cys Leu Thr Gln Leu Ser Ala 180 185 190 Lys Asp Val Thr Val Glu Asp Lys Lys Glu Leu Asp Glu Ala Leu His 195 200 205 Arg Glu Ile Gln Ala Ala Phe Arg Thr Asp Glu Ile Arg Arg Ala Gln 210 215 220 Pro Thr Pro Gln Asp Glu Met Arg Tyr Gly Met Ser Tyr Ile His Glu 225 230 235 240 Thr Val Trp Asn Gly Val Pro Lys Phe Leu Arg Arg Val Asp Thr Ala 245 250 255 Leu Lys Asn Ile Gly Ile Asn Glu Arg Leu Pro Tyr Asp Val Pro Leu 260 265 270 Ile Lys Phe Cys Ser Trp Met Gly Gly Asp Arg Asp Gly Asn Pro Arg 275 280 285 Val Thr Pro Glu Val Thr Arg Asp Val Cys Leu Leu Ser Arg Met Met 290 295 300 Ala Ala Asn Leu Tyr Ile Asn Gln Val Glu Asp Leu Met Phe Glu Leu 305 310 315 320 Ser Met Trp Arg Cys Asn Asp Glu Leu Arg Ala Arg Ala Glu Glu Val 325 330 335 Gln Ser Thr Pro Ala Ser Lys Lys Val Thr Lys Tyr Tyr Ile Glu Phe 340 345 350 Trp Lys Gln Ile Pro Pro Asn Glu Pro Tyr Arg Val Ile Leu Gly Ala 355 360 365 Val Arg Asp Lys Leu Tyr Asn Thr Arg Glu Arg Ala Arg His Leu Leu 370 375 380 Ala Thr Gly Phe Ser Glu Ile Ser Glu Asp Ala Val Phe Thr Lys Ile 385 390 395 400 Glu Glu Phe Leu Glu Pro Leu Glu Leu Cys Tyr Lys Ser Leu Cys Glu 405 410 415 Cys Gly Asp Lys Ala Ile Ala Asp Gly Ser Leu Leu Asp Leu Leu Arg 420 425 430 Gln Val Phe Thr Phe Gly Leu Ser Leu Val Lys Leu Asp Ile Arg Gln 435 440 445 Glu Ser Glu Arg Gln Thr Asp Val Ile Asp Ala Ile Thr Thr His Leu 450 455 460 Gly Ile Gly Ser Tyr Arg Ser Trp Pro Glu Asp Lys Arg Met Glu Trp 465 470 475 480 Leu Val Ser Glu Leu Lys Gly Lys Arg Pro Leu Leu Pro Pro Asp Leu 485 490 495 Pro Met Thr Glu Glu Ile Ala Asp Val Ile Gly Ala Met Arg Val Leu 500 505 510 Ala Glu Leu Pro Ile Asp Ser Phe Gly Pro Tyr Ile Ile Ser Met Cys 515 520 525 Thr Ala Pro Ser Asp Val Leu Ala Val Glu Leu Leu Gln Arg Glu Cys 530 535 540 Gly Ile Arg Gln Thr Leu Pro Val Val Pro Leu Phe Glu Arg Leu Ala 545 550 555 560 Asp Leu Gln Ala Ala Pro Ala Ser Val Glu Lys Leu Phe Ser Thr Asp 565 570 575 Trp Tyr Ile Asn His Ile Asn Gly Lys Gln Gln Val Met Val Gly Tyr 580 585 590 Ser Asp Ser Gly Lys Asp Ala Gly Arg Leu Ser Ala Ala Trp Gln Leu 595 600 605 Tyr Val Ala Gln Glu Glu Met Ala Lys Val Ala Lys Lys Tyr Gly Val 610 615 620 Lys Leu Thr Leu Phe His Gly Arg Gly Gly Thr Val Gly Arg Gly Gly 625 630 635 640 Gly Pro Thr His Leu Ala Ile Leu Ser Gln Pro Pro Asp Thr Ile Asn 645 650 655 Gly Ser Ile Arg Val Thr Val Gln Gly Glu Val Ile Glu Phe Met Phe 660 665 670 Gly Glu Glu Asn Leu Cys Phe Gln Ser Leu Gln Arg Phe Thr Ala Ala 675 680 685 Thr Leu Glu His Gly Met His Pro Pro Val Ser Pro Lys Pro Glu Trp 690 695 700 Arg Lys Leu Met Glu Glu Met Ala Val Val Ala Thr Glu Glu Tyr Arg 705 710 715 720 Ser Val Val Val Lys Glu Pro Arg Phe Val Glu Tyr Phe Arg Ser Ala 725 730 735 Thr Pro Glu Thr Glu Tyr Gly Lys Met Asn Ile Gly Ser Arg Pro Ala 740 745 750 Lys Arg Arg Pro Gly Gly Gly Ile Thr Thr Leu Arg Ala Ile Pro Trp 755 760 765 Ile Phe Ser Trp Thr Gln Thr Arg Phe His Leu Pro Val Trp Leu Gly 770 775 780 Val Gly Ala Ala Phe Lys Trp Ala Ile Asp Lys Asp Ile Lys Asn Phe 785 790 795 800 Gln Lys Leu Lys Glu Met Tyr Asn Glu Trp Pro Phe Phe Arg Val Thr 805 810 815 Leu Asp Leu Leu Glu Met Val Phe Ala Lys Gly Asp Pro Gly Ile Ala 820 825 830 Gly Leu Tyr Asp Glu Leu Leu Val Ala Glu Glu Leu Lys Pro Phe Gly 835 840 845 Lys Gln Leu Arg Asp Lys Tyr Val Glu Thr Gln Gln Leu Leu Leu Gln 850 855 860 Ile Ala Gly His Lys Asp Ile Leu Glu Gly Asp Pro Tyr Leu Lys Gln 865 870 875 880 Gly Leu Arg Leu Arg Asn Pro Tyr Ile Thr Thr Leu Asn Val Phe Gln 885 890 895 Ala Tyr Thr Leu Lys Arg Ile Arg Asp Pro Ser Phe Lys Val Thr Pro 900 905 910 Gln Pro Pro Leu Ser Lys Glu Phe Ala Asp Glu Asn Lys Pro Ala Gly 915 920 925 Leu Val Lys Leu Asn Gly Glu Arg Val Pro Pro Gly Leu Glu Asp Thr 930 935 940 Leu Ile Leu Thr Met Lys Gly Ile Ala Ala Gly Met Gln Asn Thr Gly 945 950 955 960 <210> 2 <211> 2883 <212> DNA <213> Artificial <220> <223> 2 <400> 2 atggcgtccg agcggcacca ctccatcgac gcgcagctcc gtgccctcgc acccggcaag 60 gtctccgagg agctcatcca gtatgacgcc ctgctcgtcg accgcttcct cgacatcctc 120 caggacctcc atggccccag ccttcgcgaa tttgtccagg agtgctacga ggtgtcggcc 180 gactacgagg gcaagaaaga cacgtccaag ctgggggagc tgggagccaa gctgacgggg 240 ctggcccccg ccgacgccat cctggtggcg agctccatcc tgcacatgct caacctcgcc 300 aacctggcgg aggaagtgga gctggcgcac cgccgccgga acagcaagct caagcacgggg 360 gacttctccg acgagggctc cgccaccacc gagtccgaca tcgaggagac gctcaagcgc 420 ctcgtgtcgc tcggcaagac ccccgcggag gtgttcgagg cgctcaagaa ccagagcgtc 480 gacctcgtct tcaccgcgca tcccacgcag tccgccagga ggtcgctcct gcagaaaaac 540 gccaggatcc ggaattgtct gacgcagctg agtgccaagg acgtcacggt cgaagacaag 600 aaggagctcg acgaggctct gcacagagag atccaagcag ctttcagaac tgatgaaatc 660 aggagagcac aacccacccc agaggatgaa atgcgctatg ggatgagcta catccatgaa 720 actgtatgga acggtgtgcc taagtttttg cgccgtgtgg atacagccct gaagaatatc 780 ggcatcaatg agcgcttcc ctacgatgtt cctctcatta agttctgttc ttggatgggt 840 ggtgaccgtg atggaaatcc aagagttact ccggaggtga caagagatgt gtgcttgctg 900 tctagaatga tggctgcaaa cttgtacatc aatcaggtcg aagacctgat gtttgagctc 960 tctatgtggc gctgcaatga tgagcttcgt gctcgagccg aagaagtcca gagtactcca 1020 gcttcaaaga aagttaccaa gtattacata gaattctgga agcaaattcc cccaaacgag 1080 ccctaccggg tgatccttgg tgctgtaagg gacaagttat aaacacag cgagcgtgca 1140 cgccatctgc tggcaactgg attttctgaa atttctgagg acgcggtatt taccaagatc 1200 gaagagttcc ttgagcccct tgagctgtgc tacaaatccc tgtgtgagtg cggcgacaag 1260 gccatcgccg acgggagcct cctggacctc cttcgccagg tgttcacgtt cggtctctcc 1320 ctggtgaagc tggacatccg gcaggagtcg gagcggcaga ccgacgtgat cgacgccatc 1380 accacgcacc tcggcatcgg gtcgtaccgc tcgtggcccg aggacaagcg gatggagtgg 1440 ctggtgtcgg agctgaaagg caagcgccca ctgctgcccc cggaccttcc catgaccgag 1500 gagatcgccg acgtcatcgg cgccatgcgc gtcctggccg agctccccgat cgacagcttc 1560 ggcccctaca tcatctccat gtgcacggcg ccctcggacg tgctcgccgt cgagctcctg 1620 cagcgcgagt gtggcattcg ccagacgctc cccgtggtgc cgctgttcga gaggctggcc 1680. gacctgcagg cggcgccggc gtccgtggag aagctcttct ccactgactg gtacatcaac 1740 cacatcaacg gcaagcagca ggtgatggtc ggctactccg actccggcaa ggacgccggc cgcctgtccg cggcgtggca gctgtacgtg gcgcaggagg agatggccaa ggtggccaag aagtacggcg tgaagctgac cttgttccac ggccgcggtg gcaccgtcgg caggggcggt ggcccgacgc acctcgccat cctgtcccag ccgccggaca ccatcaacgg gtccatccgt 1980. gtgacggtgc agggcgaggt catcgagttc atgttcgggg aggagaacct gtgcttccag tctctgcagc ggttcacggc cgccacgctg gagcacggca tgcacccgcc ggtgtctccc 2100 aagcccgagt ggcgcaagct catggaggag atggccgtcg tcgccacgga ggagtaccgc 2160. tccgtcgtcg tcaaggagcc gcgattcgtc gagtacttca gatcggctac ccctgagact gagtacggga agatgaacat cggcagcagg ccagccaaga ggaggccggg cggcggcatc accaccctgc gtgccatccc ctggatcttc tcgtggacac agacgaggtt ccacctcccc 2340 gtgtggctgg gagtcggcgc cgccttcaag tgggccatcg acaggacat caaacttc 2400 cagaagctca aggagatgta caacgagtgg ccattctca gggtcaccct ggacctgctg 2460 gagatggtt tcgccaaggg agaccctggc attgccggct tgtacgacga gctgcttgtc 2520 gccgaggaac tcaagccctt tgggaagcag ctcagggaca atacgtgga gandacagcag 2580 cttctcctac agatcgctgg gcacaaggac attcttgaag gcgatcctta cctgaagcag 2640 gggctgcgtc tgcgcaatcc ctacatcacc accctgaacg tgttccaggc ctacacgctg 2700 aagcggataa gggaccccag cttcaggtg acgccgcagc cgccgctgtc caggagttc 2760 gccgacgaga acagcccgc cggactgtg aagctgaacg gcgagcgagt accgccgggg 2820 ctggaagaca cgctcatcct caccatgaag ggtatcgccg ccggcatgca gaacaccggc 2880 tag 2883 <210> 3 <211> 2883 <212> DNA <213> Artificial <220> <223> 3 <400> 3 atggcttccg agcgccacca ctccatcgac gctcagctgc gcgctctggc tccaggcaag 60 gtttccgagg agctgatcca gtacgacgct ctgctggttg accgcttcct ggacatcctg 120 caggacctgc acggcccatc cctgcgcgag ttcgttcagg agtgctacga ggtttccgct 180 gactacgagg gcaagaagga cacctccaag ctgggcgagc tgggcgctaa gctgaccggc 240 ctggctccag ctgacgctat cctggttgct tcctccatcc tgcacatgct gaacctggct 300 aacctggctg aggaggttga gctggctcac cgccgccgca actccaagct gaagcacggc 360 gacttctccg acgagggctc cgctaccacc gagtccgaca tcgaggagac cctgaagcgc 420 ctggtttccc tgggcaagac cccagctgag gttttcgagg ctctgaagaa ccagtccgtt 480 gacctggttt tcaccgctca cccaacccag tccgctcgcc gctccctgct gcagaagaac 540 gctcgcatcc gcaactgcct gacccagctg tccgctaagg acgttaccgt tgaggacaag 600 aaggagctgg acgaggctct gcaccgcgag atccaggctg ctttccgcac cgacgagatc 660 cgccgcgctc agccaacccc acaggacgag atgcgctacg gcatgtccta catccacgag 720 accgtttgga acggcgttcc aaagttcctg cgccgcgttg acaccgctct gaagaacatc 780 ggcatcaacg agcgcctgcc atacgacgtt ccactgatca agttctgctc ctggatgggc 840 ggcgaccgcg acggcaaccc acgcgttacc ccagaggtta cccgcgacgt ttgcctgctg 900 tcccgcatga tggctgctaa cctgtacatc aaccaggttg aggacctgat gttcgagctg 960 tccatgtggc gctgcaacga cgagctgcgc gctcgcgctg aggaggttca gtccacccca 1020 gcttccaaga aggttaccaa gtactacatc gagttctgga agcagatccc accaaacgag 1080 ccataccgcg ttatcctggg cgctgttcgc gacaagctgt acaacacccg cgagcgcgct 1140 cgccacctgc tggctaccgg cttctccgag atctccgagg acgctgtttt caccaagatc 1200 gaggagttcc tggagccact ggagctgtgc tacaagtccc tgtgcgagtg cggcgacaag 1260 gctatcgctg acggctccct gctggacctg ctgcgccagg ttttcacctt cggcctgtcc 1320 ctggttaagc tggacatccg ccaggagtcc gagcgccaga ccgacgttat cgacgctatc 1380 accacccacc tgggcatcgg ctcctaccgc tcctggccag aggacaagcg catggagtgg 1440 ctggtttccg agctgaaggg caagcgccca ctgctgccac cagacctgcc aatgaccgag gagatcgctg acgttatcgg cgctatgcgc gttctggctg agctgccaat cgactccttc 1560 ggcccataca tcatctccat gtgcaccgct ccatccgacg ttctggctgt tgagctgctg 1620 cagcgcgagt gcggcatccg ccagaccctg ccagttgttc cactgttcga gcgcctggct 1680. gacctgcagg ctgctccagc ttccgttgag aagctgttct ccaccgactg gtacatcaac cacatcaacg gcaagcagca ggttatggtt ggctactccg actccggcaa ggacgctggc cgcctgtccg ctgcttggca gctgtacgtt gctcaggagg agatggctaa ggttgctaag aagtacggcg ttaagctgac cctgttccac ggccgcggcg gcaccgttgg ccgcggcggc ggcccaaccc acctggctat cctgtcccag ccaccagaca ccatcaacgg ctccatccgc 1980. gttaccgttc agggcgaggt tatcgagttc atgttcggcg aggagaacct gtgcttccag tccctgcagc gcttcaccgc tgctaccctg gagcacggca tgcacccacc agtttcccca 2100 aagccagagt ggcgcaagct gatggaggag atggctgttg ttgctaccga ggagtaccgc tccgttgttg ttaaggagcc acgcttcgtt gagtacttcc gctccgctac cccagagacc 2220 gagtacggca agatgaacat cggctcccgc ccagctaagc gccgcccagg cggcggcatc 2280 accaccctgc gcgctatccc atggatcttc tcctggaccc agacccgctt ccacctgcca 2340 gttggctgg gcgttggcgc tgctttcaag tgggctatcg acaaggacat caagaacttc 2400 cagaagctga aggagatgta caacgagtgg ccattcttcc gcgttaccct ggacctgctg 2460 gagatggtt tcgctaaggg cgacccaggc atcgctggcc tgtacgacga gctgctggtt 2520 gctgaggagc tgaagccatt cggcaagcag ctgcgcgaca agtacgttga gacccagcag 2580 ctgctgctgc agatcgctgg ccacaaggac atcctggagg gcgacccata cctgaagcag 2640 ggcctgcgcc tgcgcaaccc atacatcacc accctgaacg ttttccaggc ttacaccctg 2700 aagcgcatcc gcgacccatc cttcaaggtt accccacagc caccactgtc caaggagttc 2760 gctgacgaga acaagccagc tggcctggtt aagctgaacg gcgagcgcgt tccaccaggc 2820 ctggaggaca ccctgatcct gaccatgaag ggcatcgctg ctggcatgca gaacaccggc 2880 city ​​2883 <210> 4 <211> 45 <212> DNA <213> Artificial <220> <223> 4 <400> 4 cttctactgg acccagaccc gcttccacct gccagtttgg ctggg 45 <210> 5 <211> 45 <212> DNA <213> Artificial <220> <223> 5 <400> 5 tgggtccagt agaagatcca tgggatagcg cgcagggtgg tgatg 45 <210> 6 <211> 45 <212> DNA <213> Artificial <220> <223> 6 <400> 6 cctggttcag ctgaacggcg agcgcgttcc accaggcctg gagaa 45 <210> 7 <211> 45 <212> DNA <213> Artificial <220> <223> 7 <400> 7 ttcagctgaa ccaggccagc tggcttgttc tcgtcagcga actcc 45 <210> 8 <211> 45 <212> DNA <213> Artificial <220> <223> 8 <400> 8 cctggagaac accctgatcc tgaccatgaa gggcatcgct gctgg 45 <210> 9 <211> 45 <212> DNA <213> Artificial <220> <223> 9 <400> 9 agggtgttct ccaggcctgg tggaacgcgc tcgccgttca gctga 45 <210> 10 <211> 36 <212> DNA <213> Artificial <220> <223> 10 <400> 10 caattcccct ctagaatggc ttccgagcgc caccac 36 <210> 11 <211> 21 <212> DNA <213> Artificial <220> <223> 11 <400> 11 ttagtggtgg tggtggtggt g 21 <210> 12 <211> 37 <212> DNA <213> Artificial <220> <223> 12 <400> 12 attcgagctc ggtaccccga agatctgaag attcctg 37 <210> 13 <211> 38 <212> DNA <213> Artificial <220> <223> 13 <400> 13 acagccatgg agatctggtg tgtctcctct aaagattg 38 <210> 14 <211> 36 <212> DNA <213> Artificial <220> <223> 14 <400> 14 ttagaggaga cacaccagat ctccatggct gttttg 36 <210> 15 <211> 37 <212> DNA <213> Artificial <220> <223> 15 <400> 15 tgcctgcagg tcgacatgaa agagtttgta gaaacgc 37 <210> 16 <211> 35 <212> DNA <213> Artificial <220> <223> 16 <400> 16 caccaccacc actaaagatc tccatggctg ttttg 35 <210> 17 <211> 37 <212> DNA <213> Artificial <220> <223> 17 <400> 17 gcgctcggaa gccatggtgt gtctcctcta aagattg 37 <210> 18 <211> 36 <212> DNA <213> Artificial <220> <223> 18 <400> 18 tagaggagac acaccatggc ttccgagcgc caccac 36 <210> 19 <211> 56 <212> DNA <213> Artificial <220> <223> 19 <400> 19 cagccatgga gatctttagt ggtggtggtg gtggtggccg gtgttctgca tgccag 56

Claims

1. A modified phosphoenolpyruvate carboxylase, characterized in that: Compared with the amino acid sequence of wild-type phosphoenolpyruvate carboxylase, the 771st and / or 931st and / or 943rd amino acid in the amino acid sequence of the modified phosphoenolpyruvate carboxylase is substituted; The amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is shown in SEQ ID NO: 1; In the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, the serine at position 771 is replaced by tyrosine and / or the lysine at position 931 is replaced by glutamine and / or the aspartic acid at position 943 is replaced by asparagine.

2. The modified phosphoenolpyruvate carboxylase according to claim 1, characterized in that The 931st lysine in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is replaced by glutamine, and the 943rd aspartic acid is replaced by asparagine.

3. A nucleic acid encoding a modified phosphoenolpyruvate carboxylase, characterized in that The nucleotide sequence of the nucleic acid has the mutations of c.2312C>A, c.2791C>A and / or c.2827G>A based on the nucleotide sequence shown in SEQ ID NO:

3.

4. The nucleic acid according to claim 3, characterized in that The nucleotide sequence of the nucleic acid has c.2791C>A and c.2827G>A mutations based on the nucleotide sequence shown in SEQ ID NO:

3.

5. A recombinant expression vector, characterized in that: The recombinant expression vector is selected from the expression vector containing the nucleic acid according to claim 3 or 4.

6. The recombinant expression vector according to claim 5, characterized in that The expression vector is selected from the Escherichia coli-Corynebacterium glutamicum shuttle expression vector.

7. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria are obtained by transforming the recombinant expression vector according to claim 5 or 6 into a recipient bacterium.

8. The genetically engineered bacterium according to claim 7, characterized in that: The recipient bacteria is selected from Corynebacterium glutamicum.

9. A kit, characterized in that: It includes the recombinant expression vector according to claim 5 or 6 or the genetically engineered bacteria according to claim 7 or 8.

10. A method for obtaining modified phosphoenolpyruvate carboxylase, characterized in that: include: mutating the 771st, 931st and / or 943rd amino acid in the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase to obtain the modified phosphoenolpyruvate carboxylase; The amino acid sequence of the wild-type phosphoenolpyruvate carboxylase is shown in SEQ ID NO: 1; In the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase, the serine at position 771 is replaced by tyrosine, the lysine at position 931 is replaced by glutamine, and / or the aspartic acid at position 943 is replaced by asparagine.

11. Use of the modified phosphoenolpyruvate carboxylase according to claim 1 or 2, the nucleic acid encoding the modified phosphoenolpyruvate carboxylase according to claim 3 or 4, the recombinant expression vector according to claim 5 or 6, and the genetically engineered bacteria according to claim 7 or 8 in increasing amino acid production.

12. A method for increasing the amino acid production of Corynebacterium glutamicum, characterized in that: include: The recombinant expression vector according to claim 5 or 6 is transformed into Corynebacterium glutamicum, and the transformed genetically engineered bacteria are fermented and cultured.

13. The method according to claim 12, characterized in that The amino acids include aspartic acid family amino acids and / or glutamic acid family amino acids.

14. The method according to claim 13, characterized in that The aspartate family amino acids include aspartic acid, lysine, threonine, methionine and / or isoleucine; The glutamate family amino acids include glutamic acid, glutamine, proline and / or arginine.

15. A method for producing amino acids, characterized in that include: The genetically engineered bacteria according to claim 7 or 8 are subjected to fermentation culture.

16. The method according to claim 15, characterized in that The amino acids include aspartic acid family amino acids and / or glutamic acid family amino acids.

17. The method according to claim 16, characterized in that The aspartate family amino acids include aspartic acid, lysine, threonine, methionine and / or isoleucine; The glutamate family amino acids include glutamic acid, glutamine, proline and / or arginine.

Images