Tobamovirus-resistant monoclonal antibody and application thereof

Abstract

The application discloses an anti-tobacco mosaic virus monoclonal antibody, which comprises a heavy chain variable region and a light chain variable region; the heavy chain variable region comprises a heavy chain CDR1 shown as SEQ ID No. 1, a heavy chain CDR2 shown as SEQ ID No. 2 and a heavy chain CDR3 shown as SEQ ID No. 3, and the light chain variable region comprises a light chain CDR1 shown as SEQ ID No. 4, a light chain CDR2 shown as SEQ ID No. 5 and a light chain CDR3 shown as SEQ ID No. 6. The anti-tobacco mosaic virus monoclonal antibody has the characteristics of high specificity and high sensitivity, and lays a foundation for subsequent research and popularization of an immune analysis method of the tobacco mosaic virus.

Description

TECHNICAL FIELD

[0001] The present application relates to the detection of tobacco mosaic virus, in particular to an anti-tobacco mosaic virus monoclonal antibody and application thereof. BACKGROUND

[0002] Tobacco mosaic virus (TMV) is a widely distributed and broad host range plant virus, which was first discovered by Swieten in 1857 in the abnormal phenomenon of tobacco growth, and the pathological characteristics of the plant infected with the virus were recorded; in 1886, Mayer first named the virus disease as "Mosaic", and proved through a series of experiments that the virus was infectious; until 1939, German scientists Kausche et al. observed the rod-shaped virus particles of TMV for the first time using electron microscopy technology; in the following years, scientists from various countries successively discovered and reported the plant diseases caused by the virus, and also discovered many plant viruses and diseases related thereto. The diseases caused by TMV occur in all tobacco planting areas in the world, and the disease is also widespread in China, among which Heilongjiang, Liaoning, Jilin, Shandong, Henan, Anhui, Fujian, Sichuan, Yunnan and Guangdong provinces are more seriously affected. The host range of TMV is very wide, in addition to tobacco, it can also invade tomato, potato, eggplant, pepper, chrysanthemum, peach and other plants. Through experimental inoculation identification, TMV can infect up to 350 species of plants.

[0003] With the development of experimental techniques, the means for detecting TMV has also become increasingly diversified. Simply judging from the plant pathological characteristics, generally, the initial symptoms of the disease have to be observed before the judgment can be made, and such judgment is often restricted and interfered by many external objective factors, and the discovered diseased plants have already been damaged to different degrees or have caused economic losses in a certain range. The commonly used methods for detecting tobacco mosaic virus at present include direct observation method, electron microscopy detection method, biological detection method, serological detection method and molecular biology detection method, etc., but they have the disadvantages of low accuracy, low sensitivity, long detection time, requirement of professional skills for the detector, expensive professional instruments, etc. The immunodetection technology has the advantages of simple operation, rapidness, sensitivity, specificity, etc., and has a broad application prospect in virus-free planting production and field investigation. Therefore, it is of great significance for the monitoring and prevention of the virus to prepare an antibody with strong specificity, high sensitivity and strong specialization, and to establish a sensitive and rapid immunological detection method for TMV. SUMMARY

[0004] The purpose of the present application is to provide an anti-tobacco mosaic virus monoclonal antibody, which has high affinity to tobacco mosaic virus and high detection sensitivity, and lays a foundation for the subsequent research and development of tobacco mosaic virus immunological analysis method.

[0005] To solve the above technical problems, the application adopts the following technical solutions:

[0006] The application provides an anti-tobacco mosaic virus monoclonal antibody, which comprises a heavy chain variable region and a light chain variable region; the heavy chain variable region comprises a heavy chain CDR1 shown as SEQ ID No. 1, a heavy chain CDR2 shown as SEQ ID No. 2 and a heavy chain CDR3 shown as SEQ ID No. 3, and the light chain variable region comprises a light chain CDR1 shown as SEQ ID No. 4, a light chain CDR2 shown as SEQ ID No. 5 and a light chain CDR3 shown as SEQ ID No. 6.

[0007] Preferably, the amino acid sequence of the heavy chain variable region is shown as SEQ ID No. 7, and the amino acid sequence of the light chain variable region is shown as SEQ ID No. 8.

[0008] The application provides a nucleic acid molecule comprising nucleotides encoding the anti-tobacco mosaic virus monoclonal antibody.

[0009] Preferably, the nucleotide sequence encoding the heavy chain variable region of the monoclonal antibody is shown as SEQ ID No. 9, and the nucleotide sequence encoding the light chain variable region of the monoclonal antibody is shown as SEQ ID No. 10.

[0010] The application also provides application of the anti-tobacco mosaic virus monoclonal antibody in detection of tobacco mosaic virus.

[0011] Preferably, the anti-tobacco mosaic virus monoclonal antibody can be used in immune detection analysis of tobacco mosaic virus.

[0012] Preferably, the immune detection of tobacco mosaic virus comprises, but is not limited to, an ELISA kit and a colloidal gold test strip.

[0013] Compared with the prior art, the application has at least one of the following beneficial effects:

[0014] The anti-tobacco mosaic virus monoclonal antibody provided by the application can specifically recognize tobacco mosaic virus, the antibody titer reaches 1:270000 or more, has good specificity for tobacco mosaic virus, can be used as raw material for enzyme-linked immune detection and colloidal gold immune detection, and lays a foundation for subsequent research and popularization of immune analysis methods of tobacco mosaic virus. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 It is an electrophoresis diagram for expression detection of TMV-CP protein. M: Marker; 01, 02, 03 and 04: four selected monoclonal antibodies; -: before IPTG induction; +: after IPTG induction.

[0016] Figure 2 Purification results of TMV-CP protein. M: Marker; 1-5: protein after purification.

[0017] Figure 3 Figure 4 is a homology alignment diagram of the heavy chain gene sequence of the tobacco mosaic virus monoclonal antibody.

[0018] Figure 4 Figure 5 is a homology alignment diagram of the light chain gene sequence of the tobacco mosaic virus monoclonal antibody.

[0019] Figure 5 Figure 6 is a homology alignment diagram of the heavy chain amino acid sequence of the tobacco mosaic virus monoclonal antibody.

[0020] Figure 6 Figure 7 is a homology alignment diagram of the light chain amino acid sequence of the tobacco mosaic virus monoclonal antibody.

[0021] Figure 7 Figure 8 is a schematic diagram of the structure of the tobacco mosaic virus colloidal gold detection test strip.

[0022] Figure 8 Figure 9 is a result determination diagram of the tobacco mosaic virus colloidal gold detection test strip. DETAILED DESCRIPTION

[0023] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application is further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application.

[0024] Example 1

[0025] Preparation of tobacco mosaic virus monoclonal antibody

[0026] 1. Expression and purification of TMV-CP protein

[0027] (1) Gene synthesis design

[0028] The optimized DNA was constructed into the pET-28a(+) vector with BamHI and HindIII as the enzyme cutting sites.

[0029] Optimized gene sequence:

[0030] GGATCCATGAGTTACAGCATTACCACCCCGAGTCAGTTTGTGTTTCTGAGTAGTGCATGGGCAGATCCGATTGAACTGATTAATCTGTGCACCAATGCACTGGGTAATCAGTTTCAGACCCAGCAGGCCCGTACCGTTGTTCAGCGCCAGTTTAGCGAAGTTTGGAAACCGAGCCCGCAGGTGACCGTGCGCTTTCCGGATAGTGATTTTAAAGTTTATCGCTATAACGCAGTGCTGGACCCTCTGGTGACCGCACTGCTGGGCGCATTTGATACCCGTAATCGTATTATTGAAGTTGAAAATCAGGCAAATCCGACCACCGCAGAAACCCTGGATGCCACCCGTCGCGTGGATGATGCAACCGTGGCCATTCGCAGCGCAATTAATAATCTGATTGTGGAACTGATTCGTGGCACCGGCAGTTATAATCGTAGTAGCTTTGAAAGCAGCAGTGGTCTGGTTTGGACCAGTGGTCCGGCAACCTAAAAGCTT

[0031] (2) Protein expression identification

[0032] 1. Add 2 μL plasmid to 50 μL BL21 competent bacteria, and keep in ice bath for 30 min.

[0033] 2. Heat shock at 42°C for 60 s, and then quickly put in ice for 5 min. Add 500 μL LB culture solution.

[0034] 3. Shake at 37°C, 220 r / min for 1 h. Spread on LB plate containing kanamycin, and culture overnight at 37°C.

[0035] 4. Pick single colony on the plate, and inoculate in 5 mL LB culture solution containing kanamycin.

[0036] 5. Shake at 37°C, 200 r / min until the OD 600 of the culture solution is 0.6-0.8.

[0037] 6. Add IPTG to a final concentration of 1.0 mmol / L. Set up a control without adding IPTG. Shake at 16°C, 200 r / min for 16 h to induce expression of the fusion protein.

[0038] ⑦Take out 1 mL culture, centrifuge at 12000 r / min for 2 min at room temperature, discard the supernatant, resuspend the bacteria with 40 μL 1x SDS-PAGE Loading Buffer, and boil at 100°C for 5-10 min.

[0039] ⑧Analyze by 12% SDS-PAGE electrophoresis, and the results are shown in Figure 1, indicating that the fusion protein is expressed obviously. Figure 1

[0040] (3) Mass expression and purification of the protein

[0041] ①Inoculate the activated bacteria into 200 mL LB medium containing kanamycin, and shake at 37°C and 200 r / min until the OD 600 is 0.6-0.8. Then, add IPTG with a final concentration of 0.1 mmol / L, and shake at 16°C and 200 r / min for 16 h.

[0042] ②Centrifuge at 10 000 r / min for 10 min, discard the supernatant, and collect the bacteria.

[0043] ③Resuspend the bacteria with Buffer A (20 mmol / L Tris, 20 mmol / L Imidazole, 500 mmol / L NaCl, pH 8.0), crush by high-pressure homogenizer (900 bar, three times), and centrifuge at 14 000 r / min for 20 min.

[0044] ④Collect the supernatant, and remove impurities by filtration.

[0045] ⑤Equilibrate the Ni column with Buffer A for 10 column volumes, and then load the sample.

[0046] ⑥Wash away the impure proteins with Buffer A.

[0047] ⑦Elute with Buffer B (20 mmol / L Tris, 250 mmol / L Imidazole, 500 mmol / L NaCl, pH 8.0), and collect the protein peak.

[0048] ⑧Detect by SDS-PAGE electrophoresis, and the results are shown in Figure 2, indicating that the target protein is obtained by purification. Figure 2

[0049] 2. Preparation of monoclonal antibody against tobacco mosaic virus

[0050] (1) Immunize animals

[0051] ​​The expressed TMV-CP protein was diluted to 1 mg / mL with sterile PBS solution at pH 7.0, and then emulsified with Freund's adjuvant (FCA) at a ratio of 1:1 to prepare an oil emulsion vaccine. The first immunization was performed with Freund's complete adjuvant vaccine, and 6-8 week old Balb / c mice were immunized by subcutaneous injection at multiple points on the back of the neck, with an immunization dose of 200 μg per mouse. Subsequent booster immunizations were performed by subcutaneous injection at multiple points on the back of the neck every two weeks, with emulsification being performed with Freund's incomplete adjuvant (FICA); the last immunization was performed without adjuvant, and the recombinant protein was directly used for immunization, which was performed by intraperitoneal injection, with the same injection dose as the previous injections. The specific immunization steps are shown in Table 1.

[0052] Table 1 Mouse immunization procedure

[0053]

[0054] (2) Mouse polyclonal serum detection

[0055] ① Plate coating

[0056] The TMV-CP protein was diluted to 1 μg / mL with 0.05 mol / L CB buffer at pH 9.6, and 100 μL was added to each well of the enzyme-labeled plate, which was then incubated at 4°C overnight. After coating, the plate was washed once with PBST, dried, and 150 μL of blocking solution (pH 9.0 carbonate buffer) was added to each well, which was then incubated at 37°C for 2 h, dried, and stored at 4°C for later use.

[0057] ② Mouse polyclonal serum positive detection

[0058] The mouse serum was diluted 1000-fold with the antibody diluent, and then diluted by a factor of 3 six times in a gradient, and 7 serum samples at different concentrations were added to the enzyme-labeled plate coated with TMV-CP protein at 100 μL per well from top to bottom, sealed with a cover film, and incubated at 37°C for 30 min. The plate was washed 3 times and dried; 100 μL of goat anti-mouse IgG enzyme-labeled secondary antibody was added to each well, which was then incubated at 37°C for 30 min, washed 4 times, and dried; 100 μL of substrate solution was added to each well, which was then incubated at room temperature for 15 min, and 50 μL of stop solution was added per well. The OD values of each well were detected by an enzyme-labeled instrument at dual wavelengths of 450 nm / 630 nm, and the fusion mouse was selected according to the OD values. The dilution factor corresponding to the well with an OD value of about 1.0 (≥1.0) was the titer of the antibody, and the OD value of the negative serum was less than 0.4.

[0059] (3) Cell fusion

[0060] ① Preparation

[0061] The fusion agent was divided into 1 mL aliquots and placed in a 37°C carbon dioxide incubator before fusion.

[0062] HAT medium: prepared before fusion (500 mL HAT medium contains 5 mg HAT, 20% FBS, penicillin 100 U / mL, streptomycin 0.1 mg / mL), placed in a 37°C incubator for temperature recovery.

[0063] HT medium: prepared before the first cloning (500 mL DMEM medium contains 5 mg HT, 20% FBS, penicillin 100 U / mL, streptomycin 0.1 mg / mL), placed in a 37°C incubator for temperature recovery.

[0064] Cloning medium: used for other cloning except the first cloning (500 mL DMEM medium contains 20% FBS, penicillin 100 U / mL, streptomycin 0.1 mg / mL).

[0065] Cell expansion medium: used for cell expansion after subculturing (500 mL DMEM medium contains 15% FBS, penicillin 100 U / mL, streptomycin 0.1 mg / mL).

[0066] 2. Resuscitation and culture of SP2 / 0

[0067] SP2 / 0 was resuscitated 2 weeks before fusion. The ultra-low temperature stored SP2 / 0 was taken out, quickly placed in a 37°C water bath for 1-2 min, and after melting, added to a centrifuge tube containing 5-10 mL DMEM, centrifuged at 1000 r / min for 5 min, the supernatant was removed, the pellet was resuspended with expansion medium, and transferred to a cell bottle for culture. The state was observed, and the liquid was replaced and subcultured at any time. The SP2 / 0 was treated as appropriate 1 day before fusion. Fresh culture medium was replaced about 8 h before fusion.

[0068] 3. Preparation of feeder cells

[0069] Intraperitoneal macrophages were used as feeder cells. After the BALB / c mice were sacrificed by cervical dislocation, they were soaked in 75% alcohol for 5 min. The mice were taken out, stood for half a minute, and after the alcohol did not drip, they were transferred to a clean bench, with the abdomen facing up, the abdominal skin was cut open to expose the inner skin of the abdominal cavity. An appropriate amount of DMEM was sucked into a syringe and injected into the mouse abdominal cavity, without piercing the internal organs. The mouse was shaken for a few times, then the DMEM was sucked out and transferred to a 50 mL centrifuge tube, and the process was repeated 3-4 times. The centrifuge tube containing the feeder cells was placed in a centrifuge at 1000 r / min for 5 min, the supernatant was discarded, and an appropriate amount of HAT culture solution was added, and the feeder cells in the tube were blown evenly for use.

[0070] 4. Preparation of SP2 / 0 cells

[0071] Take well-grown SP2 / 0, pour off the culture medium, add an appropriate amount of DMEM medium, and blow the cells with a curved tube to prepare a suspension for use.

[0072] Preparation of spleen cells

[0073] The immunized BALB / c mice were sacrificed by cervical dislocation, and the spleen was removed after 5 minutes of disinfection in 75% alcohol. The spleen was washed with DMEM and placed in a sterile culture dish. The spleen cells were blown out by injecting DMEM culture solution into the spleen using a syringe, and the process was repeated 3-5 times to blow out all the spleen cells. The spleen cell suspension was then transferred to a centrifuge tube.

[0074] Cell fusion

[0075] The SP2 / 0 suspension was added to the spleen cell suspension, mixed, and centrifuged at 1000 r / min for 5 minutes at room temperature. The supernatant was discarded, and the centrifuge tube was kept with the opening facing down. The residual liquid on the wall of the centrifuge tube was absorbed with filter paper. The cells were evenly dispersed on the bottom of the centrifuge tube by tapping the bottom. 1 mL of fusion agent was added along the wall at a constant speed within 1 minute, and the centrifuge tube was rotated at the same time. After addition, the centrifuge tube was placed flat and allowed to fuse for 1 minute. The fusion was terminated with 15 mL of DMEM culture solution. The first minute was added at a constant speed of 1 mL, the second minute was added at a constant speed of 2 mL, and so on. After addition, the cells were centrifuged at 1000 r / min for 5 minutes at room temperature. The supernatant was discarded, and the precipitate was mixed with an appropriate amount of HAT culture solution. The corresponding HAT working solution was added as needed, and the cells were plated in a 96-well cell plate at 100-150 μL / well. The prepared feeder cells were plated in the 96-well cell plate containing the fused cells at 100-150 μL / well. The plate was incubated in a 5% CO2, 37°C constant temperature cell incubator for 7-10 days. The cell morphology was observed, and the detection time was determined according to the cell number and size.

[0076] (4) Screening and cloning of hybridoma cells

[0077] ① Detection of fusion plate

[0078] The cell state was observed 4-5 days after fusion, and the antigen plate was prepared according to the same steps as in (2)①.

[0079] The liquid was taken for detection 7 days after fusion, and 50 μL of sample was taken per well and added to the enzyme-labeled plate. The plate was sealed with a cover film, and the subsequent steps were the same as in (2)②.

[0080] ② Cloning and detection

[0081] According to the detection results, the cells were selected for cloning, and the HT culture medium was used for culture.

[0082] Prepare the culture medium in advance when cloning, prepare a new cell plate, blow the selected cell well, blow the cells evenly, dilute the cells, count the cells, dilute the cells to 1-5 per microliter according to the counting result, calculate the amount of cell suspension needed for 1-2 cells per well according to the amount of plating, and suck it into the HT culture solution, mix it evenly, and plate it into a new 96-well cell plate with feeder cells.

[0083] Cloning can be detected after 6-8 days, and the plate is prepared 1-2 days in advance. The plate preparation steps are the same as (2) i, and the detection steps are the same as (2) ii. If the detection result is qualified and there is only one cell in the cell plate well, the cells are transferred to a 24-well cell plate for culture. After detecting the titer and crossing, the strain is expanded. If there is no single cell, perform the second and third cloning until a single cell appears.

[0084] ③Expansion culture

[0085] Culture in a 24-well plate, observe the cells, and detect when the cells are plated to more than 80% of the well. Dilute the supernatant by 30 times, then dilute it by 3 times in gradient for 6-7 times. The subsequent steps are the same as the polyclonal serum inhibition detection (2) ii. After detection, transfer to a cell bottle containing expansion medium for expansion culture.

[0086] (5)Freezing

[0087] Before freezing, pay attention to observe the cell growth, good condition (cell round, transparent, amount), and 80% of the total volume. Blow the cells with a curved tube, transfer them to a centrifuge tube, and centrifuge at 1000 r / min for 5 min. Discard the supernatant, add freezing solution to mix the cells, and suck them into a freezing tube. Label the information and put it in a freezing box. Place it in a -80°C refrigerator overnight. Short-term storage can be stored in a -80°C refrigerator, and long-term storage needs to be transferred to liquid nitrogen.

[0088] (6) Preparation and detection of monoclonal antibody ascites

[0089] Use the animal in vivo induction ascites method. Prepare a certain number of BALB / c mice. Before injection, inject 0.5 mL of sterile paraffin oil into the mouse abdominal cavity. At least 4 days later, cell injection can be performed. When the cells grow well and are in good condition, blow the cells in the bottle with a curved tube, transfer them to a centrifuge tube, and centrifuge at 1000 r / min for 5 min. Discard the supernatant, add physiological saline to mix, and use a syringe to inject the mixed cell suspension into the mouse abdominal cavity. Each mouse can inject 0.5 mL of liquid into the abdominal cavity. According to the number of cells, each mouse can inject 1 x 10 6 cells.

[0090] Ascites can be produced 7-10 days after inoculation of cells. The health status and ascites signs of mice should be observed closely. When the abdomen of mice is swollen, ascites can be extracted with a syringe. Ascites can be repeatedly extracted until the mice die. Ascites is centrifuged at 8000 r / min for 10 min in a low-temperature centrifuge, and is stored at -20°C after being divided into aliquots. The titer of ascites is determined by ELISA, and is more than 1:270000.

[0091] (7) Antibody purification

[0092] Ammonium sulfate precipitation and affinity chromatography are used. The mouse ascites is centrifuged to remove impurities, is mixed with an equal volume of PB buffer, and is mixed with an equal volume of saturated ammonium sulfate solution. The final concentration of ammonium sulfate is 50%. The solution is precipitated at 4°C overnight, and is centrifuged after precipitation. The supernatant is discarded, and the precipitate is resuspended in 60% PB buffer. The resuspended solution is transferred to a dialysis bag for dialysis. After dialysis, the precipitate is removed by centrifugation. The protein solution is purified by a Protein G affinity column, and is stored at -20°C after being divided into aliquots.

[0093] (8) Subclass identification of anti-tobacco mosaic virus monoclonal antibody

[0094] Subclass identification: The IgG subclass detection kit (Sigma, USA) is used to detect the subclass of the anti-tobacco mosaic virus monoclonal antibody. The results show that the anti-tobacco mosaic virus monoclonal antibody is IgG 1(κ) .

[0095] Example 2

[0096] Gene verification of anti-tobacco mosaic virus monoclonal antibody

[0097] 1. Cloning of light chain and heavy chain variable region genes

[0098] (1) Hybridoma cell culture and total RNA extraction

[0099] The hybridoma cells are cultured in DMEM complete medium at 37°C and 5% carbon dioxide. The cultured hybridoma cells are collected by centrifugation, and the total RNA of the cultured cells is extracted by TRIZOL lysis and phenol chloroform extraction. 6

[0100] (2) Synthesis of cDNA first strand

[0101] The cDNA is synthesized by a Thermo reverse transcription kit.

[0102] (3) Gene amplification

[0103] The Kappa chain, heavy chain upstream and downstream primers are designed.

[0104] ​Primer: HF: CTCCACGTCGAACAACTC

[0105] HR: ACCAGTGACAGAGACGCC

[0106] Kappa F: CTATAGCACGAGTGAGTT

[0107] Kappa R: GGTTCGACCTTTAGTTTG

[0108] PCR was performed using the first strand of cDNA as a template, and the reaction system was 50 μL.

[0109] The PCR reaction system was 2xI5 Master Mix 25.0 μL, upstream primer 2.0 μL, downstream primer 2.0 μL, cDNA template 2.0 μL, and deionized water 16.0 μL.

[0110] The PCR reaction conditions were: 98℃ for 30s; 98℃ for 10s, 60℃ / 58℃ for 30s, 72℃ for 30s; cycle 35 times; 72℃ for 7min.

[0111] (4) Cloning and screening of PCR amplification products

[0112] The PCR products were subjected to 1.0% agarose gel electrophoresis, and the antibody Kappa chain and Heavy chain fragments were recovered using a PCR product recovery kit (Omega). After double digestion with EcoRV and NheI, they were connected with the linearized vector pFUSEss-mG1, and the NEB T4 DNA ligase was used for ligation, and transformed into DH5α competent cells (Zeocin). The positive recombinant clones were screened and sequenced.

[0113] The PCR products were subjected to 1.5% agarose gel electrophoresis, and the results showed that the nucleotide sequence of the Heavy chain was as shown in SEQ ID No. 9, and the nucleotide sequence of the Kappa chain was as shown in SEQ ID No. 10.

[0114] Among them, the amino acid sequence of the CDR1 of the variable region of the heavy chain of the anti-tobacco mosaic virus monoclonal antibody is as shown in SEQ ID No. 1; the amino acid sequence of the CDR2 of the variable region of the heavy chain is as shown in SEQ ID No. 2; and the amino acid sequence of the CDR3 of the variable region of the heavy chain is as shown in SEQ ID No. 3.

[0115] The amino acid sequence of the CDR1 of the variable region of the light chain is as shown in SEQ ID No. 4; the amino acid sequence of the CDR2 of the variable region of the light chain is as shown in SEQ ID No. 5; and the amino acid sequence of the CDR3 of the variable region of the light chain is as shown in SEQ ID No. 6.

[0116] (5) Analysis of variable region amino acid sequence and homology

[0117] Comparison analysis was performed in the NCBI database. The results showed that the monoclonal antibody heavy chain variable region gene sequence had the highest homology with the mouse immunoglobulin heavy chain variable region mRNA (Sequence ID: AB734750.1), with a homology of 318 / 351 and a homology percentage of 91%. Figure 3 .

[0118] The monoclonal antibody light chain variable region gene sequence has the highest homology with the mouse immunoglobulin light chain variable region mRNA (SequenceID: HQ015070.1), with a homology of 305 / 333 and a homology percentage of 92%. Figure 4 .

[0119] The amino acid sequence of the variable region of the monoclonal antibody heavy chain has the highest homology with the amino acid sequence of the variable region of the mouse immunoglobulin heavy chain (SequenceID: AML31273.1), with a homology of 100 / 117 and a homology percentage of 85%. Figure 5 .

[0120] The amino acid sequence of the light chain variable region of the monoclonal antibody has the highest homology with the amino acid sequence of the light chain variable region of the mouse immunoglobulin Kappa chain (Sequence ID: AAA38863.1), with a homology of 96 / 111 and a homology percentage of 86%. Figure 6 .

[0121] The results of homology analysis of the gene sequences and amino acid sequences encoding the heavy and light chain variable regions of the monoclonal antibody showed that no sequence identical to that of the present invention was found. This result is consistent with the identification of the anti-tobacco mosaic virus monoclonal antibody as IgG using an IgG subclass detection kit (Sigma, USA). 1(κ) consistent.

[0122] The heavy chain variable region and light chain variable region sequences were analyzed on the online website IMGT (https: / / www.imgt.org / IMGT_vquest / analysis) to obtain their CDR regions, whose amino acid sequences are shown in SEQ ID No. 1 to SEQ ID NO. 6.

[0123] Example 3

[0124] Preparation of colloidal gold test strips for tobacco mosaic virus

[0125] 1. Preparation of anti-tobacco mosaic virus monoclonal antibody-colloidal gold label

[0126] (1) Preparation of colloidal gold

[0127] Dilute 1% chloroauric acid with double-distilled deionized water to 0.01% (mass fraction), take 100 mL in a conical flask, heat to boiling with a constant-temperature electromagnetic stirrer, add 1.5 mL of 1% trisodium citrate under continuous high temperature and continuous stirring, continue to stir at a uniform speed until the solution is clear red, then stop heating, cool to room temperature, restore to the original volume with deionized water, and store at 4°C. The prepared colloidal gold is pure, clear, and free of precipitate and floaters, and its color is wine red under sunlight.

[0128] (2) Preparation of tobacco mosaic virus monoclonal antibody-colloidal gold marker

[0129] Under magnetic stirring, adjust the pH of the colloidal gold to 7.2 with 0.2 mol / L potassium carbonate solution, add the above-mentioned tobacco mosaic virus monoclonal antibody to the colloidal gold solution at 5-50 μg of antibody per mL of colloidal gold solution, and continue to stir and mix for 30 min; after standing for 10 min, add 10% BSA to make the final concentration of BSA in the colloidal gold solution 1%, and stand for 10 min. Centrifuge at 12,000 r / min at 4°C for 40 min, discard the supernatant, wash the precipitate with resuspension buffer twice, resuspend the precipitate with resuspension buffer with a volume of 1 / 10 of the initial colloidal gold volume, and store at 4°C.

[0130] Resuspension buffer: 0.02 mol / L phosphate buffer containing 0.1%-0.5% BSA and 2%-4% sucrose, pH 7.2.

[0131] 2. Preparation of conjugate release pad

[0132] Soak the conjugate release pad in 0.02 mol / L phosphate buffer containing 0.5% BSA, 5% sucrose, and pH 7.4, and uniformly soak for 2 h, then dry at 37°C for standby. Use the Bio dot film marker to uniformly spray the prepared tobacco mosaic virus monoclonal antibody-colloidal gold marker on the conjugate release pad, spray 0.01 mL of tobacco mosaic virus monoclonal antibody-colloidal gold marker per 1 cm of conjugate release pad, then place it in a 37°C environment (humidity <20%) for 2 h, take it out, and store it in a dry environment (humidity <20%) for standby.

[0133] 3. Preparation of sample absorption pad

[0134] Soak the sample absorption pad in 0.02 mol / L phosphate buffer containing 1% BSA and pH 7.2 for 2 h, and dry at 37°C for 2 h for standby.

[0135] 4. Preparation of reaction membrane

[0136] Anti-tobacco mosaic virus monoclonal antibodies were coated on the reaction membrane to form the detection line, and goat anti-mouse antibodies were coated on the reaction membrane to form the quality control line.

[0137] Coating process: Dilute anti-tobacco mosaic virus monoclonal antibody to 1 mg / mL in 0.01 mol / L, pH 7.2 phosphate buffer and coat the membrane at the test line (T line) on the nitrocellulose membrane using a Bio dot stripper at a coating volume of 1.0 μL / cm. Dilute goat anti-mouse antibody to 200 μg / mL in 0.01 mol / L, pH 7.2 phosphate buffer and coat the membrane at the control line (C line) on the nitrocellulose membrane using a Bio dot stripper at a coating volume of 1.0 μL / cm. Dry the coated membrane at 37°C for 16 hours before use.

[0138] 5. Assembly of test strips

[0139] According to the attached Figure 7 The cross-sectional structure of the test strip shown in the figure is that the sample absorption pad (1), the conjugate release pad (2), the reaction membrane (3) and the water absorption pad (4) are sequentially pasted on the PVC base plate (7); 1 / 3 of the area of ​​the conjugate release pad from the starting end is covered by the sample absorption pad, the end of the conjugate release pad is connected to the starting end of the reaction membrane, the end of the reaction membrane is connected to the starting end of the water absorption pad, the starting end of the sample absorption pad is aligned with the starting end of the PVC base plate, and the end of the water absorption pad is aligned with the end of the PVC base plate; the reaction membrane is provided with a detection line (5) and a quality control line (6), and the detection line (T line) and the quality control line (C line) are both strips perpendicular to the length of the test strip; the detection line is located on the side close to the end of the conjugate release pad; the quality control line is located on the side away from the end of the conjugate release pad; the test strip is cut into small strips with a width of 3.95 mm by a machine, placed in a special plastic card shell, sealed with an aluminum foil bag, and stored in an environment of 2 to 30°C with a validity period of 12 months.

[0140] Example 4

[0141] Detection of tobacco mosaic virus in samples

[0142] 1. Sample pretreatment

[0143] Place 0.15g of fresh tobacco leaves in a centrifuge tube and rotate and squeeze the tube several times with a grinding rod to ensure that the leaf tissue is fully ground. Add 2mL of 0.02mol / L PB buffer and repeat the grinding to thoroughly mix the sample and buffer. Remove the grinding rod and let it stand for at least 1 minute. The supernatant is the test fluid.

[0144] 2. Use test strips to test

[0145] Use micropipette to suck 100 μL of the sample liquid to be tested vertically into the sample well; start timing when the liquid flows, react for 10 min, and determine the result.

[0146] 3. Analyze the test results

[0147] Positive (+): C line shows a red or purple red band, and T line also shows a red or purple red band, regardless of the color depth, indicating that the sample contains tobacco mosaic virus, such as Figure 8 a, 8b, 8c.

[0148] Negative (-): C line shows a red or purple red band, and T line does not show color, indicating that the sample does not contain tobacco mosaic virus or the concentration is too low, such as Figure 8 d.

[0149] Invalid: no C line appears, indicating incorrect operation or deterioration of the test strip, such as Figure 8 e, 8f.

[0150] 4. Sensitivity analysis

[0151] Using 0.01 mol / L PB buffer as a diluent, TMV-CP protein was diluted from 10000 ng / mL to 100 ng / mL, and the test strip was used for detection, with three repeated determinations for each concentration.

[0152] The results show that when the concentration of TMV-CP protein is low, the test strip T line does not show color, and the result is negative; when the concentration reaches 10 ng / mL, the test strip appears T line, and with the increase of concentration, the T line color becomes darker and darker. Therefore, the detection limit of the test strip for TMV-CP protein in this study is 10 ng / mL.

[0153] Although the present application has been described herein with reference to the various illustrative embodiments thereof, it is understood that various other modifications and implementations can be devised by those skilled in the art, which will fall within the principles and spirit of the disclosure. More specifically, many variations and modifications of the subject combination arrangement can be made to the constituent components and / or arrangements of the subject combination arrangement within the scope and spirit of the disclosure as described in the specification, drawings, and claims. In addition to variations and modifications of the constituent components and / or arrangements, other uses will also be apparent to those skilled in the art.

Claims

1. An anti-tobacco mosaic virus monoclonal antibody, characterized in that: The monoclonal antibody comprises a heavy chain variable region and a light chain variable region; The heavy chain variable region includes a heavy chain CDR1 as shown in SEQ ID No. 1, a heavy chain CDR2 as shown in SEQ ID No. 2, and a heavy chain CDR3 as shown in SEQ ID No. 3, The light chain variable region includes a light chain CDR1 as shown in SEQ ID No. 4, a light chain CDR2 as shown in SEQ ID No. 5, and a light chain CDR3 as shown in SEQ ID No.

6.

2. The anti-tobacco mosaic virus monoclonal antibody according to claim 1, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID No. 7, and the amino acid sequence of the light chain variable region is shown in SEQ ID No.

8.

3. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the anti-tobacco mosaic virus monoclonal antibody according to claim 1 or 2.

4. The nucleic acid molecule according to claim 3, characterized in that: The nucleotide sequence of the nucleic acid molecule encoding the heavy chain variable region of the anti-tobacco mosaic virus monoclonal antibody is shown in SEQ ID No. 9, and the nucleotide sequence of the nucleic acid molecule encoding the light chain variable region of the anti-tobacco mosaic virus monoclonal antibody is shown in SEQ ID No.

10.

5. Use of the anti-tobacco mosaic virus monoclonal antibody according to any one of claims 1 to 2 in detecting tobacco mosaic virus.

Images