Heat shock protein genes related to stress resistance and their applications

Abstract

The present invention discloses heat shock protein genes related to stress resistance and their applications, including DgHsp20-30 with a nucleotide sequence as shown in SEQ ID NO: 21 and DgHsp20-31 with a nucleotide sequence as shown in SEQ ID NO: 24. It is found through research that overexpression of these genes in yeast can respectively increase the survival rate of yeast under salt stress (1.0 M NaCl) and drought stress (2.0 M sorbitol). These genes can be used to prepare yeast with stronger resistance, including Saccharomyces cerevisiae with stronger applicability. The Arabidopsis mutant lacking the homologous genes shows reduced resistance to salt stress (1.0 M NaCl), all indicating that these genes are related to stress resistance. This characteristic also has potential advantages in preparing plants with enhanced stress resistance, including Arabidopsis thaliana and Dactylis glomerata, etc.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a heat shock protein gene related to stress resistance and its applications. Background Art

[0002] Plants are constantly exposed to changing external environments and are thus vulnerable to various biotic and abiotic stresses, which can cause abnormal protein expression. Numerous studies have found that heat shock proteins have molecular chaperone activity and are closely related to alleviating abnormal protein expression. Heat shock proteins, also known as stress proteins or heat shock proteins, are newly synthesized or increased in content when cells or organisms are subjected to environmental stresses such as high temperature, drought, hypoxia, and heavy metals. This stress phenomenon is called the heat shock response (HSR). Heat shock proteins are widely present in plants, animals, and microorganisms and are produced in large amounts after being subjected to adversity stress to improve the adaptability of organisms to environmental stress. Plant heat shock proteins were first discovered in 1982 when scientists found that soybean seedlings synthesized heat shock proteins at higher temperatures. In addition to high temperature, heat shock proteins are induced under other abiotic stress conditions such as cold and drought.

[0003] Heat shock proteins in eukaryotes can be classified according to their molecular weights: including five categories of large molecular weight HSP100, HSP90, HSP70, HSP60, and small molecular weight HSP20. Among them, HSP20 in plants has a small molecular weight but is more widely distributed and has the most species. The molecular weight of HSP20 ranges from 12 to 40 kDa, and most members are 15 to 22 kDa, also known as Hsp20. As a protective protein with stress resistance, heat shock protein molecules of different families form a molecular chaperone network by performing different functions, thereby reducing the abnormal expression of proteins in plants after being subjected to adversity stress and maintaining normal plant growth. After plants are stressed, HSP70 and HSP90 first receive the stimulus and participate in signal transduction and transcriptional activation to direct the generation of other heat shock proteins or stress response proteins; then HSP20 and HSP70 bind to denatured or partially denatured proteins to stabilize their conformations and prevent the aggregation of denatured proteins. Finally, HSP60, HSP70, and HSP90 refold them. Even if aggregates of denatured or misfolded proteins are formed, HSP100 will redissolve them and promote protein refolding. However, there are currently not many reports on small molecular heat shock protein genes related to heat stress resistance. Therefore, exploring the research on small molecular heat shock proteins in heat stress resistance provides theoretical support for the application of heat shock protein genes in heat stress resistance, including the preparation of plant and microbial strains with enhanced heat stress resistance, and has important application research significance. Summary of the Invention

[0004] The object of the present invention is to provide heat shock protein genes related to stress resistance, and for the first time, discloses heat shock protein genes DgHsp20-30 and DgHsp20-31 related to stress resistance, solves the problem of poor stress resistance of yeast, prepares yeast, Arabidopsis thaliana, etc. with enhanced stress resistance, and also provides a research basis for preparing cocksfoot with enhanced resistance.

[0005] To achieve the above object, the present invention provides heat shock protein genes related to stress resistance, and the genes are DgHsp20-30 with a nucleotide sequence as shown in SEQ ID NO: 21 or DgHsp20-31 with a nucleotide sequence as shown in SEQ ID NO: 24. In yeast, overexpression of DgHsp20-30 or DgHsp20-31 improves the salt stress resistance and drought stress resistance of yeast; in Arabidopsis thaliana, deletion of the homologous gene of DgHsp20-31 reduces the salt stress resistance of Arabidopsis thaliana.

[0006] The present invention also provides specific primers for identifying the above heat shock protein genes DgHsp20-30 and DgHsp20-31. Among them, the nucleotide sequences of the specific primers for identifying DgHsp20-30 are as shown in SEQ ID NO: 19 and SEQ ID NO: 20, and the nucleotide sequences of the specific primers for identifying DgHsp20-31 are as shown in SEQ ID NO: 22 and SEQ ID NO: 23.

[0007] The present invention also provides a kit for detecting the above heat shock protein genes DgHsp20-30 and DgHsp20-31, and the kit contains the above specific primers with nucleotide sequences as shown in SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 22 and SEQ ID NO: 23.

[0008] The present invention also provides a cloning vector containing the above heat shock protein gene. Among them, the cloning vector preferably uses the yeast expression plasmid pYES2.

[0009] The present invention also provides an expression bacterium containing the above heat shock protein gene.

[0010] The present invention also provides the application of the above heat shock protein gene in the preparation of stress-resistant yeast, and particularly can be used for preparing Saccharomyces cerevisiae with enhanced stress resistance.

[0011] The present invention also provides the application of the above heat shock protein gene in the preparation of stress-resistant plants, and particularly can be used for preparing cocksfoot and Arabidopsis thaliana with enhanced stress resistance.

[0012] The heat shock protein gene related to stress resistance of the present invention solves the problems such as poor stress resistance of ordinary yeast and has the following advantages:

[0013] For the heat shock protein gene related to stress resistance provided by the present invention, through research, it is known that overexpression of this gene in yeast can significantly improve the stress resistance of the yeast. This characteristic can be used to prepare yeast with high stress resistance, such as Saccharomyces cerevisiae, etc., and also has potential advantages in preparing plants with enhanced stress resistance, including Arabidopsis thaliana and Dactylis glomerata, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the expression heat map of the DgHsp20s gene of Dactylis glomerata in different tissues under normal growth conditions in the present invention.

[0015] Figure 2 It is the expression heat map of the DgHsp20s gene in the leaves of Dactylis glomerata at different times under heat stress in the present invention.

[0016] Figure 3 It is the expression heat map of the DgHsp20s gene of Dactylis glomerata in the leaves and roots under drought stress in the present invention.

[0017] Figure 4 It is the expression heat map of 8 screened DgHsp20s genes of Dactylis glomerata under three abiotic stresses at different times in the present invention.

[0018] Figure 5 It is the result of the PCR electrophoresis of the gene overexpression yeast constructed in the present invention.

[0019] Figure 6 The result of the verification of the stress resistance function of Saccharomyces cerevisiae in the present invention.

[0020] Figure 7 It is the identification principle and PCR identification result of the Arabidopsis thaliana mutant athsp31 in the present invention.

[0021] Figure 8 It is the result of the phenotypic changes of wild-type Arabidopsis thaliana and mutant lines under high-salt stress treatment in the present invention.

[0022] Figure 9 It is the result of the changes in the physiological indexes of the Arabidopsis thaliana mutant before and after salt stress in the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0024] Embodiment

[0025] I. Acquisition and analysis of genes

[0026] Genome-wide identification of DgHsp20 in Dactylis glomerata

[0027] 1.1 Retrieval and identification of DgHsp20 genes in Dactylis glomerata

[0028] Heat shock proteins in eukaryotes can be classified according to their molecular weights, including five major categories: large molecular weight HSP100, HSP90, HSP70, HSP60, and small molecular weight HSP20. Among them, HSP20 in plants has a small molecular weight but is more widely distributed and has the largest number of species. Because it plays an important role in the biological world, homologous genes of HSP20 have been found in almost all organism genomes, even in genomes with a significant reduction in many other genes. Compared with other organisms, small heat shock proteins in plants are the most widely distributed and the most abundant. Therefore, the present invention selects HSP20 as the research target. Download heat shock protein genome data and protein sequences from the Dactylis glomerata genome database (http: / / orchardgrassgenome.sicau.edu.cn / download.php). The sequence data of Hsp20s in Arabidopsis thaliana and Glycine max come from Ensemblplants (http: / / plants.ensembl.org / index.html), and the sequence data of Hsp20s in Oryza sativa come from the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ).

[0029] To identify the members of the Hsp20 family in Orchardgrass, the present invention uses the HMMERv3 software. Download the hidden Markov model (HMM) spectrum of the HSP20 conserved domain (PF00011) from the Pfam database (http: / / pfam.xfam.org / ) as the template sequence, and use the HMM3.0 software to compare the protein sequences containing the conserved domain. Then, use hmmbuild in the HMMERv3 suite to construct a Dactylis glomerata-specific HMM file. Next, use the new HMM to scan the Dactylis glomerata heat shock protein data to re-identify the members of the Dactylis glomerata Hsp20 family, and select all proteins with an e-value less than 0.01. Finally, use the online tools Search Pfam( http: / / pfam.xfam.org / search / ) and CD-Search( https: / / www.ncbi.nlm.nih.gov / cdd ) to detect their typical Hsp20 characteristic domains and screen out candidate proteins. Use the EXPASY website tool (https: / / www.expasy.org / ) to analyze the theoretical isoelectric point (pI), molecular weight (MW), and number of amino acids of the predicted protein sequences.

[0030] Finally, 47 HSP20 proteins were identified in orchardgrass by using HMMER (PF00011) and analyzing with SMART software. Sequences without typical ACD domains were excluded and they were named according to their chromosomal locations. The amino acid lengths of DgHSP20s varied greatly, ranging from 128 to 791 amino acids. The molecular weights ranged from 14.4 (Dg2HSP20-18) to 89.2 (Dg7HSP20-47) kDa, and the predicted theoretical isoelectric points ranged from 4.01 (Dg3HSP20-20) to 10.48 (Dg6HSP20-44). Data such as the gene names, gene IDs, chromosomal locations, amino acid numbers, molecular weights, and theoretical isoelectric points of DgHSP20s proteins are shown in Table 1 below. The numbers after Dg in the gene names indicate the chromosome numbers where the genes are located. The number 0 indicates that the gene is not mapped to a chromosome and is represented by Dg0, such as Dg0HSP20-1 and Dg0HSP20-2.

[0031] Table 1 Molecular characteristics of DgHSP20s encoded proteins

[0032]

[0033]

[0034] 1.2 Gene mapping and analysis of duplicated genes

[0035] Using the online tool MG2C (http: / / mg2c.iask.in / mg2c_v2.1 / ), the chromosomal locations of Hsp20 genes were first obtained. The intron and exon location information of Hsp20 was extracted from the gff3 data in the orchardgrass genome, and the CDS and DNA sequences obtained by alignment through the online website Gene Structure Display Server 2.0 (http: / / gsds.cbi.pku.edu.cn / ) were used to finally obtain the visualized exon-intron structure diagram of Hsp20 genes. The online search program MEME 4.11.3 (http: / / meme-suite.org / tools / meme) for protein conserved motifs was used to analyze the conserved motifs of its gene family, with the parameter of the maximum number of motif retrievals set to 15 and other parameters set to default. KaKs_CalgμLator 2.0 was used to calculate the Ka (non-synonymous substitution rate) and Ks (synonymous substitution rate) of each pair of duplicated genes.

[0036] Among the predicted 47 DgHsp20s genes, 45 genes are randomly distributed on the seven chromosomes of the diploid orchardgrass genome, and two genes cannot be mapped to chromosomes. According to their positions arranged on chromosomes 1 to 7, the genes are named DgHsp20-01 to Dg7Hsp-47 in sequence. Most Hsp20 genes are mainly located on four chromosomes: chromosome 2 (n = 14, 29.79%), chromosome 4 (n = 6, 12.77%), chromosome 5 (n = 9, 19.15%), and chromosome 6 (n = 7, 14.89%). There are only 3 (6.38%), 4 (8.51%), and 2 (4.26%) DgHsp20s genes on chromosomes 1, 3, and 7, respectively.

[0037] During the process of evolution, both tandem duplication and segmental duplication contribute to the generation of gene family members. Therefore, the present invention analyzed the duplication events of DgHsp20 genes. According to the defined criteria and chromosome localization information, 12 genes (25.5%) were identified as tandem duplication genes. Three pairs of independent tandem duplication genes are located on chromosome 5, and two pairs and one pair of independent tandem duplication genes are located on chromosomes 6 and 2, respectively. Six pairs of tandem duplication genes belong to four subfamilies, namely CⅠ, CⅡ, CⅤ, and P, and the KA / KS values are all less than 1, indicating that these tandem duplication genes are subject to purifying selection. In addition, three pairs of genes (Dg2Hsp20-06 and Dg3Hsp20-23, Dg2Hsp20-19 and Dg6Hsp20-44, Dg5Hsp20-37 and Dg6Hsp20-39) are segmental duplication genes. The segmental duplication genes only account for 12.8% of all DgHsp20s genes. In addition, one pair of duplicated genes could not be mapped to chromosomes. Based on the above results, it can be inferred that tandem duplication and segmental duplication together promoted the expansion of the DgHsp20 family, but the former played a dominant role.

[0038] 1.3 Phylogenetic tree, gene structure, and conserved motif analysis

[0039] With the help of the software MEGA 7, a phylogenetic tree of orchardgrass, Arabidopsis thaliana, and soybean genes was constructed using the maximum likelihood method with the Poisson correction model. The Bootstrap value was set to repeat 1000 times, and other parameters were set to default. Then, the phylogenetic tree was beautified using the Figtree software. Finally, based on the topological structure of the phylogenetic tree and combined with the known Hsp20 protein subfamily information in other species, the orchardgrass Hsp20 proteins were grouped.

[0040] Multiple alignments were performed on Hsp20 proteins from soybean (Glycine max), rice (Oryza sativa), Arabidopsis thaliana, and orchardgrass (Dactylis glomerata). Based on the results of the multiple alignments, a phylogenetic tree was constructed using the maximum likelihood method to study the phylogenetic relationships of these Hsp20 proteins. It was found that 47 sequences of the Hsp20 gene family in orchardgrass were divided into 10 classes, including 12 in CⅠ, 4 in CⅡ, 6 in CⅢ, 8 in CⅤ, 1 in CⅥ, 5 in MⅠ, 1 in MⅡ (mitochondria), 5 in P (plastids), 2 in Po (peroxisomes), 2 in ER (endoplasmic reticulum), and one unknown class (DgHsp20-20).

[0041] Thirty-one orchardgrass Hsp20 proteins were clustered into five cytoplasmic groups (CI to CVI), which may indicate that most orchardgrass Hsp20 proteins function in the cytoplasm. Notably, orchardgrass lacks members within the CⅣ and CⅦ subfamilies. The Hsp20 proteins of the monocotyledonous orchardgrass are not present in the cytoplasmic CIV group. Previous studies have reported that cytoplasmic CIV group Hsp20 proteins are only present in dicotyledonous plants, and this result is consistent with that report, which may indicate that cytoplasmic CIV group Hsp20 proteins are specific to dicotyledonous plants.

[0042] By aligning the full-length cDNA sequences with the corresponding Hsp20 genomic DNA sequences, the exon-intron structure of each Hsp20 gene was analyzed. According to the number of introns, the 47 Hsp20 genes could be divided into three categories. Among them, 29 genes had no introns, accounting for more than half (61.70%) of all gene family members. The Hsp20 genes with introns were mainly distributed in the CⅠ and P subfamilies. Among them, 4 genes (8.51%) had only one intron, and 14 genes (29.79%) had 2 introns. This regularity in gene structure may be related to the evolutionary trend and also reflects the evolutionary conservation of the orchardgrass Hsp20 gene family from the side. The results of the analysis showed that members of the same subfamily had similar exon-intron organizations. For example, members of the CⅡ subfamily had no UTRs, and except for HSP20-03 in the CV subfamily, the remaining members had no UTRs.

[0043] MEME analysis studied 15 conserved motifs of Hsp20 protein. It was found that 91% of Hsp20 contained motif1, 87% of Hsp20 contained motif2, and 55.32% of Hsp20 proteins contained the combination of motif1, motif2, and motif4, which were concentrated in CI, CⅡ, MI, and P subfamilies. Motif3, motif6, and motif8 were often combined and distributed in the CI subfamily. Motif11 and motif12 were only distributed in the P subfamily. Motif9 and motif15 were only distributed in the CV subfamily. Motif13 was only distributed in the CⅡ subfamily. Motif14 was only distributed in the CⅢ subfamily. Members of the same subfamily had the same or similar motif compositions, and the distribution positions of the motifs were roughly the same, indicating their high conservation. This rule was similar to the distribution rule of exons - introns.

[0044] 2DgHsp20s Gene Expression Analysis

[0045] 2.1 Cultivation of Research Materials and Stress Treatments

[0046] The stress treatment material selected was the "Baoxing" variety of orchardgrass. Orchardgrass seeds were sown in petri dishes filled with quartz sand, and plastic wrap with pre - punched holes was attached to promote seed germination. The quartz sand used was washed and dried in advance. It was cultivated in a plant growth chamber with a growth environment of 23℃ during the day, 18℃ at night, and a light cycle of 16 h light / 8 h dark cycle. During the cultivation period, 1 / 2 Hoagland nutrient solution was irrigated. When the orchardgrass seedlings grew to 3 - 4 leaves, seedlings with similar growth trends were selected for different stress treatments. PEG - 6000, as an osmotic mimetic, well - simulated the drought environment and was currently recognized as the best macromolecular compound for simulating water stress. Therefore, 20% PEG - 6000 was used to simulate the drought environment in the experiment. Salt stress and drought stress were respectively treated by soaking the roots with 150 mM NaCl solution and 20% PEG - 6000 solution. Heat stress was treated by exposing the orchardgrass seedlings to 40℃ high temperature. During this period, the water in the petri dish was ensured to be sufficient, and 1 / 2 Hoagland nutrient solution was used as a control. Samples were taken at different time points (0, 2, 4, 8, 12, 24, 48 h) for each treatment. After treatment, the fresh whole orchardgrass seedlings were placed in 2.0 EP tubes and quickly frozen in liquid nitrogen and stored in an - 80℃ refrigerator.

[0047] 2.2 RNA Extraction and cDNA Synthesis Detection of Orchardgrass Seedlings

[0048] Total RNA of Dactylis glomerata was extracted using the Tianmo Biological Plant Total RNA Extraction Kit (Hipure HP plant RNA minikit, Meiji Biotechnology Co., Ltd., Guangzhou, China). The extraction steps referred to the product instruction manual, and the extracted RNA was stored in an -80 °C refrigerator immediately. The quality of the extracted RNA samples was detected by 2% agarose gel electrophoresis, and their quality and concentration were measured using a NanoDrop2000 micro-spectrophotometer. The cDNA of Dactylis glomerata was reverse-transcribed using a reverse transcription kit (MonScript TM RTIII All-in-One Mix with dsDNase, Monad Biotechnology Co., Ltd., Wuhan, China). Referring to the product instruction, the RNA samples that had been detected for quality and concentration in the previous step were prepared on ice into a reaction system as shown in Table 2 below:

[0049] Table 2 Reverse transcription PCR reaction system

[0050]

[0051] The successfully synthesized cDNA was diluted 10-fold with ddH 2 O and stored in a -20 °C refrigerator for standby, and repeated freezing and thawing of the cDNA was avoided as much as possible.

[0052] 2.3 Expression profile analysis of Dactylis glomerata Hsp20 genes under different tissues

[0053] To better understand the function of the Dactylis glomerata Hsp20 gene during its growth and development and study the expression pattern of the DgHsp20s gene, the expression levels of the DgHsp20s gene in different parts (flowers, leaves, roots, spikes, stems) of Dactylis glomerata under normal growth conditions were determined by transcriptome sequencing in this experiment. The results are as Figure 1 shown. It can be found that most DgHsp20s genes showed tissue-specific differential expression, which may indicate that DgHsp20s genes play different functional mechanisms and differentiated functional differences during the growth and development of Dactylis glomerata. All DgHsp20s were expressed in at least one tissue, 33.34% of the genes had relatively high expression in at least one tissue, 21.28% of the DgHsp20s genes had significantly higher expression levels in root organs than in other tissue organs, 17.02% of the DgHsp20s genes had significantly higher expression levels in spike organs than in other tissue organs, and only the Dg1Hsp20-03 gene had a relatively higher expression level in leaves than in other tissue organs.

[0054] It was found that individual genes might play prominent roles. For example, the expression levels of Dg6Hsp20-41 were relatively high in flowers and spikes, being 6 times and 3 times respectively of that in leaves. The expression levels of Dg1Hsp20-03 were high in flowers, leaves and roots, especially the expression level in leaves was 43 times that in stems; the expression levels of Dg5Hsp20-31 were relatively high in leaves, spikes, flowers and roots, and the expression levels in flowers and roots were 3 times and 4 times respectively of that in leaves; the expression levels of Dg2Hsp20-17 were high in flowers, roots, spikes and stems, and the highest expression level was in roots, being 11 times that in leaves; the expression levels of Dg2Hsp20-08 were high in flowers, leaves, roots and spikes, and the highest expression level was in flowers, being 57 times that in stems; the expression level of Dg3Hsp20-23 was very high in spikes, being more than 84 times that in flowers, indicating that it might be mainly expressed in spikes.

[0055] 2.4 Expression profile analysis of DgHsp20s under different stress conditions

[0056] Dactylis glomerata will suffer various abiotic stress conditions in the natural environment, such as drought, high temperature and waterlogging. We collected the expression levels of Hsp20 under drought stress and heat stress from Huang et al. and Ji et al. to explore other potential functions of HSP20 genes differentially expressed under different abiotic stress conditions. The expression levels of DgHsp20s genes fluctuated, and genes with LOG(FC)>1 or <-1 were considered significantly up-regulated or down-regulated genes. Then, TB-TOOLs software was used to visualize the expression profiles under various abiotic stresses and draw the heatmap of DgHsp20s genes under different stress conditions.

[0057] 2.4.1 Expression profile analysis of Dactylis glomerata Hsp20 genes under heat stress

[0058] In the heat stress treatment, two varieties of Dactylis glomerata, "Baoxing" and "01998", were selected and subjected to heat stress treatment for 10 days and 26 days respectively (cultured in a 35°C light incubator), and the expression levels of DgHsp20s genes in the leaves of Dactylis glomerata were measured. The results are as Figure 2As shown in the figure, in the abscissa, 'BX01' refers to Dactylis glomerata L. cv. Baoxing stressed for 0 days, 'BX101' refers to Dactylis glomerata L. cv. Baoxing heat stressed for 10 days, 'BX261' refers to Dactylis glomerata L. cv. Baoxing heat stressed for 26 days, '0199801' refers to Dactylis glomerata L. cv. 01998 stressed for 0 days, '01998101' refers to Dactylis glomerata L. cv. 01998 heat stressed for 10 days, and '01998261' refers to Dactylis glomerata L. cv. 01998 heat stressed for 26 days. It can be seen that after 10 days of heat treatment, 13 HSP20 genes in the heat-tolerant material 'Baoxing' Dactylis glomerata L. were up-regulated, and 3 genes (Dg1Hsp20-03, Dg2Hsp20-19, Dg6Hsp20-41) were down-regulated; after 26 days of heat treatment, except for Dg4Hsp20-28, the original 12 up-regulated Hsp20 genes were still up-regulated, and 4 genes (Dg1Hsp20-03, Dg2Hsp20-08, Dg6Hsp20-41, Dg5Hsp20-38) were down-regulated. In the heat-sensitive material '01998' Dactylis glomerata L., 9 Hsp20 genes were up-regulated and 4 Hsp20 genes were down-regulated after 10 days and 26 days of heat treatment. It is worth noting that the expression level of the Dg5Hsp20-30 gene was 0 before heat stress and increased after 10 days and 26 days of heat treatment. At the same time, the genes Dg2Hsp20-13 and Dg5Hsp20-35 were significantly up-regulated after heat stress treatment. The genes Dg1Hsp20-04, Dg4Hsp20-28, Dg5Hsp20-32, and Dg6Hsp20-44 were up-regulated in 'Baoxing' Dactylis glomerata L. but showed no significant difference in '01998' Dactylis glomerata L. These genes may be the key genes for the higher heat tolerance of 'Baoxing' Dactylis glomerata L. compared with '01998' Dactylis glomerata L.

[0059] 2.4.2 Expression profile analysis of Hsp20 genes in Dactylis glomerata L. under drought stress

[0060] The expression profiles of Hsp20 genes in the leaf and root tissues of Dactylis glomerata L. treated for 18 days under drought stress are as follows Figure 3As shown in the figure, in the abscissa, 'CK_L' refers to the expression profile of Dactylis glomerata leaves under CK conditions, 'D18d_L' refers to the expression profile of Dactylis glomerata leaves under drought conditions, 'CK_R' refers to the expression profile of Dactylis glomerata roots under CK conditions, and 'D18d_R' refers to the expression profile of Dactylis glomerata roots under drought conditions. It can be seen that after drought stress treatment, in the leaves, 15 Hsp20s genes were down-regulated, and 5 Hsp20s genes were up-regulated; in the roots, 10 Hsp20s genes were down-regulated, and 12 Hsp20s genes were up-regulated. Dg2Hsp20-17 and Dg0Hsp20-01 were up-regulated in both leaves and roots; Dg5Hsp20-37 was down-regulated in both leaves and roots; Dg2Hsp20-06 was significantly up-regulated in the roots, and this gene showed differential high expression in the roots under normal growth conditions. The Dg2Hsp20-06 gene may mainly play a role in plant root organs. It is worth mentioning that before drought stress treatment, the expression level of the Dg5Hsp20-31 gene was the highest in the roots and the second highest in the leaves, but it hardly expressed in both tissues after stress treatment.

[0061] 2.5 Real-time fluorescence quantitative analysis

[0062] The real-time fluorescence quantitative analysis technology was used to determine the expression of members of the Dactylis glomerata Hsp20s gene family under high temperature, salt and drought stresses. GAPDH was used as an internal reference gene in the real-time fluorescence quantitative PCR reaction. When designing primers, Primer-Premier 5 software was used, and the specificity of the primers was detected by local BLAST. Combining the above bioinformatics analysis and transcriptome data, 8 target genes with significant differences in stress expression were selected for fluorescence quantitative analysis. The qRT-PCR primer sequences of the Dactylis glomerata Hsp20s genes involved are shown in Table 3 below. In the qRT-PCR experiment, a fluorescence quantitative PCR kit (MonAmpTM Green qPCR Mix None ROX, Mona Biotechnology Co., Ltd., Wuhan, China) was used, and the detection system used was the Bio-RAD CFXConnet platform (Bio-Rad Laboratories, Inc. HercμLes, CA, USA). The specific reaction system is shown in Table 4 below, and the reaction procedure is shown in Table 5 below. In the experiment, the 2 -ΔΔCT method was used to measure the relative expression level of genes, and 3 biological replicates and 3 technical replicates were satisfied. Genes with an up- or down-regulation of more than 1.5 times were considered to have significant expression differences.

[0063] Table 3 qRT-PCR primers for candidate genes

[0064]

[0065] Table 4 qRT-PCR reaction system

[0066]

[0067] Table 5 Real-time fluorescence quantitative PCR program

[0068]

[0069] The results of expression profile detection are as Figure 4 shown. The expression profiles of 8 Dactylis glomerata genes under abiotic stress at different time periods (including CK, i.e., 0 h, 2 h, 4 h, 8 h, 12 h, 24 h, 48 h) were analyzed by qRT-PCR to explore their roles under heat stress (a in the figure), salt stress (b in the figure), and drought stress (c in the figure). The 8 screened Dactylis glomerata genes were normalized relative to the internal reference gene (GAPDH). Combining the stress expression profile data, the expressions of DgHsp20-30 and DgHsp20-08 were significantly down-regulated at each stage after PEG-6000 and salt stress treatments. After drought treatment, the down-regulation range of their expressions was between 0.01 - (4 hours of drought) and 0.14-fold (8 hours of drought), and after salt treatment, the down-regulation range of their expressions was between 0.02 (2 and 24 hours of salt) and 0.26-fold (8 hours of salt). The DgHsp20-31 gene was down-regulated at each stage after PEG-6000 treatment. The expressions of DgHsp20-13 and DgHsp20-35 were significantly up-regulated after heat treatment, and were particularly obvious in the early stage of stress (2 - 12 h). The expression level of DgHsp20-13 was 299.2 times that of the CK treatment after 4 hours of heat treatment, and the expression level of DgHsp20-3 was 126.2 times that of the CK treatment after 2 hours of heat treatment. The DgHsp20-03 was significantly up-regulated in the later stage of salt stress (8 - 48 h). Although the transcriptional levels of each gene were analyzed across various different treatments or time points of stress, most of the stress-responsive genes were up-regulated by heat, down-regulated by drought and salt, and mainly responded in the early stage of stress (1 - 12 h).

[0070] II. Functional verification of genes in yeast

[0071] 1 Cloning of target genes, vector construction and transformation of Saccharomyces cerevisiae

[0072] According to the fluorescence quantitative analysis of Hsp20s genes and the previous transcriptome analysis, two genes, DgHSP20-30 and DgHSP20-31, which showed obvious differential expression under drought stress, were selected for gene cloning and further identification. It was found that the CDS sequences of the two genes, DgHSP20-30 and DgHSP20-31, were shown as SEQ ID NO: 21 and SEQ ID NO: 24 respectively. At the same time, specific amplification primers for these two genes were designed. Among them, the nucleotide sequences of the specific primers for identifying DgHsp20-30 were shown as SEQ ID NO: 19 and SEQ ID NO: 20, and the nucleotide sequences of the specific primers for identifying the DgHsp20-31 gene were shown as SEQ ID NO: 22 and SEQ ID NO: 23. To preliminarily explore the functions of DgHsp20-30 and DgHSP20-31 genes in yeast, cloning vectors were constructed using conventional molecular biology construction methods. The nucleotide sequences of the two genes, DgHSP20-30 and DgHSP20-31, shown as SEQ ID NO: 21 and SEQ ID NO: 24 respectively, were inserted into the yeast expression plasmid pYES2 to obtain yeast expression plasmid cloning vectors. The constructed plasmids were transferred into Escherichia coli for plating, and the specific primers corresponding to the above genes were used for identification. The plasmids were extracted from the identified successfully constructed Escherichia coli, and then transferred into yeast competent cells for plating and further verification by colony PCR of yeast monoclonal. The results of colony PCR verification were as Figure 5 shown. In the figure, lane M is the ladder, lanes 1-7 are all the colony PCR samples of the Hsp20-30 vector constructed, lanes 10-15 are the colony PCR samples of the Hsp20-31 vector constructed, and lanes 8 and 9 are empty lanes without loading samples. The successfully identified ones are the prepared Saccharomyces cerevisiae, and the bacteria were stored in a -80 °C refrigerator.

[0073] 2 Stress treatment

[0074] The above-mentioned screened positive yeast transformants were cultured in SC-Ura liquid medium supplemented with 2 mg / mL galactose, and then placed in a shaker at a temperature of 28 °C and a rotation speed of 150 rpm until the appropriate bacterial liquid concentration (OD600≈1.2) was reached. Then, the bacterial liquid was serially diluted 4 times at a 10-fold gradient with sterile distilled water (10 0 、10 -1 、10 -2 、10 -3 、10 -4 times). Finally, 3 μL of the diluted yeast suspension was sequentially added dropwise onto the SD-Ura medium supplemented with 2.0 mol / L sorbitol or 1.0 mol / L NaCl. The petri dish was incubated at 28 °C for 5 d before imaging, and then observed and photographed.

[0075] The gene function was verified by yeast transformation experiments. Yeast transformed with the empty vector, DgHsp20-30, and DgHsp20-31 genes grew normally on YPG medium. The results of the stress resistance function verification of Saccharomyces cerevisiae are as Figure 6 shown. It can be seen that when exposed to salt stress, the growth of yeast containing the empty vector pYES2 decreased, while the cell survival rates of cells transfected with the DgHsp20-30 and DgHsp20-31 genes were higher. The significant difference between the yeast with the empty vector pYES2 and the transgenic yeast observed on the medium containing sorbitol also indicates that the expression of the DgHsp20-30 gene enhanced the drought stress tolerance of Saccharomyces cerevisiae.

[0076] III. Function verification of the HSP20-31 gene in Arabidopsis thaliana

[0077] Research materials: The wild-type Arabidopsis thaliana seeds (Col-0) and Arabidopsis thaliana T-DNA insertion mutant seeds (SALK_056782C / At1g53540) selected in this invention were purchased from the ABRC (Arabidopsis Biological Resource Center) seed bank. Among them, the Arabidopsis thaliana T-DNA insertion mutant seeds are mutants lacking the HSP20-31 gene.

[0078] 1 Identification and stress treatment of Arabidopsis thaliana mutants

[0079] In this invention, the gene function was verified by using the salt stress of the small heat shock homologous Arabidopsis thaliana mutants. In this invention, one-month-old wild-type Arabidopsis thaliana and two mutant Arabidopsis thaliana seedlings were transferred to a stress solution of 1 / 2 Hoagland containing 150 mM NaCl, and the solution containing only 1 / 2 Hoagland was used as a control treatment. After 5 days of treatment, the plant phenotypes were observed and plant physiological measurements were carried out.

[0080] 2 PCR identification of homozygous lines of T-DNA insertion mutants

[0081] To further study the biological function of the DgHsp20-31 gene under abiotic stresses, the present invention identified an Arabidopsis homologous T-DNA insertion mutant atshsp31 (SALK_056782C). The PCR identification of the homozygous mutant lines was performed using the "three-primer method". The following primers were used for PCR identification. In wild-type plants, bands could be amplified using the SALK_056782-LP (hereinafter referred to as LP) and SALK_056782-RP (hereinafter referred to as RP) primers, and no bands could be amplified using the LBb1.3-BP (hereinafter referred to as BP) and RP primers; in homozygous mutant plants, no bands could be amplified using the LP and RP primers, and bands could be amplified using the BP and RP primers; in heterozygous mutant plants, since only one chromosome had a T-DNA insertion, bands could be amplified using both the LP and RP primers and the BP and RP primer pairs.

[0082] Among them, the primer sequences are as follows (5’→3’)

[0083] LP (SEQ ID NO: 25): AGGGCAGAATCTCTGATTTCC

[0084] RP (SEQ ID NO: 26): GATTTACCGGGACTGAGGAAG

[0085] BP (SEQ ID NO: 27): ATTTTGCCGATTTCGGAAC

[0086] The identification results are as Figure 7 shown. Among them, lane M in the figure is the DNA ladder, lane 1 in the figure is the fragment amplified by the LP and RP primers of the wild-type material, lane 2 is the fragment amplified by the BP and RP primers of the wild-type material, lane 3 is the fragment amplified by the LP and RP primers of the mutant material, and lane 4 is the fragment amplified by the BP and RP primers of the mutant material. From the PCR results, it can be known that this mutant is a homozygous mutant line with the DgHsp20-31 gene knocked out.

[0087] 3 Stress treatment and analysis and determination

[0088] Usually, when plants are under stress conditions such as drought and salinity, it will cause damage to the cell membrane. The higher the relative electrical conductivity of the leaves and the content of malondialdehyde, the higher the degree of damage to the cell membrane or the degree of peroxidation, and the more serious the damage to the cell membrane. The level of antioxidant enzyme activity can also reflect the stress resistance of plants. Therefore, the present invention detected the stress resistance of mutant plants by measuring the activities of POD, SOD, and APX and the relative electrical conductivity of the leaves and the content of malondialdehyde before and after salt stress induction.

[0089] After transplanting wild-type (Col-0) Arabidopsis thaliana and the above-mentioned Arabidopsis thaliana defective mutant line atshsp31 for 4 weeks respectively, wild-type and mutant plants with consistent growth vigor were selected and divided into 2 groups. The control group was watered normally with 1 / 2 Hoagland nutrient solution, and the treatment group under high-salt treatment was watered with 1 / 2 Hoagland nutrient solution containing 150 mM NaCl. After one week, their phenotypes were observed and photographed, and samples were taken for determination of physiological indexes. As Figure 8 shown, it can be found that the mutant had more withered and yellow leaves, and its growth vigor was significantly worse than that of the wild type. The number and degree of leaf shrinkage of the plant gradually increased. The yellowing of the mutant's leaves was more serious than that of the wild type Col-0. The growth states of each strain in the non-stressed control group were normal.

[0090] Therefore, the present invention continued the following physiological and biochemical experiments to determine the response of each mutant to salt stress. The whole seedlings of the control group and the salt-stress treatment group were sampled respectively, with 0.1 g sampled for each group. After treatment, they were placed in labeled 2.0 EP tubes and quickly frozen in liquid nitrogen, and stored in a -80 °C refrigerator.

[0091] 3.1 Determination of relative electrical conductivity

[0092] Take about 0.1 g of fresh leaves, with 4 biological replicates. Wrap them with gauze and place them in a 50 mL EP tube, and add 20 mL of pure water to completely soak the leaves. Place them in a light incubator at room temperature. After 24 hours, measure the initial electrical conductivity S1, and then use a sterilizer to completely "kill" the leaves and cool them to room temperature to measure the final electrical conductivity S2. Relative electrical conductivity = S1 / S2 × 100%.

[0093] 3.2 Determination of superoxide dismutase (SOD)

[0094] Enzyme solution extraction: Put the 2.0 EP tube containing 0.1 g of experimental materials (stored in a -80 °C ultra-low temperature refrigerator) on a tissue grinder to grind the tissue until it is broken. Then add 1.5 mL of pre-cooled 150 mM phosphate buffer (pH 7.8, 0.05 mol / L) to the EP tube, centrifuge at 12000 rmp for 20 min at 4 °C, and take the supernatant as the crude enzyme extract.

[0095] Color reaction: Take a clean 2 mL EP tube, write the number, and then add each reagent in sequence according to Table 6 below. After mixing, immediately place it at 25 °C and react under 13000 lux light for 15 - 30 min, and observe the changes. Immediately place it in the dark to terminate the reaction after the reaction ends.

[0096] Enzyme activity determination: Use the No. 2 zero-adjustment tube as a reference to zero-adjust, measure the absorbance value of each reaction solution at a wavelength of 560 nm, record the data, with 3 biological replicates.

[0097] Table 6 SOD determination method

[0098]

[0099] 3.3 Determination of Peroxidase (POD)

[0100] Enzyme solution extraction: The experimental method refers to the process in 3.2 above.

[0101] Prepare the reaction mixture: For a 1.5 mL reaction system, sequentially add 0.925 mL of phosphate buffer (pH 5.5, 0.05 mol / L), 0.5 mL of 0.25% guaiacol (50 mmol / L), and mix well.

[0102] Enzyme activity determination: Take 2 cuvettes with a light path of 1 cm. In one cuvette, add 1.325 mL of the reaction mixture, 0.25 mL of phosphate buffer, and 0.50 mL of 0.75% H 2 O 2 as a blank control, and zero the reference. In the other cuvette, sequentially add 1.325 mL of the reaction mixture, 0.25 mL of the crude enzyme solution, mix well, then add 0.50 mL of 0.75% H 2 O 2 to initiate the reaction,

[0103] Immediately measure the absorbance of each reaction solution at 470 nm, read the value every 10 s for a total of 90 s, record the data, with 3 biological replicates.

[0104] 3.4 Determination of Ascorbate Peroxidase (APX)

[0105] Enzyme solution extraction: The experimental method refers to the process in 3.2 above.

[0106] Prepare the reaction mixture: For a 1.5 mL reaction system, sequentially add 1.375 mL of 100 mM acetic acid - sodium acetate, 25 μL of 0.003 mM EDTA, 25 μL of mM hydrogen peroxide, and 25 μL of 10 mM ascorbic acid, and mix well.

[0107] Enzyme activity determination: Take 2 cuvettes with a light path of 1 cm. In one cuvette, add 1.35 mL of the reaction mixture and 0.5 mL of phosphate buffer as a blank control, and zero the reference. In the other cuvette, sequentially add 1.35 mL of the reaction mixture and 0.5 mL of the crude enzyme solution to initiate the reaction, immediately measure the absorbance of each reaction solution at 290 nm, read the value every 10 s for a total of 90 s, record the data, with 3 biological replicates.

[0108] 3.5 Determination of Malondialdehyde (MDA) Content

[0109] Enzyme solution extraction: The experimental method refers to the process in 3.2 above.

[0110] Enzyme activity assay: Add 1 mL of reaction solution (20% trichloroacetic acid and 0.5% thiobarbituric acid) to 0.5 mL of crude enzyme solution, incubate in a water bath at 95 °C for 30 min, quickly cool to room temperature in an ice bath, and shake the tube to prevent the generation of bubbles. Centrifuge at 12,000 rpm for 10 min, take the supernatant, measure the absorbance at 532 nm and 600 nm, record the data, and perform 3 biological replicates.

[0111] 3.6 Determination of soluble protein

[0112] Take 0.1 mL of crude enzyme solution and add it to 1.5 mL of chromogenic solution, mix thoroughly, and perform a dark reaction for 5 min to ensure sufficient color development. Zero with the extraction buffer and measure the absorbance at 595 nm.

[0113] 3.7 Determination of chlorophyll fluorescence

[0114] After keeping the leaves in the dark for 20 - 30 min, use a Pocket PEA plant chlorophyll fluorescence efficiency meter to measure the maximum photochemical efficiency (Fv / Fm) and photosynthetic performance index (PIABS), and perform 4 biological replicates.

[0115] 3.8 Data processing and result analysis

[0116] The data obtained from the above measurements are expressed as the mean ± standard error (SE) of 3 replicates. One-way ANOVA in SPSS 20 is used to analyze the significant differences in the data, and GraphPad 6.0 is used for graphing.

[0117] The results are as Figure 9 shown. It can be found that compared with the treatment group (NaCl), there are no significant differences in the activities of SOD, POD, and APX in the wild type (WT) and mutant (atshsp31) of the control group (CK), as shown in a - c of Figure 7 respectively. It can be seen that most of the antioxidant enzyme indexes of wild-type and mutant plants have significantly decreased before and after salt treatment, indicating that these plants produce a large amount of antioxidant enzymes to maintain the ROS balance in the plants after stress. In particular, compared with the control group, the activities of SOD and POD in the deletion mutant after salt treatment are significantly lower than those of the wild type, which may indicate that the ability of the mutant plants to produce SOD and POD after stress is inferior to that of the wild type. As Figure 7As shown in d in [reference], it can be seen that the deletion mutant reduces the salt tolerance of Arabidopsis seedlings at the seedling stage, and is less salt-tolerant than the wild type at the Arabidopsis seedling stage. By observing the MDA content after stress, it was found that there was no significant difference in the malondialdehyde content between the mutant and wild-type materials without stress treatment, but the malondialdehyde content of the mutant increased significantly after salt stress (p < 0.05), while the difference in the malondialdehyde content of the wild type was not significant. This indicates that the oxidative damage suffered by the mutant under simulated salt stress is more obvious than that of the wild type. Therefore, the deletion mutant may have a lower salt tolerance than the wild type. As Figure 7 shown in e in [reference], it can be seen that the chlorophyll fluorescence of the two groups of Arabidopsis thaliana did not change significantly before and after salt stress. As Figure 7 As shown in f in [reference], it can be seen that after using NaCl to simulate salt stress, there was no significant change trend in the conductivity of the wild type Col-0 and the deletion mutant (p > 0.05), and it remained at about 0.8. From the measurement results of physiological indexes after salt stress, it can be seen that the stress resistance of the atshsp31 mutant under salt stress is lower than that of the wild-type plants, indicating that the DgHsp20-31 gene plays an important role in the stress resistance of Arabidopsis thaliana.

[0118] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be recognized that the above description should not be considered as a limitation of the present invention. After those skilled in the art have read the above content, various modifications and substitutions of the present invention will be obvious. Therefore, the protection scope of the present invention should be defined by the appended claims.

Claims

1. Heat shock protein genes related to stress resistance, characterized in that, the gene is DgHsp20-30 with a nucleotide sequence as shown in SEQ ID NO: 21 or DgHsp20-31 with a nucleotide sequence as shown in SEQ ID NO:

24.

2. Specific primers for identifying the heat shock protein gene according to claim 1, characterized in that, the nucleotide sequences of the specific primers for identifying DgHsp20-30 are as shown in SEQ ID NO: 19 and SEQ ID NO: 20; the nucleotide sequences of the specific primers for identifying DgHsp20-31 are as shown in SEQ ID NO: 22 and SEQ ID NO:

23.

3. A kit for detecting the heat shock protein gene according to claim 1, characterized in that, the primers in the kit are the specific primers according to claim 2.

4. A cloning vector containing the heat shock protein gene according to claim 1.

5. The cloning vector according to claim 4, characterized in that, the cloning vector is selected as the yeast expression plasmid pYES2.

6. An expression bacterium containing the heat shock protein gene according to claim 1.

7. The application of the heat shock protein gene according to claim 1 in the preparation of stress-resistant yeast, characterized in that, the yeast is Saccharomyces cerevisiae, and the stress resistance is resistance to sorbitol or NaCl stress.

Images