Lily resistance to adversity regulation lo wrky22 gene and application thereof

By cloning and characterizing the lily LoWRKY22 gene, the problem of unclear regulation of stress resistance and senescence of lily WRKY transcription factors was solved, and overexpression of LoWRKY22 in Arabidopsis thaliana was achieved, demonstrating a new mechanism for the regulation of stress resistance and senescence in lilies, and providing a key gene for lily genetic engineering breeding.

CN116120418BActive Publication Date: 2026-04-17JINLING INST OF TECH
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JINLING INST OF TECH
Filing Date
2023-03-28
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

The disease resistance and stress resistance mechanisms of the WRKY transcription factor gene in lilies are not clear in the current technology, which affects the development of lily reproductive organs and the quality of cut flowers, and there is a lack of effective stress resistance regulatory genes.

Method used

The LoWRKY22 gene of lily 'Siberia' was cloned and characterized, and its nucleotide and amino acid sequences were determined. A recombinant vector was constructed for overexpression and subcellular localization analysis to verify its transcriptional activation activity. LoWRKY22 was overexpressed in Arabidopsis thaliana using genetic engineering techniques, and its effect on plant senescence was observed.

Benefits of technology

This study enriched the gene pool for plant senescence regulation and provided key target genes for lily genetic engineering breeding. Overexpression of LoWRKY22 in Arabidopsis thaliana resulted in premature leaf senescence and dwarfing phenotypes, revealing the stress resistance and senescence regulation mechanism of lilies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116120418B_ABST
    Figure CN116120418B_ABST
Patent Text Reader

Abstract

The application discloses a lily stress resistance regulation LoWRKY22 gene and application thereof, and belongs to the field of plant molecular biology. The lily gene LoWRKY22 is cloned first, and the nucleotide sequence and the coded amino acid sequence of the gene are respectively shown in SEQ ID NO. 1 and SEQ ID NO. 2. Biochemical experiments are used to reveal that LoWRKY22 is located in the cell nucleus and has transcription activation activity. A wild type Arabidopsis is transformed by constructing an overexpression vector of LoWRKY22, and overexpression of the LoWRKY22 gene can reduce the plant height of the Arabidopsis and promote leaf senescence of the Arabidopsis. The application lays a theoretical foundation for lily genetic engineering improvement breeding, and provides important application support for cultivating a new lily senescence resistance variety or other dwarfing new material.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology, specifically relating to the LoWRKY22 gene that regulates the stress resistance of lilies and its applications. Background Technology

[0002] The WRKY family is one of the largest and most unique transcription factor families in plants. Its proteins are characterized by approximately 60 amino acid residues at the N-terminus, within which the amino acid sequence WRKYGQK is absolutely conserved. The C-terminus contains a zinc finger structure CCHH or CCHC. WRKY family proteins have complex functions, with members widely involved in plant growth and development, encompassing biotic and abiotic stresses, and disease resistance. Numerous studies have confirmed the important role of WRKY transcription factors in the molecular network of plant stress responses. Research on the involvement of WRKY transcription factors in plant senescence will contribute to a deeper understanding of the plant senescence regulatory network and will also help in the breeding of more senescence-resistant new varieties.

[0003] 'Siberia' (Lilium spp. 'Siberia') is one of the main varieties of cut lilies in the market. In agricultural production, high summer temperatures can cause premature senescence in lily plants. Since the leaves are the main organs for energy production during development, premature senescence reduces the plant's carbon assimilation and nitrogen absorption capacity, affects the development of reproductive organs, and lowers the quality of cut flowers. Although WRKY transcription factor genes in lilies have been reported, their disease resistance and stress tolerance mechanisms remain unclear. Therefore, this invention aims to clone stress-related WRKY transcription factor genes from the lily 'Siberia' to elucidate their functions, analyze the mechanisms of senescence regulation, and provide new target genes for lily genetic engineering breeding. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a LoWRKY22 gene that regulates the stress resistance of lilies, thereby providing a new target gene for lily genetic engineering breeding, in order to address the shortcomings of the existing technology.

[0005] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned LoWRKY22 gene in the regulation of plant senescence.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] A LoWRKY22 gene that regulates the stress resistance of lilies, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The amino acid sequence of the LoWRKY22 gene expression protein that regulates the stress resistance of lilies is shown in SEQ ID NO.2.

[0009] The LoWRKY22 gene has a typical amino acid sequence WRKYGQK at its N-terminus and a conserved zinc finger structure C2H2 at its C-terminus.

[0010] In Arabidopsis thaliana, the LoWRKY22 gene clusters with AtWRKY27 and AtWRKY29, and is also clustered with AtWRKY22. According to TAIR (https: / / www.arabidopsis.org), it is most closely related to AtWRKY22, followed by AtWRKY29 and AtWRKY27.

[0011] Among them, the LoWRKY22 gene was expressed at the highest level in lily leaves.

[0012] Recombinant vectors containing the LoWRKY22 gene, which regulates the stress resistance of lilies, are also within the scope of protection of this invention.

[0013] The carrier is pCAMBIA1300 or BD.

[0014] The pCAMBIA1300 vector is used for subcellular localization of the LoWRKY22 gene expression protein or overexpression of the LoWRKY22 gene, and the recombinant vector constructed therefrom is pCAMBIA1300-LoWRKY22.

[0015] Specifically, the pCAMBIA1300-LoWRKY22 recombinant vector was transformed into Agrobacterium GV3101, plated on LB solid medium containing Kan and Rif, and incubated at 30°C for 2 days. Single colonies were picked for bacterial testing, and positive colonies were selected and cultured overnight in LB liquid medium containing Kan and Rif at 30°C in a shaker. Subsequent tobacco infection experiments were conducted on pCAMBIA1300-LoWRKY22 and pCAMBIA1300 Agrobacterium after 14-16 hours of culture. The results showed that the LoWRKY22 translated protein was expressed in the cell nucleus.

[0016] Specifically, the recombinant vector pCAMBIA1300-LoWRKY22 was transformed into GV3101 Agrobacterium competent cells, shaken at 28°C for 4 hours, plated on LB solid medium containing Kan and Rif, and incubated upside down at 28°C for 2-3 days. Positive single colonies were selected and cultured overnight to OD. 600 When the bacterial culture reaches a pH between 1.5 and 2.0, centrifuge at 5,000 rpm for 5 minutes, and resuspend the bacterial cells in a 5% sucrose solution until the OD value is reached. 600The level reached approximately 0.8. Wild-type Arabidopsis thaliana was infected using the pollen pathway method, and phenotypes were observed after sowing and screening up to the T3 generation. RNA was extracted from infected Arabidopsis leaves for positive identification. The results showed that positive Arabidopsis lines OE4 and OE5 had amplified bands, while the wild-type did not.

[0017] The BD vector is used for transcriptional activation activity analysis of the LoWRKY22 gene, and the recombinant vector constructed therefrom is BD-LoWRKY22.

[0018] Specifically, the positive control GAL4, the empty BD vector, and the BD-LoWRKY22 recombinant vector were transformed into AH109 yeast competent cells, respectively. The transformed colonies were then plated on SD / Trp solid medium and incubated upside down at 30°C for 2-3 days. Single colonies were picked and placed in 100 μl of sterile water. 5 μl of the bacterial solution was then spotted onto SD / -Trp, SD / -Trp-His, SD / -Trp-His + 5 mM 3AT, and SD / -Trp-His + 15 mM 3AT solid media, respectively, and incubated at 30°C for 2-3 days. Observations and photographs were then taken. A sterile filter paper was laid flat on the SD / -Trp plate, and the paper was gently pressed until the colonies adhered. The filter paper was then clamped and flash-frozen in liquid nitrogen for 1 min. The filter paper was then removed and thawed at room temperature. This freeze-thaw cycle was repeated 3-5 times. With the yeast cells facing upwards, 1 ml of Z buffer / X-Gal solution was evenly dropped onto filter paper and incubated in the dark at 30°C. The color change of β-galactosidase was then observed. The results showed that LoWRKY22 could grow normally on both deficient and inhibitory media, and exhibited β-galactosidase color change, indicating that LoWRKY22 possessed transcriptional activation activity.

[0019] Recombinant bacteria containing the LoWRKY22 gene, which regulates the stress resistance of lilies, are also within the scope of protection of this invention.

[0020] The application of the LoWRKY22 gene that regulates lily stress resistance, or the expression protein of the LoWRKY22 gene that regulates lily stress resistance, or the recombinant vector of the LoWRKY22 gene that regulates lily stress resistance, or the recombinant bacteria of the LoWRKY22 gene that regulates lily stress resistance in the regulation of plant senescence is also within the scope of protection of this invention.

[0021] The plant in question is either Arabidopsis thaliana or lily.

[0022] Specifically, the T3 generation Arabidopsis thaliana plants infected with the virus exhibited a phenotype of premature leaf senescence and stunted growth compared to wild plants.

[0023] Specifically, wild-type and T3 generation Arabidopsis seeds were sown in the same MS medium and cultured for 20 days. Total RNA was extracted from the seedlings, reverse transcribed, and then used for semi-quantitative experiments. Semi-quantitative results ( Figure 8 The study showed that, compared to the control line, the expression levels of 7 out of 16 genes associated with leaf senescence were increased in the LoWRKY22 transgenic Arabidopsis. This indicates that overexpression of LoWRKY22 leads to increased expression of senescence-related genes, thereby inducing senescence in Arabidopsis plants.

[0024] Beneficial effects:

[0025] This invention marks the first cloning of the LoWRKY22 gene sequence and its encoded protein sequence in the lily 'Siberia'. LoWRKY22 is located in the cell nucleus and possesses transcriptional activation activity. Overexpression of LoWRKY22 in Arabidopsis thaliana revealed that this protein induces premature senescence and dwarfing of the plant. This study not only enriches the gene pool regulating plant senescence but also provides a key gene for breeding lily senescence-regulating genes. Attached Figure Description

[0026] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0027] Figure 1 This is a sequence alignment diagram of the LoWRKY22 transcription factor protein in lily.

[0028] Figure 2 Phylogenetic analysis of the transcription factor LoWRKY22 in lily.

[0029] Figure 3 A graph showing the expression analysis of LoWRKY22 transcription factor in different tissues of lily.

[0030] Figure 4 This is a diagram illustrating the subcellular localization of the LoWRKY22 transcription factor in lily.

[0031] Figure 5 This is a graph showing the transcriptional activation activity of the lily LoWRKY22 transcription factor.

[0032] Figure 6 Image showing positive identification of LoWRKY22 transgenic Arabidopsis thaliana. From left to right: gel electrophoresis images of PCR amplification products from wild-type Arabidopsis thaliana line 4, transgenic line 5, and transgenic line 5. M: DNA Marker.

[0033] Figure 7 The image shows the phenotypic diagram of the LoWRKY22 transgenic Arabidopsis thaliana. From left to right, the images show the phenotypic diagrams of the wild-type Arabidopsis thaliana line, transgenic line 4, and transgenic line 5.

[0034] Figure 8 This is a graph showing the expression analysis of senescence-related genes. M: DNA Marker. Lanes 1-16 represent senescence-related genes in Arabidopsis leaves, and lane 17 represents the Arabidopsis internal reference gene ACTIN7. Detailed Implementation

[0035] To illustrate the process and uses of this invention in detail, the embodiments of the invention are further described in conjunction with figures and tables. It should be noted that the following description is for illustrative purposes only and does not limit the scope of the invention.

[0036] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; the reagents and materials described are commercially available unless otherwise specified.

[0037] The lily 'Siberia' used in this invention was cultivated at the Horticulture Base of Jinling Institute of Technology under normal water and fertilizer management. The sequencing vector pMD18-T and the yeast two-hybrid system vector BD were purchased from Takara Bio Inc., and the subcellular localization (or overexpression) vector pCAMBIA1300 was purchased from Shanghai Hewu Biotechnology Co., Ltd. Escherichia coli competent cells DH5α and Agrobacterium competent cells GV3101 were purchased from Kangwei Century Biotechnology Co., Ltd. AH109 yeast competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0038] RNA extraction reagent Trizol was purchased from Thermo Fisher Scientific (China) Co., Ltd. High-fidelity enzyme 2×SuperPfx Master Mix was purchased from Kangwei Century Biotechnology Co., Ltd., vector digestion reagent was purchased from Takara Reagents Co., Ltd., homologous recombinase ClonExpressⅡOne Step Cloning Kit and fluorescent quantitative PCR enzyme ChamQ UniversalSYBR qPCR Master Mix were purchased from Novizan Biotechnology Co., Ltd., and the enzyme 2×HieffTM PCR Master Mix used for colony PCR was purchased from Yisheng Biotechnology Co., Ltd. DNA recovery kit and plasmid extraction kit were purchased from Tiangen Biotech Co., Ltd. Primer synthesis and sequencing were performed by Genscript Biotech Co., Ltd.

[0039] Example 1: Cloning of the LoWRKY22 gene in lily 'Siberia'

[0040] 1. Extraction of total RNA from lilies

[0041] Total RNA was extracted from lily 'Siberia' using Trizol RNA extraction reagent from Thermo Fisher Scientific (China) Co., Ltd. The specific steps are as follows:

[0042] (1) Take about 0.5g of lily 'Siberia' tissue sample and put it into a mortar. Pour in liquid nitrogen and grind it into powder with a mortar and pestle. Transfer it to an RNase-free centrifuge tube, add 1ml of Trizol, vortex to mix, and let it stand at room temperature for 5min to allow the cells to fully lyse.

[0043] (2) Centrifuge at 12,000 rpm for 10 min, transfer 900 μl of supernatant to a new 1.5 ml centrifuge tube, let stand for 5 min, add 200 μl of chloroform to each tube, shake well immediately, let stand for 10 min, and centrifuge at 12,000 rpm for 15 min.

[0044] (3) Pipette 600 μl of supernatant into a new 1.5 ml centrifuge tube, add 200 μl of chloroform, shake well immediately, let stand for 10 min, and centrifuge at 12,000 rpm for 15 min;

[0045] (4) Transfer 450 μl of the supernatant to a new 1.5 ml centrifuge tube, add 200 μl of chloroform, shake well immediately, let stand for 10 min, and centrifuge at 12,000 rpm for 15 min;

[0046] (5) Take 300 μl of the supernatant into a 1.5 ml centrifuge tube, add an equal volume of pre-cooled isopropanol, gently shake to mix, and let stand for 10 min.

[0047] (6) Centrifuge at 7500 rpm for 5 min, discard the supernatant, add 1 ml of 75% ethanol and gently shake to mix, then centrifuge at 7500 rpm for 5 min.

[0048] (7) Wash once more;

[0049] (8) Discard the supernatant, dry the precipitate in a clean bench or fume hood, and dissolve it in 30 μl of RNase-free water. After the lily 'Siberia' RNA is completely dissolved, store it in an ultra-low temperature freezer at -80°C.

[0050] 2. Reverse transcription

[0051] Reverse transcription was performed using the HiScript II Q SelectRTSuperMix for qPCR kit from Novizan Biosciences Inc. The specific steps are as follows:

[0052] (1) Prepare the following mixture in an RNase-free microcentrifuge tube:

[0053]

[0054] (2) Mix the mixture from step (1) by blowing and stirring, and react at 42°C for 2 min;

[0055] (3) Add 5×HiScript II Select qRT SuperMix II to the reaction tube from step 2.

[0056]

[0057] (4) Mix the mixture from step (3) by pipetting, 50℃ for 15 min, 85℃ for 5 s. Store at -20℃ after the reverse transcription reaction is complete.

[0058] 3. High-fidelity enzyme PCR amplification

[0059] Based on the obtained cDNA sequence of the LoWRKY22 gene, open reading frames (ORF) were predicted using NCBI's ORFfinder online software (https: / / www.ncbi.nlm.nih.gov / orffinder / ). Primers WRKY22-F / R were designed based on the largest open reading frame sequence (SEQ ID No. 1), with the upstream primer being 5'-ATGGGGAACGATGATTGGGA-3' and the downstream primer being 5'-AAGGAGTGATGTCGT-3'. The LoWRKY22 gene was amplified by PCR using the reverse-transcribed cDNA as a template.

[0060] (1) PCR reaction system:

[0061]

[0062] (2) Pre-denaturation at 98℃ for 2 min; denaturation at 98℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, 35 cycles, and full extension at 72℃ for 2 min.

[0063] (3) The obtained PCR products were detected by electrophoresis on a 1% agarose gel. The PCR products were recovered by a conventional agarose gel DNA recovery kit, ligated into the sequencing vector pMD18-T, and transformed into competent E. coli strain DH5α. The results showed that the largest open reading frame sequence of the gene was SEQ ID NO.1, which was 831 bp and encoded 276 amino acids (SEQ ID NO.2).

[0064] 4. Amino acid sequence alignment

[0065] The LoWRKY22 homolog was obtained from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). Multiple alignment of the amino acid sequence was performed using ClustalX 1.81 and BioEdit 7.0 to analyze its gene structure. The N-terminus of LoWRKY22 contains the typical amino acid sequence WRKYGQK, and the C-terminus contains a conserved zinc finger structure C2H2 (…). Figure 1 ).

[0066] 5. Evolutionary Tree Analysis

[0067] Phylogenetic trees were constructed using MEGA 7.0, with the Neighbor-Joining (NJ) bootstrap parameter set to 1000 times. In the species *Arabidopsis thaliana*, phylogenetic analysis showed that LoWRKY22 clustered with AtWRKY27, and AtWRKY29 clustered with AtWRKY22. TAIR (https: / / www.arabidopsis.org) showed that LoWRKY22 was most closely related to AtWRKY22, followed by AtWRKY29 and AtWRKY27. Figure 2 ).

[0068] Example 2: LoWRKY22 gene expression analysis

[0069] Using tissue samples (roots, stems, leaves, perianth, anthers, pollen, and pistils) from 10cm long lily 'Siberia' plants, RNA was extracted and reverse transcribed to obtain cDNA using the method described above. Real-time PCR was then performed using the Novizan ChamQ UniversalSYBR qPCR Master Mix kit. The specific system is as follows:

[0070]

[0071] The LoWRKY22 gene nucleotide sequence was used for primer design using Primer Express 3.0.1 software. The upstream primer was 5'-GCAGCACCCGAGTTCAGAAG-3', and the downstream primer was 5'-ACCTCCCCACCGAGGAAT AA-3'. Relative expression levels were measured using the internal reference gene 18S. The upstream primer was 5'-AGTTGGTGGAGCGATTTGT CT-3', and the downstream primer was 5'-CCTGTTATTGCCTCAAACTTCC-3'. The reaction program was 95℃ / 5-10 min; 95℃ / 15 s, 55℃ / 15 s, 72℃ / 20 s, for 40 cycles. Each sample's expression level included three biological replicates. Relative expression levels were calculated using 2... -ΔΔCt Methods: SPSS 17.0 statistical software was used to determine the significance of statistical data (different letters represent significant differences, p < 0.05). Results: Figure 3 As shown, the LoWRKY22 gene was expressed at the highest level in lily leaves.

[0072] Example 3: Construction and Subcellular Localization Analysis of the pCAMBIA1300-LoWRKY22 Recombinant Vector

[0073] Homologous recombination primers with vector adapters and restriction enzyme sites were designed using Primer Express 3.0.1. The upstream primer was 5'- CACCAAATCGACTCTAGAAAGCTTCTGCAG ATGGGGAACGATGATTG-3', downstream primer: 5'-CAGCTCCTCGCCCTTGCTCACCATGGTACCAAGGAGTGATGTCGT-3'). N-terminal restriction site: PstⅠ, C-terminal restriction site: KpnⅠ. The high-fidelity amplification system is as follows:

[0074]

[0075] Gene products were recovered by agarose gel electrophoresis, and the empty pCAMBIA1300 vector was then double-digested with Pst1 and Kpn1 enzymes, as shown in the following system:

[0076]

[0077] After enzyme digestion at 37℃ for 1 hour, the linearized vector fragment was recovered by agarose gel electrophoresis. The recovered linearized vector and gene product were then ligated using the Novitane-derived recombinant kit. The ligation system is as follows:

[0078]

[0079]

[0080] Incorporate at 50℃ for 5 min, cool, transfer to competent E. coli strain DH5α, spread on LB solid medium containing Kan, and incubate overnight at 37℃ for 12 h.

[0081] Single-clone colonies were selected for bacterial testing and sequencing. The reaction program for bacterial testing was 98℃ / 5min; 95℃ / 30s, 55℃ / 30s, 72℃ / 30s, for 27 cycles. The primers used for sequencing were universal primers for the pCAMBIA1300 vector: upstream primer: AGCAAGACGGAATGCGCGTGAC; downstream primer: TTGCCGGTGGTGCAGATGAACTTC. Positive pCAMBIA1300-LoWRKY22 colonies were selected and propagated in LB liquid culture containing Kans at 37℃ in a shaker. The recombinant vector was extracted using a plasmid extraction kit (Tiangen Biotech Co., Ltd.).

[0082] The pCAMBIA1300-LoWRKY22 recombinant vector was transformed into Agrobacterium GV3101 (Kangwei Century Biotechnology Co., Ltd.), plated on LB solid medium containing Kan and Rif, and incubated at 30°C for 2 days. Single colonies were picked for bacterial testing. Positive colonies were selected and cultured overnight in LB liquid medium containing Kan and Rif at 30°C in a shaker. Agrobacterium pCAMBIA1300-LoWRKY22 and pCAMBIA1300 cultured for 14-16 hours can be used for subsequent tobacco infection tests.

[0083] When the OD value of the overnight cultured Agrobacterium is between 1.5 and 2.0, centrifuge to collect the bacteria, and resuspend the bacterial culture in a resuspension solution (MgCl2 10mM, MES 10mM, AS 200mM, pH 5.6) to adjust the OD value. 600 To reach a concentration of 1.0, incubate in the dark for 2-4 hours. Using a syringe without a needle, draw 1 ml of Agrobacterium resuspension and gently push it onto the underside of tobacco leaves until the leaves are wetted. Incubate in the dark for 1 day, then in the light for 1 day. Observe subcellular localization using a Zeiss LSM780 laser confocal microscope. Figure 4 The results showed that the expression of the LoWRKY22 translational protein was localized in the cell nucleus.

[0084] Example 4: Construction of the BD-LoWRKY22 recombinant vector and analysis of its transcriptional activation activity

[0085] The BD-LoWRKY22 recombinant vector was constructed using the homologous recombination method described above. The gene fragment primers are as follows: Upstream primer: 5'- TGCATATGGCCATGGAGGCCGAATTC ATGGGGAACGATGATTG-3'; Downstream primer: 5'- TAGTTATGCGGCCG CTGCAGGTCGAC AAGGAGTGATGTCGT-3'.

[0086] The BD vector was linearized using the same restriction enzyme sites EcoRI and SalRI. After recovery, it was ligated with the gene fragment at 50°C for 5 min, then transformed into competent E. coli strain DH5α, plated on LB solid medium containing Kan, and cultured overnight at 37°C for 12 h.

[0087] Single-clone colonies were selected for bacterial testing and sequencing. The primers used for both testing and sequencing were as follows: upstream primer: 5'-ATGGAGGAGCAGAAGCTG-3'; downstream primer: 5'-CTAGTTATGCGGCCGCTGC-3'. Positive BD-LoWRKY22 colonies were selected and propagated in LB liquid culture containing Kan at 37°C in a shaker. The recombinant vector was extracted using a plasmid extraction kit.

[0088] The positive control GAL4, the empty BD vector, and the BD-LoWRKY22 recombinant vector were transformed into AH109 yeast competent cells, respectively. The transformed colonies were then plated on SD / Trp solid medium and incubated upside down at 30°C for 2-3 days. Single colonies were picked and placed in 100 μl of sterile water. 5 μl of the bacterial solution was then spotted onto SD / -Trp, SD / -Trp-His, SD / -Trp-His + 5 mM 3AT, and SD / -Trp-His + 15 mM 3AT solid media, respectively, and incubated at 30°C for 2-3 days. Observations and photographs were then taken.

[0089] Place a sterile filter paper flat on the SD / -Trp plate and press it gently until colonies adhere. Remove the filter paper and flash-freeze it in liquid nitrogen for 1 minute. Thaw the filter paper at room temperature and repeat this freeze-thaw cycle 3-5 times. With the yeast side facing up, take 1 ml of Zbuffer / X-Gal solution and evenly drop it onto the filter paper. Incubate in the dark at 30°C and observe the color changes of β-galactosidase.

[0090] The Z-buffer (1L) was prepared as follows: 16.1g Na₂HPO₄·7H₂O, 5.5g NaH₂PO₄·H₂O, 0.75g KCl, 0.246g MgSO₄·7H₂O, pH adjusted to 7.0, and autoclaved at high temperature. The X-Gal (50mg / ml) was prepared as follows: 0.05g X-Gal dissolved in 1ml N,N-dimethylformamide, stored in aluminum foil-lined centrifuge tubes at -20℃. The Z-buffer / X-Gal mixture was prepared as follows: 5ml Z-buffer, 13.5μl β-mercaptoethanol, 33.5μl X-Gal (50mg / ml), stored protected from light. Results are as follows: Figure 5 LoWRKY22 can grow normally on both defective and inhibitory media, and β-galactosidase staining indicates that LoWRKY22 has transcriptional activation activity.

[0091] Example 5: Genetic transformation of LoWRKY22 Arabidopsis thaliana

[0092] The overexpression vector pCAMBIA1300-LoWRKY22 constructed in Example 3 was transformed into GV3101 Agrobacterium competent cells, shaken at 28°C for 4 hours, plated on LB solid medium containing Kan and Rif, and incubated upside down at 28°C for 2-3 days.

[0093] Select positive monoclonal colonies and incubate overnight to OD. 600 When the bacterial culture reaches a pH between 1.5 and 2.0, centrifuge at 5,000 rpm for 5 minutes, and resuspend the bacterial cells in a 5% sucrose solution until the OD value is reached. 600The level reached approximately 0.8. Wild-type Arabidopsis thaliana was infected using the pollen pathway method, and phenotypes were observed after sowing and selection up to the T3 generation. RNA was extracted from infected Arabidopsis leaves, and positive results were identified using the aforementioned LoWRKY22 quantitative primers. Upstream primer: 5'-GCAGCACCCGAGTTCAGAAG-3'; Downstream primer: 5'-ACCTCCCCACCGAGGAATAA-3'. Results showed that positive Arabidopsis lines OE4 and OE5 exhibited amplified bands, while the wild-type showed no amplified bands. Figure 6 ).

[0094] Example 6: Analysis of the aging-regulating function of LoWRKY22 in Arabidopsis thaliana

[0095] Sterilize Arabidopsis thaliana T3 generation seeds with a 1% NaClO aqueous solution by shaking for 15 min. After rinsing the seeds 3-5 times with sterile water, sow the sterilized seeds onto MS solid medium. Seal the medium with tape and vernalize at 4℃ for 3 days, then transfer to a light incubator. Once the Arabidopsis thaliana has developed true leaves, select vigorous and uniformly growing seedlings and transplant them into 7cm×7cm planting pots. Use a 1:1 mixture of peat moss and vermiculite as the substrate, soak it with water, cover with plastic wrap to retain moisture, and incubate in a light incubator for 3 days before removing the plastic wrap.

[0096] Under normal conditions in a light-incubated incubator, the phenotype of infected Arabidopsis thaliana plants grown in soil for approximately 50 days was observed. Figure 7 Compared to wild plants, the overexpressed transgenic plants exhibited premature leaf senescence and stunted growth.

[0097] Wild-type and T3 generation Arabidopsis seeds were sown in the same MS medium and cultured for 20 days. Total RNA was extracted from the seedlings and subjected to semi-quantitative experiments after reverse transcription.

[0098] Sixteen genes associated with leaf senescence (1-16) correspond to AtCEP2, AtCEP3, AtABA2, AtYUC6, AtAALP, AtAXR3, AtGBF1, AtXCP1, AtXCP2, AtXND1, AtXSP1, AtXYN3, AtMC8, AtMC9, AtWRKY53, and AtSAG12, respectively. Semi-quantitative primers were designed as follows:

[0099]

[0100]

[0101] Semi-quantitative results ( Figure 8The results showed that, compared to the control line, the expression levels of 7 of the 16 genes associated with leaf senescence were increased in the LoWRKY22 transgenic Arabidopsis. This indicates that overexpression of LoWRKY22 leads to increased expression of senescence-related genes, thereby causing senescence in Arabidopsis plants.

[0102] This invention provides a method and approach for regulating the LoWRKY22 gene in lilies to enhance their stress resistance. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. A LoWRKY22 gene for regulating the stress resistance of lilies, characterized in that, The nucleotide sequence of the LoWRKY22 gene is shown in SEQ ID NO.

1.

2. The expression protein of the LoWRKY22 gene that regulates the stress resistance of lilies as described in claim 1, the amino acid sequence of which is shown in SEQ ID NO.

2.

3. A recombinant vector containing the LoWRKY22 gene, which regulates the stress resistance of lilies, as described in claim 1.

4. The recombinant vector of claim 3, wherein, The carrier is pCAMBIA1300 or BD.

5. The recombinant vector of claim 4, wherein, The pCAMBIA1300 vector is used for subcellular localization of the LoWRKY22 gene expression protein or overexpression of the LoWRKY22 gene, and the recombinant vector constructed therefrom is pCAMBIA1300-LoWRKY22.

6. The recombinant vector of claim 4, wherein, The BD vector was used for transcriptional activation activity analysis of the LoWRKY22 gene, and the recombinant vector constructed was BD-LoWRKY22.

7. A recombinant bacterium containing the LoWRKY22 gene, which regulates the stress resistance of lilies, as described in claim 1.

Citation Information

Patent Citations

  • Method for improving citrus canker resistance based on CRISPRCas9 mediated CsWRKY22 site-directed editing

    CN110283843A

  • Lilium regale Wilson WRKY transcription factor gene LrWRKY11 and application thereof

    CN110747202A