Endoglucanase mutant and its encoding gene, recombinant vector, recombinant bacteria and enzyme preparation and their application

Abstract

The invention relates to renewable energy and bioengineering technology, and discloses an endoglucanase mutant and its encoding gene, recombinant vector, recombinant bacteria and enzyme preparation and their applications. The endoglucanase mutant is: an enzyme having an amino acid sequence shown in SEQ ID NO.1; or an enzyme shown in an amino acid sequence in which the 12th and 264th amino acids shown in SEQ ID NO.1 are substituted, deleted or added with one or several amino acid residues and still have endoglucanase mutant activity; or an enzyme shown in an amino acid sequence with a label connected to the amino terminal and / or carboxyl terminal of the amino acid sequence; or an enzyme shown in an amino acid sequence with a signal sequence connected to the amino terminal of the amino acid sequence. The endoglucanase mutant has significantly improved ethanol resistance and organic solvent resistance, high catalytic efficiency, and improved bioethanol production efficiency.

Description

Technical Field

[0001] The present invention relates to renewable energy and bioengineering technology, and in particular to an endoglucanase mutant, an encoding gene of the endoglucanase mutant, a recombinant vector, a recombinant strain, a preparation method of the endoglucanase mutant, an enzyme preparation and applications of the same in degrading cellulose and / or preparing bioethanol. Background Art

[0002] Bioethanol is one of the most promising sustainable renewable resources, and its large-scale production has the potential to solve the current environmental and energy challenges in the world. Since the production of first-generation ethanol from sugary and starchy feedstocks may lead to food shortages, lignocellulosic biomass, as the most abundant sustainable carbon source on earth, has great development potential if it can be effectively converted into ethanol. The main components of lignocellulosic biomass are high-molecular carbohydrates cellulose, hemicellulose, and lignin, which can be hydrolyzed into monosaccharides by chemical or enzymatic methods to produce glucose. Since enzymatic hydrolysis is carried out under mild conditions and consumes less energy, it is a more practical biomass hydrolysis mechanism. Stable cellulases play a key role in industrial bioethanol fermentation, which is conducive to reducing the amount of enzymes used and overcoming the limitations of high solids, inhibitors, and sugar concentrations. However, existing cellulases are easily inhibited by ethanol concentration or other inhibitors in bioethanol production, resulting in greatly reduced activity or even inactivation, which reduces fermentation efficiency and interferes with the economic benefits of bioethanol.

[0003] Cellulase belongs to glycoside hydrolase, which hydrolyzes (hemi)cellulose into glucose monomers at relatively low temperature. The complete degradation of cellulose requires the synergistic action of three different types of cellulase: endoglucanase (EG) forms gaps in cellulose and opens the reducing and non-reducing ends; cellulose hydrolase (CBH) acts on the reducing and non-reducing ends to release cellulose, and β-glucosidase (BGL) cuts cellulose to release glucose. Endoglucanase is an essential key enzyme for hydrolyzing lignocellulose. However, in the process of bioethanol production, the increase of ethanol concentration has a significant inhibitory effect on the activity of endoglucanase, thereby reducing the production efficiency of bioethanol. Summary of the invention

[0004] The purpose of the present invention is to overcome the problem that ethanol inhibits the activity of endoglucanase in the process of bioethanol production, and to provide an endoglucanase mutant and its encoding gene, a recombinant vector, a recombinant bacteria and an enzyme preparation and their applications. The endoglucanase mutant has significantly improved ethanol resistance and organic solvent resistance, high catalytic efficiency, and improved bioethanol production efficiency.

[0005] In order to achieve the above object, the first aspect of the present invention provides an endoglucanase mutant, wherein the endoglucanase mutant is an enzyme described in any one of (a) to (d):

[0006] (a) an enzyme having the amino acid sequence shown in SEQ ID NO.1;

[0007] (b) an enzyme represented by an amino acid sequence in which one or more amino acid residues are substituted, deleted or added at positions 12 and 264 of amino acids represented by SEQ ID NO.1 and which still has endoglucanase mutant activity;

[0008] (c) an enzyme represented by an amino acid sequence having a tag connected to the amino terminus and / or carboxyl terminus of the amino acid sequence described in (a) or (b);

[0009] (d) An enzyme represented by an amino acid sequence in which a signal sequence is linked to the amino terminus of the amino acid sequence described in (a) or (b).

[0010] Preferably, the endoglucanase mutant is an enzyme having an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0011] The second aspect of the present invention provides a gene encoding an endoglucanase mutant, wherein the gene has a nucleotide sequence encoding the aforementioned endoglucanase mutant.

[0012] Preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO.1.

[0013] More preferably, the gene has the nucleotide sequence shown in SEQ ID NO.3.

[0014] Preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO.2.

[0015] More preferably, the gene has the nucleotide sequence shown in SEQ ID NO.4.

[0016] The third aspect of the present invention provides a recombinant vector, which contains the aforementioned gene.

[0017] Preferably, the expression vector of the recombinant vector is at least one selected from the group consisting of pBSYA1S1Z plasmid, pET22b plasmid and pET28a plasmid; more preferably, it is pBSYA1S1Z plasmid.

[0018] The fourth aspect of the present invention provides a recombinant strain, which contains the aforementioned gene or the aforementioned recombinant vector.

[0019] Preferably, the recombinant strain is selected from at least one of Pichia pastoris, Escherichia coli and Saccharomyces cerevisiae; more preferably, it is Pichia pastoris BSYBG11.

[0020] The fifth aspect of the present invention provides a method for preparing an endoglucanase mutant, which comprises: inoculating the aforementioned recombinant strain into a fermentation medium for fermentation to obtain a fermentation broth, and separating and purifying the fermentation broth to obtain the endoglucanase mutant.

[0021] The sixth aspect of the present invention provides an enzyme preparation, which comprises the endoglucanase mutant prepared by the aforementioned method.

[0022] The seventh aspect of the present invention provides the use of at least one of the aforementioned endoglucanase mutant, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain, the endoglucanase mutant prepared by the aforementioned method, and the aforementioned enzyme preparation in degrading cellulose and / or preparing bioethanol.

[0023] Through the above technical solution, the beneficial effects of the present invention are:

[0024] The invention adopts the KnowVolution directed evolution technology in combination with an established high-throughput screening scheme to transform endoglucanase, and screens out endoglucanase mutants with ethanol resistance and organic solvent resistance. In addition, the catalytic efficiency of the endoglucanase mutant is significantly improved. When applied to the process of producing bioethanol from lignocellulosic biomass, the utilization rate of lignocellulosic biomass raw materials can be effectively improved, the yield and output of bioethanol can be significantly improved, and the production cost of bioethanol can be reduced.

[0025] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 1 is a protein gel image of the purified EG variant and wild-type EG in Example 1, WT is wild-type EG, 1 is the EG variant S12K / T77M / E85Y / G264H, and 2 is the EG variant S12C / T77M / E85Y / G264R;

[0027] Figure 2 It is a graph showing the ethanol resistance of the EG variants and wild-type EG in Example 1 in different organic solvents. DETAILED DESCRIPTION

[0028] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0029] The first aspect of the present invention provides an endoglucanase mutant, wherein the endoglucanase mutant is an enzyme described in any one of (a) to (d):

[0030] (a) an enzyme having the amino acid sequence shown in SEQ ID NO.1;

[0031] (b) an enzyme represented by an amino acid sequence in which one or more amino acid residues are substituted, deleted or added at positions 12 and 264 of amino acids represented by SEQ ID NO.1 and which still has endoglucanase mutant activity;

[0032] (c) an enzyme represented by an amino acid sequence having a tag connected to the amino terminus and / or carboxyl terminus of the amino acid sequence described in (a) or (b);

[0033] (d) An enzyme represented by an amino acid sequence in which a signal sequence is linked to the amino terminus of the amino acid sequence described in (a) or (b).

[0034] During the research process, the inventors of the present invention combined protein engineering with directed evolution and rational design, and carried out rapid directed transformation of the endoglucanase having the amino acid sequence shown in SEQ ID NO.5, thereby achieving the improvement of the ethanol resistance and organic solvent resistance of the endoglucanase mutant. At the same time, the catalytic efficiency of the endoglucanase mutant is significantly improved, and the endoglucanase mutant can be efficiently and stably applied to cellulose degradation processes (such as the degradation of lignocellulosic biomass) or the process of producing bioethanol using lignocellulosic biomass, thereby effectively improving the utilization rate of lignocellulosic biomass raw materials, significantly improving the yield and output of bioethanol, and reducing the production cost of bioethanol.

[0035] In the present invention, in the amino acid sequence of the endoglucanase mutant having the amino acid sequence shown in SEQ ID NO.1, amino acid residues at positions 12 and 264 may be substituted, deleted or added, and the role of the residues in the protein domain (such as providing positive charge or forming a hydrophobic pocket structure) is unchanged, and the three-dimensional structure of the protein is not affected, so the function of the protein can still be achieved. Preferably, the lysine at position 12 of the endoglucanase mutant amino acid sequence shown in SEQ ID NO.1 of the present invention is substituted with cysteine, and the histidine at position 264 is substituted with arginine, to obtain an endoglucanase mutant amino acid having the amino acid sequence shown in SEQ ID NO.2.

[0036] According to the present invention, preferably, the endoglucanase mutant is an enzyme having an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2. In this case, the endoglucanase mutant has higher ethanol resistance and organic solvent resistance, and good catalytic efficiency, which is more conducive to improving the efficiency of producing bioethanol by fermentation of lignocellulosic biomass.

[0037] In order to facilitate purification, (a) or (b) can also be modified by adding tags commonly used in the art. For example, it can be obtained by connecting an amino acid sequence with a tag to the amino terminus and / or carboxyl terminus of (a). The tag will not affect the activity of the endoglucanase mutant of the present invention. In actual application, whether to add a tag can be selected according to needs.

[0038] In the present invention, the amino terminus of the endoglucanase mutant may also be connected to a signal sequence, which may be derived from Pichia pastoris, Escherichia coli and Saccharomyces cerevisiae, but is not limited thereto.

[0039] The above-mentioned endoglucanase mutant can be obtained by artificial synthesis, or its encoding gene can be synthesized first and then obtained by biological expression. Preferably, the endoglucanase mutant provided by the present invention is mutated by KnowVolution directed evolution combined with InSiReP technology to modify the encoding gene of the wild-type endoglucanase whose amino acid sequence is shown in SEQ ID NO.5, and the specific process includes:

[0040] (1) Heterologous expression of endoglucanase (EG): The expression plasmid containing the coding gene of wild-type endoglucanase was transferred into Pichia pastoris competent cells and spread on a YPD plate containing a certain bleomycin resistance (bleomycin content was 20-100 μg / mL). After 2-3 days, transformants were obtained. The transformants grown on the plate were picked and inoculated into a YPD 96-well plate containing a certain bleomycin resistance (bleomycin content was 20-100 μg / mL), and fermented to produce enzyme under appropriate conditions;

[0041] (2) Establishment of EG high-throughput screening system: After the fermentation is completed, the supernatant enzyme solution is obtained by centrifugation, and an empty plasmid without the EG gene is used as a control. The enzyme activity is detected using a high-throughput screening substrate, and a certain ethanol concentration is selected as the screening concentration to establish a screening system;

[0042] (3) KnowVolution directed evolution phase I: The diversity of the EG gene was generated by casting epPCR (cepPCR). The EG gene was evenly divided into several gene fragments of about 200 bp according to the cepPCR method. 2+ The concentration (0.1-0.5 mM) regulates the mutation rate, and after obtaining the mutants, they are screened through a high-throughput screening system to obtain high-throughput beneficial mutants;

[0043] (4) KnowVolution directed evolution phase II: By sequencing the high-throughput beneficial mutants obtained in phase I, the beneficial potential sites that affect the enzyme's ethanol resistance were obtained. The tang-method technology and 22c-trick technology were used to perform site-saturation mutagenesis (SSM) and screen each site in turn to obtain several confirmed beneficial sites that affect the enzyme's ethanol resistance;

[0044] (5) KnowVolution directed evolution phase III: stability analysis (including site distance analysis and stability analysis) of the beneficial sites obtained in phase II is performed by computer to obtain the best strategy for recombination;

[0045] (6) KnowVolution directed evolution phase IV: The optimal recombination strategy (including 2GeneRep and InsiRep) obtained by computer analysis was experimentally verified, and recombinants with greater improvements in ethanol resistance were selected and their tolerance to different organic solvents was verified to obtain endoglucanase mutants with high ethanol resistance and high organic solvent resistance.

[0046] According to the present invention, preferably, in step (1), the expression plasmid can be a pBSYA1S1Z plasmid, a pET22b plasmid, or a pET28a plasmid; the electroporation method is used to transfer the plasmid into the competent state of Pichia pastoris, and the electroporation conditions may include: a voltage of 1.5-5KV, a capacitance of 10-20μF, and a resistance of 180-200Ω; and the conditions for the fermentation and enzyme production include: a temperature of 20-30°C, a rotation speed of 700-900rpm, and a time of 48-96h.

[0047] According to the present invention, preferably, in step (2), the high-throughput screening substrate of the endoglucanase (EG) can be fluorescent resorcinol, CMC microcrystalline cellulose, carboxymethyl cellulose sodium salt or Azo-CM-cellulose (Azo-CMC); the screening method is: 5-40 μL of enzyme solution is mixed with 10-40 μL of sodium acetate buffer (0.1M, pH 3-6), and then an excess of high-throughput screening substrate is added to react for 5-20 minutes, and then a precipitate (sodium acetate concentration is 2-8 % (w / v), zinc chloride concentration of 0.1-1% (w / v), ethanol concentration of 70-90% (v / v) aqueous solution), react at 600-1200rpm for 1-10min and then terminate the reaction, centrifuge the reaction solution at a speed of 1000-4000rpm and a temperature of 4-20°C for 5-20min, take 50-150μL of the supernatant and transfer it to a new 96-well plate, measure the absorbance at 500nm-600nm; calculate the relative enzyme activity based on the absorbance. The screening ethanol concentration selected in the present invention can be 20-80% by volume.

[0048] The second aspect of the present invention provides a gene encoding an endoglucanase mutant, wherein the gene has a nucleotide sequence encoding the aforementioned endoglucanase mutant.

[0049] According to the present invention, preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO.1, or has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO.2.

[0050] As described above, accordingly, the 5' end and / or 3' end of the nucleotide sequence may also be connected to a coding sequence of a modified tag.

[0051] It is well known in the art that among the 20 different amino acids that make up proteins, except for Met (ATG) or Trp (TGG) which are encoded by a single codon, the other 18 amino acids are encoded by 2-6 codons respectively (Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, second edition, 1989, see Appendix D on page 950). That is, due to the degeneracy of the genetic code, there are usually more than one codon to determine an amino acid, and the substitution of the third nucleotide in the triplet codon often does not change the amino acid composition, so the nucleotide sequence of the gene encoding the same protein can be different.

[0052] More preferably, the gene encoding the enzyme having the amino acid sequence shown in SEQ ID NO.1 has the nucleotide sequence shown in SEQ ID NO.3, and the gene encoding the enzyme having the amino acid sequence shown in SEQ ID NO.2 has the nucleotide sequence shown in SEQ ID NO.4.

[0053] The nucleotide sequences provided by the present invention can usually be obtained by polymerase chain reaction (PCR) amplification, recombination, or artificial synthesis. Once the relevant nucleotide sequence is obtained, the relevant amino acid sequence can be obtained in large quantities by recombination. The obtained nucleotide sequence is usually cloned into a vector, then transferred into genetically engineered bacteria, and then the relevant nucleotide sequence is isolated from the propagated host cells by conventional methods.

[0054] In addition, the relevant nucleotide sequences can also be synthesized by known artificial chemical synthesis methods.

[0055] The third aspect of the present invention provides a recombinant vector, which contains the aforementioned gene.

[0056] The "vector" used in the recombinant vector can be selected from various vectors known in the art, such as various commercially available plasmids, cosmids, phages and retroviruses. Preferably, the expression vector of the recombinant vector is selected from at least one of pBSYA1S1Z plasmid, pET22b plasmid and pET28a plasmid; more preferably, pBSYA1S1Z plasmid.

[0057] The recombinant vector construction can be connected with the gene fragment by Gibson assembly to obtain a recombinant plasmid. The present invention preferably uses the pBSYA1S1Z plasmid and the gene fragment connected thereto, and connects them by seamless cloning ligase to construct the recombinant vector pBSYA1S1Z-EG.

[0058] The fourth aspect of the present invention provides a recombinant strain, which contains the aforementioned gene or the aforementioned recombinant vector.

[0059] In the present invention, the recombinant vector can be transformed, transduced or transfected into a host cell (strain) by conventional methods in the art, such as chemical transformation by calcium chloride method, high voltage electroporation transformation, to obtain a recombinant strain. The recombinant strain can be a prokaryotic cell or a eukaryotic cell, preferably at least one selected from Pichia pastoris, Escherichia coli and Saccharomyces cerevisiae, more preferably, the recombinant strain is Pichia pastoris, such as Pichia pastoris BSYBG11.

[0060] Among the present invention, the endoglucanase mutant can be used in the form of recombinant bacterial strain full cell, or can be used in the form of crude enzyme or purified enzyme separated from the recombinant bacterial strain cell. If necessary, the endoglucanase mutant of the present invention can also be made into immobilized enzyme or immobilized cell using immobilized technology known in the art.

[0061] The fifth aspect of the present invention provides a method for preparing an endoglucanase mutant, which comprises: inoculating the aforementioned recombinant strain into a fermentation medium for fermentation to obtain a fermentation broth, and separating and purifying the fermentation broth to obtain the endoglucanase mutant.

[0062] The method for preparing an endoglucanase mutant provided by the present invention comprises: culturing the recombinant strain provided by the present invention, inducing the expression of the gene encoding the endoglucanase mutant; isolating and purifying the expressed endoglucanase mutant. The culture conditions are conventional culture conditions, such as using YPD medium (the solvent is water, and the solute and its final concentration are respectively: peptone 15-25g / L, yeast extract 5-15g / L, glucose 15-25g / L), culturing at a temperature of 25-35°C and a rotation speed of 800-1200rpm.

[0063] Since the recombinant strain provided by the present invention contains a gene encoding an endoglucanase mutant, it can efficiently express the endoglucanase mutant. After cultivation, it can be separated and purified to obtain a high-purity endoglucanase mutant. The separation and purification can be carried out by methods known to those skilled in the art, which will not be repeated here.

[0064] Based on the fermentation broth of the recombinant strain, a fermentation agent containing the endoglucanase mutant can be prepared in liquid or solid form. The fermentation agent can contain auxiliary materials added during the conventional preparation of bacterial agents in the art, and those skilled in the art can select them as needed. Preferably, the content of the recombinant strain is 10 5 -10 10 CFU, preferably 10 7 -10 9 CFU.

[0065] The sixth aspect of the present invention provides an enzyme preparation, which comprises the endoglucanase mutant prepared by the aforementioned method.

[0066] The enzyme preparation may be in solid, semi-solid or liquid form, and may contain auxiliary materials or additives for preparing the enzyme preparation, etc. Those skilled in the art may select them as needed, which will not be described in detail here.

[0067] The seventh aspect of the present invention provides the use of at least one of the aforementioned endoglucanase mutant, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain, the endoglucanase mutant prepared by the aforementioned method, and the aforementioned enzyme preparation in degrading cellulose and / or preparing bioethanol.

[0068] The endoglucanase mutant provided by the present invention not only has the activity and high stability of endoglucanase, but also has high tolerance to ethanol and organic solvents. It can continuously exert the activity of endoglucanase in the process of producing bioethanol from lignocellulosic biomass, improve the utilization rate of lignocellulosic biomass raw materials, and significantly improve the yield and output of bioethanol.

[0069] The present invention will be described in detail below through examples.

[0070] In the following examples, EG activity was measured by the Azo-CM-cellulose (Azo-CMC) method, and the calculation formula for the ethanol resistance multiple was as follows:

[0071] Resistance multiple = residual activity of EG mutant at a certain ethanol concentration / residual activity of wild-type EG at the same ethanol concentration,

[0072] Residual activity = EG enzyme activity in ethanol / EG enzyme activity in buffer, wherein the buffer is sodium acetate buffer (0.1 M, pH 4.5);

[0073] Pichia pastoris was purchased from Bisy (Austria) with the number BSYBG11; Saccharomyces cerevisiae was purchased from Angel Yeast Co., Ltd. with the number 80000194; DpnI was purchased from Takara with the number 1609, commercial cellulase Ctec3 was purchased from Novozymes, α-amylase was purchased from Genencor Bioproducts Co., Ltd., saccharifying enzyme was purchased from Shandong Longda Bioproducts Co., Ltd., PrimeSTAR Mix DNA polymerase was purchased from Takara with the number R045A, corn was purchased from Anhui COFCO Group Co., Ltd., China, and corn stover was purchased from Lianyungang, Jiangsu; unless otherwise specified, the other reagents or raw materials were conventional commercially available products.

[0074] The formula of YPD medium is: peptone 20g / L, yeast extract 10g / L, glucose 20g / L.

[0075] In the following examples, the method for detecting the content of glucan in corn or corn straw raw materials is as follows: 0.3 g of the raw material sample is mixed with 3 mL of a 72 wt% sulfuric acid solution, stirred at 30 ° C. and 50 rpm for 1 hour, then 84 mL of water is added, and the mixture is reacted at 121 ° C. for 1 hour. The content of glucan in the corn or corn straw raw material is obtained by high performance liquid chromatography.

[0076] Example 1

[0077] (1) Heterologous expression of wild-type endoglucanase EG

[0078] Pichia pastoris was inoculated into YPD medium and cultured until OD600 When the pH reaches 1.3-1.5, the mixture is naturally precipitated, and the Pichia pastoris cells are collected. The Pichia pastoris cells are suspended in a mixture of 100 mM lithium acetate solution, 10 mM dithiothreitol solution, 0.6 M sorbitol solution and 10 mM Tris-HCl (pH 7.5) at room temperature, and incubated at 30° C. and 110 rpm for 30 min. After the incubation is completed, the mixture is centrifuged, and the cells are resuspended in ice-cold sterile water, centrifuged, and the supernatant is discarded. The operation is repeated, and the cells are resuspended in an ice-cold 1 M sorbitol solution, centrifuged to remove the supernatant, and finally the cells are resuspended in an ice-cold 1 M sorbitol solution to obtain competent cells.

[0079] The construction of the recombinant plasmid pBSYA1S1Z-wild-type EG was carried out using a seamless cloning kit, specifically including the cloning of the target gene and the vector: according to the map of the target gene wild-type EG and the vector pBSYA1S1Z, primers EG-P1 (nucleotide sequence as shown in SEQ ID NO.17), EG-P2 (nucleotide sequence as shown in SEQ ID NO.18), Vector-P3 (nucleotide sequence as shown in SEQ ID NO.19), and Vector-P4 (nucleotide sequence as shown in SEQ ID NO.20) were designed, and the wild-type EG gene (amino acid sequence as shown in SEQ ID NO.5, nucleotide sequence as shown in SEQ ID NO.6) was amplified using PrimeSTAR high-fidelity enzyme. NO.6) and linearized vector, the PCR program was: EG gene - 98℃120s; 98℃10s, 55℃15s, 72℃30s, 31 cycles; 72℃5min; vector - 98℃120s; 98℃10s, 55℃15s, 72℃180s, 31 cycles; 72℃10min;

[0080] EG-P1: GCTAACTCTAAAGAGGTTA (SEQ ID NO. 17);

[0081] EG-P2: GAAGTAAGTCTCCAAGATGGA (SEQ ID NO. 18);

[0082] Vector-P3: AACCTCTTTAGAGTTAGCAGCTTCGGCCTCTCTCTTCTC (SEQ ID NO. 19);

[0083] Vector-P4: CCATCTTGGAGACTTACTTCTAAGCGGCCGCTCAAGAGGAT (SEQ ID NO. 20);

[0084] Connection of target gene and vector: According to the basic principle of homologous recombination, the ratio of EG gene to linearized vector was 2:1 using 2X Seamless Cloning Mix provided by the seamless cloning kit, and the system was supplemented to 20 μL with double distilled water. The above system was incubated at 50°C for 15 min, 5 μL was added to Escherichia coli DH5α competent cells, mixed and placed on ice for 30 min, immediately heat-shocked at 42°C for 90 s, quickly returned to ice and allowed to stand for 3-5 min, added LB medium and cultured for 1 h, most of the supernatant was poured off, the precipitated bacteria were resuspended and spread on the plate, and after the transformants grew, the plasmid was extracted and sent for testing to confirm that the recombinant plasmid was successfully constructed, and the recombinant plasmid pBSYA1S1Z-wild-type EG (nucleotide sequence is shown in SEQ ID NO.21) was obtained;

[0085] The Pichia competent cells prepared above were mixed with 3 ng of the recombinant plasmid pBSYA1S1Z-wild-type EG (1 μL, the amino acid sequence of the wild-type EG is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6), transferred to an electroporation cup (pre-cooled in advance), incubated on ice for 5 min, and electroporated under the conditions of a voltage of 1.5 KV, a capacitance of 10 μF, and a resistance of 186 Ω. Immediately add 1 mL of a 1 M sorbitol solution (pre-cooled in advance) and mix well. Spread on a YPD plate containing resistance (bleomycin content is 50 μg / mL), culture at 30°C for 2-3 days, pick the transformants grown on the plate and inoculate them in a YPD 96-well plate containing resistance (bleomycin content is 50 μg / mL), culture and ferment at a temperature of 25°C and a rotation speed of 900 rpm for 96 h, centrifuge at 4000 rpm for 25 min, collect the supernatant, and obtain a supernatant enzyme solution.

[0086] (2) Establishment of EG high-throughput screening system

[0087] Azo-CMC was used as a substrate to detect the activity of EG. 5 μL of supernatant enzyme solution, 30 μL of sodium acetate buffer (0.1 M, pH 5.5) and 35 μL of substrate solution containing Azo-CMC (1 wt%) were added to each well. After incubation at 50°C and 800 rpm for 8 min, a precipitant (aqueous solution containing 2% (w / v) sodium acetate, 1% (w / v) zinc chloride and 80% (v / v) ethanol) was added. The reaction was terminated by incubation at 800 rpm for 5 min. The reaction solution was centrifuged at 2000 rpm and 10°C for 10 min. 100 μL of supernatant was taken in a 96-well plate and the absorbance value (590 nm) was measured. According to the absorbance value OD 590nmThe relative enzyme activity was calculated, and the standard deviation of the detection was determined by measuring the activity in a 96-well MTP containing only wild-type EG (WT) and another 96-well MTP containing only an empty vector (EV, with the empty plasmid pBSYA1S1Z without the EG gene as a control) to determine the ethanol concentration for high-throughput screening, that is, by adjusting the amount of precipitant to obtain different ethanol concentrations, the ethanol concentration at which the residual activity was 30-40% was selected as the final screening concentration, that is, the ethanol concentration was 55% (v / v), and the solvent was supplemented with sodium acetate buffer (0.1 M, pH 4.5).

[0088] (3) KnowVolution directed evolution phase I: Generate diversity of EG gene by Casting epPCR (cepPCR), divide EG gene into 5 almost uniform cepPCR fragments (f1: 197bp, f2: 192bp, f3: 199bp, f4: 193bp, f5: 190bp); amplify 5 cepPCR fragments with primers in Table 1 to obtain cepPCR fragments, then use cepPCR product as large primer to amplify the whole plasmid, the whole plasmid amplification mixture (50μL) contains: 25μL PrimeSTAR Mix DNA polymerase, 500 ng of the cepPCR product obtained as described above, 60 ng of the vector template pBSYA1S1Z-wild-type EG; PCR program: 94°C 2 min (1 cycle); 94°C 30 s, 55°C 30 s, 72°C 3 min (25 cycles); 72°C 10 min (1 cycle); PCR product was digested with DpnI (20 U, 37°C, overnight) and purified; then, 3 ng of the purified fragment product was transformed into 80 μL Pichia pastoris according to the method in step (1) The cells were cultured in YPD plates containing 100 μg / mL bleomycin, and single clones from each library were selected in 96-well plates. After culture and expression, they were screened using a high-throughput screening system (ethanol concentration of 55%, v / v) to obtain mutant strains with improved ethanol resistance. After screening 3,000 clones, 10 beneficial EG variants were identified, which had 11 amino acid substitutions. The results are shown in Table 2. Compared with the wild-type EG (WT), the ethanol resistance of all EG variants was increased by 1.15-1.46 times.

[0089] Table 1 Primers used for cepPCR of EG gene in pBSYA1S1Z

[0090]

[0091]

[0092] Table 2

[0093] Variants Substitution site Ethanol resistance relative to wild-type EG I1 S3P 1.36 I2 S12A 1.23 I3 S113T 1.19 I4 T190A 1.15 I5 F80G 1.26 I6 T77A / E85G 1.27 I7 V231I 1.16 I8 G264R 1.26 I9 S256N / G264R 1.32 I10 D290G 1.46

[0094] (4) KnowVolution directed evolution phase II: A site-saturation mutagenesis library was generated from S3, S12, T77, F80, E85, S113, T190, V231, S256, G264 and D290 of the wild-type EG; a combination of primers designed by the 20c-Tang method was used to create codons encoding 20 standard amino acids, where each amino acid contained exactly one codon. This made it possible to construct an SSM library with minimal redundancy. According to the number of amino acids encoded, the four linked codons NDT (N, S, I, H, R, L, Y, C, F, D, G and W), VMA (E, A, Q, P, K and T), ATG (M) and TGG (W) were mixed in a ratio of 12:6:1:1; the PCR mixture system (50 μL) contained: 2 μL F / R mixed primers, 25 μL PrimeSTAR Mix DNA polymerase and 20 ng pBSYA1S1Z-wild-type EG template; for each target amino acid position, the reaction mixture was divided into two tubes, and the forward primer or reverse primer (10 μm) was added respectively. First, PCR was performed using the following program: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, 72°C for 120 s (3 cycles), the forward and reverse reaction products were combined, and PCR was continued: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, 72°C for 3 min (15 cycles), 72°C for 10 min, and then the PCR product was digested with DpnI (20 U, 37°C, overnight); subsequently, 3 ng of PCR product was transformed into 80 μL of Pichia pastoris competent cells according to the method in step (1), and the cells were placed on a YPD plate containing 100 μg / mL bleomycin. After culture and expression, it was screened using a high-throughput screening system (ethanol concentration of 55%, v / v). The beneficial amino acid substitution sites identified by the SSM library are shown in Table 3. Compared with the wild-type EG (WT), the ethanol resistance of all EG variants was improved by 1.21-1.70 times.

[0095] Table 3 Beneficial amino acid substitution sites identified by screening the EG SSM library

[0096]

[0097]

[0098] (5) KnowVolution directed evolution phase III: The beneficial substitutions of EG determined in step (4) were used to generate single substitutions and recombinants using the FoldX method in the YASARAStructure version, and the ΔΔG of the substitutions was calculated. fold(ΔΔG fold =ΔG fold,sub -ΔG fold,wt ) generated the structures of the variants, and the results are shown in Table 4.

[0099] Table 4

[0100] Variants <![CDATA[ΔΔG fold ]]> S3T 1.13 S3P 3.53 S12C -0.64 S12K -1.90 S12V -0.53 S12A -1.07 T77M -1.11 F80Y 0.99 E85Y -0.95 G264H -2.04 G264R -2.81

[0101] (6) KnowVolution directed evolution stage IV: According to the InSiReP principle, it is generally believed that ΔΔG fold Mutations with a value of ≤+0.36 kcal / mol make the enzyme structure more stable, so the 12 beneficial substitutions screened out are divided into two categories: Subset 1: S12C, S12K, S12V, S12A, T77M, E85Y, G264H, G264R, D290G, ΔΔG fold ≤+0.36 kcal / mol; Subset 2: S3T, S3P, F80Y, 0.36<ΔΔG fold ≤+7.52kcal / mol; For the beneficial variants in subset 1, all possible recombinants (110 recombinants) were arranged and ranked according to their ΔΔGfold values. The top 10% recombinants with the lowest ΔΔGfold values ​​(11 variants in the current study) will be experimentally verified for their specific activity and ethanol resistance. The results are shown in Table 5; that is, 11 PvCel5A variants were constructed by stepwise site-directed mutagenesis, and two significantly improved recombinant EG variants S12K / T77M / E85Y / G264H and EG variants S12C / T77M / E85Y / G264R were produced using a high-throughput screening method. The two EG variants were compared with the wild-type EG after purification. The protein gel is shown in Figure 5. Figure 1 shown.

[0102] The recombination was carried out by the SDM method. The SDM PCR mixture system (50 μL) contained: 25 μL PrimeSTAR Mix DNA polymerase (purchased from Takara, product number R045Q) and 30 ng pBSYA1S1Z-wild-type EG template; for each target amino acid position, the reaction mixture was divided into two tubes, and a forward primer or a reverse primer (10 μm) was added respectively, as shown in Table 6. First, PCR was performed using the following program: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, and 72°C for 120 s (3 cycles), the forward and reverse reaction products were combined, and PCR was continued: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, and 72°C for 3 min (15 cycles), 72°C for 10 min, and then the PCR product was digested with DpnI (20 U, 37°C, overnight); subsequently, 3 ng The PCR product was transformed into 80 μL of Pichia competent cells according to the method in step (1), and the cells were cultured on a YPD plate containing 100 μg / mL bleomycin, and then inoculated into a 96-well plate at 900 rpm, 25°C, and fermented for 96 hours. The supernatant enzyme solution was obtained after centrifugation; the ethanol resistance of EG was determined according to the method in step (2) using the substrate Res-CB in 0.1M sodium acetate buffer adjusted to pH 7. As shown in Table 7, compared with the wild-type EG (WT), the ethanol resistance of the EG variant S12K / T77M / E85Y / G264H (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.3) was increased by 1.96 times, and the ethanol resistance of the EG variant S12C / T77M / E85Y / G264R (amino acid sequence as shown in SEQ ID NO.2, nucleotide sequence as shown in SEQ ID NO.4) was increased by 2.02 times.

[0103] The resistance of EG variant S12K / T77M / E85Y / G264H (referred to as variant 1) and EG variant S12C / T77M / E85Y / G264R (referred to as variant 2) as well as wild-type EG in solutions containing different organic solvents was determined. The organic solvent solutions were ethanol solution, 1,4-dioxane (DOX) solution, dimethyl sulfoxide (DMSO) solution, tetrafluoroethylene (TFE) solution, isopropanol (IPA) solution, and methanol solution. The organic solvents were prepared into solutions of corresponding concentrations using sodium acetate buffer (0.1 M, pH 4.5). The results are shown in Table 1. Figure 2 From Table 7, it can be seen that the EG variant S12K / T77M / E85Y / G264H and the EG variant S12C / T77M / E85Y / G264R have significantly superior organic solvent resistance than the wild-type EG.

[0104] Table 5

[0105] Variants Replacement site <![CDATA[ΔΔG fold (kcal / mol)]]> R1 S12K / T77M / E85Y / G264R -6.75 R2 S12K / T77M / E85Y / G264R / D290G -6.66 R3 S12A / T77M / E85Y / G264R -6.1 R4 S12K / T77M / E85Y / G264H -5.91 R5 S12A / T77M / E85Y / G264R / D290G -5.91 R6 S12K / T77M / E85Y / G264H / D290G -5.89 R7 S12K / E85Y / G264R -5.73 R8 S12C / T77M / E85Y / G264R -5.53 R9 S12V / T77M / E85Y / G264R -5.26 R10 S12A / E85Y / G264R -5.16 R11 T77M / E85Y / G264R -4.93

[0106] Table 6

[0107]

[0108]

[0109] Table 7

[0110]

[0111] Example 2

[0112] (1) After seed culture, Saccharomyces cerevisiae was inoculated into 120 mL of YPD medium containing 100 g / L glucose at an inoculum amount of 1% (v / v), and grown for 24 h at a temperature of 30° C. and a rotation speed of 150 rpm to obtain a Saccharomyces cerevisiae culture solution; corn was liquefied in a 1 L flask using an intermittently mixed water bath, and the dry corn loading in the total mixture was 30% (w / w), and the dosage of α-amylase was 0.048% (w / w dry corn). Rice), wherein 700g of the total mixture is liquefied at pH 5.7 and temperature 85°C for 4h to obtain liquefied corn, then in a 250mL conical flask, the saccharification enzyme (0.1g / 100g dry corn) is added to the liquefied corn for simultaneous saccharification and fermentation, the working weight is 150g, and the fermentation is carried out at pH 4.6, stirring rate 150rpm, and temperature 30°C for 96h to obtain a fermentation liquid;

[0113] (2) The fermentation liquid was treated with 1% (w / w) dilute sulfuric acid for 90 minutes at a temperature of 82°C and a pressure of 0.05-0.06MPa. The solid obtained by solid-liquid separation after acid treatment was dried at 50°C for 8 hours. The dried lees were mixed with 4.5% (w / w corn liquefaction total mixture) and returned to the corn liquefaction stage in step (1) for simultaneous fermentation and conversion of corn starch and corn fiber; commercial cellulase Ctec3 (added amount of 20 mg protein / g glucan) and EG variant S12K / T77M / E85Y / G264H (EG variant and Ctec3 EG enzyme activity of 1:1) were added, and the final fermentation liquid was obtained after fermentation at pH 4.6, stirring rate of 150rpm, and temperature of 30°C for 96 hours. The ethanol concentration in the final fermentation liquid was 104.02 g / L by high performance liquid chromatography.

[0114] Example 3

[0115] The simultaneous fermentation conversion of corn starch and corn fiber was carried out according to the method of Example 2, except that the EG variant S12K / T77M / E85Y / G264H was replaced by the EG variant S12C / T77M / E85Y / G264R.

[0116] The ethanol concentration in the final fermentation broth was 104.62 g / L as determined by high performance liquid chromatography.

[0117] Comparative Example 1

[0118] The simultaneous fermentation conversion of corn starch and corn fiber was carried out according to the method of Example 2, except that the EG variant S12K / T77M / E85Y / G264H was replaced by wild-type EG.

[0119] The ethanol concentration in the final fermentation broth was 100.52 g / L as determined by high performance liquid chromatography.

[0120] Comparative Example 2

[0121] The simultaneous fermentation conversion of corn starch and corn fiber was carried out according to the method of Example 2, except that the commercial cellulase Ctec3 and EG variant S12K / T77M / E85Y / G264H were not added.

[0122] The ethanol concentration in the final fermentation broth was 94.62 g / L as determined by high performance liquid chromatography.

[0123] Comparative Example 3

[0124] The simultaneous fermentation conversion of corn starch and corn fiber was carried out according to the method of Example 2, except that the EG variant S12K / T77M / E85Y / G264H was not added, and the added amount of the commercial cellulase Ctec3 was 40 mg protein / g glucan.

[0125] The ethanol concentration in the final fermentation broth was 96.33 g / L as determined by high performance liquid chromatography.

[0126] From the data of Examples 2-3 and Comparative Examples 1-3, it can be seen that compared with no addition of cellulase in Comparative Example 2 and the addition of commercial cellulase Ctec3 alone in Comparative Example 3, the addition of EG variant S12K / T77M / E85Y / G264H or EG variant S12C / T77M / E85Y / G264R can effectively increase the ethanol concentration in the fermentation broth, indicating that the EG variant designed by KnowVolution can resist the adverse effects of ethanol accumulated in the fermentation environment, promote cellulose hydrolysis, and thus increase ethanol production.

[0127] Example 4

[0128] The corn stalks were pretreated with dilute alkali in a 1L shake flask, the total mass of the mixture was 500g, the mixture contained 10% (w / w) corn stalks and 2% (w / w) NaOH, and the mixture was reacted in a pressure cooker at 121°C for 20min to obtain a pretreated solution, the pretreated solution was neutralized with hydrochloric acid, and the solid-liquid separation was performed to obtain a precipitate, the precipitate was washed with 500mL of water and then dried at 50°C to obtain a moisture content of 10-20% to obtain the pretreated corn stalks; the enzymatic hydrolysis of the pretreated corn stalks was performed in a 100mL shake flask, the total mass of the mixture was 50g, the solid content was 10% (w / w), and the commercial cellulase Ctec3( The added amount is 20 mg protein / g glucan) and EG variant S12K / T77M / E85Y / G264H (the EG enzyme activity of the EG variant and Ctec3 is 1:1), and enzymolysis is carried out at a temperature of 50°C, a pH of 4.8, and a stirring rate of 250 rpm for 48 hours. After the enzymolysis is completed, centrifugation is carried out at 10000 rpm for 10 minutes to obtain a supernatant, 5 g / L yeast extract, 10 g / L trypsin and 0.44 g / L seed culture of Saccharomyces cerevisiae are added to the supernatant, and fermentation is carried out at a temperature of 30°C and a rotation speed of 150 rpm for 24 hours to obtain a fermentation broth.

[0129] The ethanol concentration in the fermentation broth was analyzed by high performance liquid chromatography and was found to be 26.0 g / L.

[0130] Example 5

[0131] Corn stover fermentation was performed according to the method of Example 3, except that the EG variant S12K / T77M / E85Y / G264H was replaced by the EG variant S12C / T77M / E85Y / G264R.

[0132] The ethanol concentration in the fermentation broth was analyzed by high performance liquid chromatography and was found to be 26.8 g / L.

[0133] Comparative Example 4

[0134] Corn stover fermentation was performed according to the method of Example 3, except that the EG variant S12K / T77M / E85Y / G264H was replaced by wild-type EG.

[0135] The ethanol concentration in the fermentation broth was analyzed by high performance liquid chromatography and was found to be 24.3 g / L.

[0136] Comparative Example 5

[0137] Liquid fermentation of Saccharomyces cerevisiae was carried out according to the method of Example 3, except that the EG variant S12K / T77M / E85Y / G264H was not added, and the added amount of commercial cellulase Ctec3 was 40 mg protein / g glucan.

[0138] The ethanol concentration in the fermentation broth was analyzed by high performance liquid chromatography and was found to be 22.5 g / L.

[0139] From the data of Example 4-Example 5 and Comparative Example 4-Comparative Example 5, it can be seen that after the corn stover is enzymatically hydrolyzed with the EG variant S12K / T77M / E85Y / G264H, the ethanol yield (concentration) is increased by 15.56% (about 3.5 g / L) compared with the enzymatic hydrolysis with commercial cellulase (Comparative Example 5), and the ethanol yield is increased by 7.00% (about 1.7 g / L) compared with the enzymatic hydrolysis with wild-type EG; after the corn stover is enzymatically hydrolyzed with the EG variant S12C / T77M / E85Y / G264R, the ethanol yield (concentration) is increased by 19.11% (about 4.3 g / L) compared with the enzymatic hydrolysis with commercial cellulase, and the ethanol yield is increased by 10.29% (about 2.5 g / L) compared with the enzymatic hydrolysis with wild-type EG.

[0140] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. An endoglucanase mutant, characterized in that The endoglucanase mutant is an enzyme described in any one of (a) to (d): (a) an enzyme having the amino acid sequence shown in SEQ ID NO.1; (b) an enzyme represented by an amino acid sequence in which the 12th amino acid position represented by SEQ ID NO.1 is substituted by cysteine ​​and the 264th amino acid position represented by arginine; (c) an enzyme represented by an amino acid sequence having a tag connected to the amino terminus and / or carboxyl terminus of the amino acid sequence described in (a) or (b); (d) An enzyme represented by an amino acid sequence in which a signal sequence is linked to the amino terminus of the amino acid sequence described in (a) or (b).

2. The endoglucanase mutant according to claim 1, characterized in that The endoglucanase mutant is an enzyme with an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. A gene encoding an endoglucanase mutant, characterized in that The gene is a nucleotide sequence encoding the endoglucanase mutant according to claim 1 or 2.

4. The gene according to claim 3, characterized in that The gene is a nucleotide sequence encoding an enzyme with an amino acid sequence shown in SEQ ID NO.

1.

5. The gene according to claim 4, characterized in that The gene is the nucleotide sequence shown in SEQ ID NO.

3.

6. The gene according to claim 3, characterized in that The gene is a nucleotide sequence encoding an enzyme with an amino acid sequence shown in SEQ ID NO.

2.

7. The gene according to claim 6, characterized in that The gene is the nucleotide sequence shown in SEQ ID NO.

4.

8. A recombinant vector, characterized in that: The recombinant vector contains the gene according to any one of claims 3 to 7.

9. The recombinant vector according to claim 8, characterized in that The expression vector of the recombinant vector is selected from at least one of pBSYA1S1Z plasmid, pET22b plasmid and pET28a plasmid.

10. A recombinant strain, characterized in that The recombinant strain contains the gene according to any one of claims 3 to 7 or the recombinant vector according to claim 8 or 9.

11. The recombinant strain according to claim 10, characterized in that The recombinant strain is selected from at least one of Pichia pastoris, Escherichia coli and Saccharomyces cerevisiae.

12. A method for preparing an endoglucanase mutant, characterized in that: The preparation method comprises: inoculating the recombinant strain according to claim 10 or 11 into a fermentation medium for fermentation to obtain a fermentation liquid, and separating and purifying the fermentation liquid to obtain an endoglucanase mutant.

13. An enzyme preparation, characterized in that The enzyme preparation comprises the endoglucanase mutant prepared by the method according to claim 12.

14. Use of at least one of the endoglucanase mutant according to claim 1 or 2, the gene according to any one of claims 3 to 7, the recombinant vector according to claim 6, the recombinant strain according to claim 8 or 9, the endoglucanase mutant prepared by the method according to claim 10 or 11, and the enzyme preparation according to claim 13 in degrading cellulose and / or preparing bioethanol.

Images