Nanobody Nb7 and its encoding gene, recombinant vector, recombinant strain, microbial agent, and their applications
By developing nanoantibodies Nb7 and their encoding genes and recombinant strains, the probiotic E. coli Nissle1917 was used to colonize in the intestine, and the screening and delivery of nanoantibodies in the prevention and treatment of blue ear disease of pigs was solved, achieving efficient and economical viral neutralization effects, especially suitable for postpartum care of sows.
Patent Information
- Application Number
- CN202211493717.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-25
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2042-11-25
AI Technical Summary
In the prior art, nano-antibodies are limited in preventing and treating pig reproductive and respiratory syndrome virus (PRRSV), screening is limited, delivery mode is inconvenient, and the efficacy duration is not ideal.
A nanoantibody Nb7 and its encoding genes, recombinant vectors and recombinant strains were developed. The probiotic E. coli Nissle1917 was used to colonize the intestines, and the nanoantibody Nb7 was delivered through probiotics to achieve neutralization of the PRRSV virus and prevent the virus from invading the body.
The nano-antibody Nb7 is effectively prevented and treated with blue ear disease, especially suitable for postpartum care of sows, improving the duration of efficacy and delivery efficiency.
Smart Images

Figure CN116143911B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical engineering technology, and particularly relates to a nanobody Nb7, its encoding gene, recombinant vector, recombinant strain, bacterial agent, and their applications. Background Art
[0002] Porcine reproductive and respiratory syndrome (PRRS), also known as "porcine reproductive and respiratory syndrome (PRRS)", is an animal disease with respiratory symptoms and reproductive disorders caused by porcine reproductive and respiratory syndrome virus (PRRSV). Infected pigs will show a transient symptom of blue-purple ears, and it will lead to consequences such as abortion, weak piglets, and dyspnea. Pigs of different ages, breeds, and genders are all susceptible to PRRSV, among which piglets and pregnant sows are the susceptible targets. The comprehensive mortality rate of acute-onset sows and piglets is more than 40%, which has caused great economic losses to the pig industry in China.
[0003] Animals infected with PRRSV, including diseased pigs and virus-carrying pigs, are the main sources of infection of this disease. Most PRRSV is transmitted through contact, and the respiratory tract is the main infection route of the virus. At the same time, it can also be transmitted through vertical transmission. At present, various methods have been taken to control PRRSV infection in farms, including detecting PRRSV in boar semen and replacement gilts, removing animals with positive serum reactions, reducing and refilling the herd, and closing the herd, etc. However, controlling and eliminating PRRSV in a large area is much more complicated, and the above-mentioned means are cumbersome to operate and have low efficiency. Therefore, there is an urgent need for effective methods to prevent and control PRRSV.
[0004] Nanobodies have a small molecular weight, strong specificity and affinity, and flexibility comparable to monoclonal antibodies, and can be highly expressed through a bacterial expression system, that is, the preparation process is simple and the cost is low. Therefore, they have been widely used in the treatment of infectious diseases. However, the screening and delivery methods of nanobodies are inconvenient, and the duration of drug efficacy is not ideal, which limits their application and development in the prevention and treatment of PRRSV. Summary of the Invention
[0005] The purpose of the present invention is to overcome the problems in the prior art that the screening of PRRSV nanobodies is limited, the delivery method is inconvenient, and the duration of drug efficacy is not ideal, and to provide a nanobody Nb7, its encoding gene, recombinant vector, recombinant strain, bacterial agent, and their applications. This nanobody can specifically bind to porcine reproductive and respiratory syndrome virus (PRRSV) and has good neutralizing activity against PRRSV.
[0006] To achieve the above object, a first aspect of the present invention provides a nanobody Nb7, which comprises:
[0007] (1) A protein having the amino acid sequence shown in SEQ ID NO: 1;
[0008] (2) A derivative protein obtained by modifying the protein having the amino acid sequence shown in SEQ ID NO: 1 and having the same activity as before the modification.
[0009] Preferably, the modification includes:
[0010] i. Performing at least one of substitution, deletion, and addition of one or several amino acid residues in the amino acid sequence shown in SEQ ID NO: 1; and / or
[0011] ii. Connecting a tag facilitating purification at the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO: 1; and / or
[0012] iii. Connecting a signal peptide sequence beneficial to protein secretion and expression at the amino terminus of the amino acid sequence shown in SEQ ID NO: 1.
[0013] Preferably, the tag facilitating purification is selected from at least one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc, and more preferably Poly-His.
[0014] Preferably, the signal peptide sequence is pelB.
[0015] A second aspect of the present invention provides a gene encoding a nanobody, which has a nucleotide sequence encoding the aforementioned nanobody Nb7.
[0016] Preferably, the gene has a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1.
[0017] Preferably, the gene has the nucleotide sequence shown in SEQ ID NO: 2.
[0018] A third aspect of the present invention provides a recombinant vector, which contains the aforementioned gene.
[0019] Preferably, the expression vector of the recombinant vector is a pTrc99a vector.
[0020] A fourth aspect of the present invention provides a recombinant strain, which contains the aforementioned gene or the aforementioned recombinant vector.
[0021] Preferably, the recombinant strain is selected from at least one of Escherichia coli, yeast, lactic acid bacteria, and Bacillus subtilis.
[0022] More preferably, the recombinant strain is Escherichia coli Nissle1917.
[0023] The fifth aspect of the present invention provides a bacterial agent, which contains the aforementioned recombinant strain.
[0024] Preferably, the bacterial agent is a liquid bacterial agent and / or a solid bacterial agent.
[0025] The sixth aspect of the present invention provides the use of the aforementioned nanobody Nb7, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain, or the aforementioned bacterial agent in the preparation of a drug for preventing and / or treating porcine reproductive and respiratory syndrome.
[0026] By the above technical solution, the beneficial effects of the present invention are as follows:
[0027] The present invention provides a nanobody Nb7 constructed by molecular biology methods. After experimental verification, it can specifically bind to porcine reproductive and respiratory syndrome virus (PRRSV) and has good neutralizing activity against PRRSV virus. This indicates that the nanobody can be used alone or in combination with other antibodies as an active component to play a role in preventing and treating PRRSV virus.
[0028] The present invention further provides a recombinant strain, which is obtained by using the probiotic Escherichia coli Nissle1917 as the starting strain and transforming it with a recombinant vector containing the nanobody Nb7 provided by the present invention. By colonizing the probiotic in the intestine, nanobody Nb7 can be continuously generated in the body to neutralize the target virus, achieving the effect of delivering the nanobody into the pig's body based on the probiotic to prevent porcine reproductive and respiratory syndrome, and there will be no problem that the dose of the nanobody is too low, too high, or the residence time is too short to play a role; due to the adhesion of the probiotic, it can establish the first line of defense at the mucosal invasion point to prevent PRRSV virus from invading the body, effectively solving the problems of inconvenient administration of ordinary vaccines and unsatisfactory duration of drug efficacy.
[0029] The nanobody Nb7 provided by the present invention and the recombinant strain containing the nanobody are expected to be applied to the simple, efficient, and inexpensive production of vaccines or specific drugs for porcine reproductive and respiratory syndrome, which can serve the majority of farmers, enhance the rural economy, and have important economic and social significance. Description of the Drawings
[0030] Figure 1 It is the agarose gel electrophoresis analysis diagram of the target fragment Nb7 in Example 1;
[0031] Figure 2 It is the map of the recombinant vector pTrc99a-Nb7 in Example 1;
[0032] Figure 3 It is the verification analysis diagram of agarose gel electrophoresis of the recombinant vector pTrc99a-Nb7 of a single colony in Example 2;
[0033] Figure 4 It is the SDS-PAGE gel diagram of the Nb7 protein expressed by the recombinant strain pTrc99a-Nb7-Nissle1917 in Example 2, where M is the marker, 1 is the blank supernatant of Escherichia coli Nissle 1917, 2 is the blank precipitate of Escherichia coli Nissle 1917, 3 is the broken supernatant of the recombinant strain pTrc99a-Nb7-Nissle1917, and 4 is the broken precipitate of the recombinant strain pTrc99a-Nb7-Nissle1917;
[0034] Figure 5 It is the WB diagram of the Nb7 protein expressed by the recombinant strain pTrc99a-Nb7-Nissle1917 in Example 2, where M is the marker, 1 is the blank supernatant of Escherichia coli Nissle 1917, 2 is the blank precipitate of Escherichia coli Nissle 1917, 3 is the broken supernatant of the recombinant strain pTrc99a-Nb7-Nissle1917, and 4 is the broken precipitate of the recombinant strain pTrc99a-Nb7-Nissle1917. Detailed implementation mode
[0035] The endpoints and any values within the ranges disclosed herein are not limited to the exact ranges or values. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the values between the endpoints of each range, between the endpoints of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.
[0036] The first aspect of the present invention provides a nanobody Nb7, and the antibody includes:
[0037] (1) A protein with the amino acid sequence shown in SEQ ID NO: 1;
[0038] (2) A derivative protein obtained by modifying the protein with the amino acid sequence shown in SEQ ID NO: 1 and having the same activity as before the modification.
[0039] The nanobody Nb7 provided by the present invention can be a derivative protein obtained by modifying the above protein (1) in any existing manner in the art under the condition of the same activity. There are no specific limitations on its modification method and the specific sequence and characteristics of the modified derivative protein.
[0040] According to a preferred embodiment of the present invention, the modification may include:
[0041] i. performing at least one of substitution, deletion, and addition on one or several amino acid residues in the amino acid sequence shown in SEQ ID NO:1; and / or
[0042] ii. connecting a tag facilitating purification to the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO:1; and / or
[0043] Connecting a signal peptide sequence beneficial for protein secretion and expression to the amino terminus of the amino acid sequence shown in SEQ ID NO:1.
[0044] The nanobody Nb7 provided by the present invention can be obtained by treating the amino acid sequence shown in SEQ ID NO:1 with any one or a combination of several of the above modification methods i, ii, and iii, as long as the modified derivative protein has the same activity as the amino acid sequence shown in SEQ ID NO:1.
[0045] Any existing tag in the art that can facilitate protein purification can be applicable to the nanobody Nb7 provided by the present invention. Preferably, the tag facilitating purification is selected from at least one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc. There is no particular limitation on the specific amino acid sequence of the above tags. For example, it can be the sequences shown in Table 1 below.
[0046] Table 1 Sequences of tags facilitating purification
[0047]
[0048]
[0049] * Poly-Arg can be composed of 5-6 arginine residues. Only the Poly-Arg tag composed of 5 arginine residues commonly used is listed in Table 1, but the Poly-Arg tag composed of 6 arginine residues is also applicable to the present invention.
[0050] ** Poly-His can be composed of 2-10 histidine residues. Only the Poly-His tag composed of 6 histidine residues commonly used is listed in Table 1, but the Poly-His tags composed of 2-10 histidines are all applicable to the present invention.
[0051] Any signal peptide sequence existing in the art that can facilitate protein secretion and expression can be applied to the nanobody Nb7 provided by the present invention. Preferably, the signal peptide sequence selects pelB (the nucleotide sequence is shown in SEQ ID NO: 14) as the secretion and expression signal peptide;
[0052] pelB (SEQ ID NO: 14):
[0053] ggccatcgccggctgggcagcgaggagcagcagaccagcagcagcggtcggcagcaggtatttcat.
[0054] The second aspect of the present invention provides a gene encoding a nanobody, and this gene has a nucleotide sequence encoding the aforementioned nanobody Nb7.
[0055] In the present invention, any gene that can encode the nanobody Nb7 as described above belongs to the content of the present invention. Preferably, the gene has a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1.
[0056] According to the present invention, preferably, the gene has the nucleotide sequence shown in SEQ ID NO: 2. In the present invention, the gene may only contain the sequence shown in SEQ ID NO: 2, or may be a DNA molecule with the sequence shown in SEQ ID NO: 2 as the coding region and additionally adding other components. The other components may include any components required in the art for artificially synthesizing gene sequences and expressing them through expression vectors, such as promoters, enhancers, Kozak sequences, etc.
[0057] The nucleotide sequence provided by the present invention can usually be obtained by polymerase chain reaction (PCR) amplification method, recombination method, or artificial synthesis method. For example, those skilled in the art can easily obtain templates and primers according to the nucleotide sequence provided by the present invention and use PCR to amplify the relevant sequence. Once the relevant nucleotide sequence is obtained, the relevant amino acid sequence can be obtained in large quantities by the recombination method. Usually, the obtained nucleotide sequence is cloned into a vector, then transferred into a genetically engineered bacterium, and then the relevant nucleotide sequence is separated from the proliferated host cells by conventional methods.
[0058] In addition, the relevant nucleotide sequence can also be synthesized by the well-known artificial chemical synthesis method.
[0059] Exemplarily, the preparation method of the nanobody Nb7 of the present invention may specifically include: introducing a recombinant vector containing the gene as described above into a host cell, and expressing to obtain the nanobody Nb7. Any recombinant vector capable of inserting the above gene and expressing the nanobody Nb7 in a host cell in the art can be applicable to the present invention. Preferably, the recombinant vector is a pTrc99a vector.
[0060] In the present invention, any host cell for expressing exogenous genes in the art can be applicable to the present invention. Preferably, the host cell is selected from at least one of Escherichia coli, yeast, lactic acid bacteria, and Bacillus subtilis; more preferably Escherichia coli; and further preferably Escherichia coli Nissle1917.
[0061] In the present invention, the preparation method of the nanobody Nb7 further includes a process of purifying the expressed nanobody Nb7. Any method for purifying exogenous proteins expressed by host cells in the art can be applicable to the present invention. For example, purification can be carried out by using a tag (such as the tags in Table 1) carried in the vector or the nanobody Nb7 that facilitates purification.
[0062] The third aspect of the present invention provides a recombinant vector, and the recombinant vector contains the aforementioned gene.
[0063] In the present invention, the "vector" used in the recombinant vector can be selected from various vectors known in the art, such as various commercially available plasmids, cosmids, phages, and retroviruses, etc. The preferred expression vector of the present invention is a pTrc99a vector. The construction of the recombinant vector can be carried out by using various endonucleases capable of having a cleavage site at the multiple cloning site of the vector (for example, for the pTrc99a vector, Sal I, Nco I, etc.) to digest to obtain a linear plasmid, and ligating with a gene fragment digested with the same endonuclease to obtain a recombinant plasmid. The present invention preferably uses double digestion of the pTrc99a vector and the gene fragment ligated thereto with Sal I and Nco I, and ligates with a ligase to construct the recombinant vector pTrc99a-Nb7.
[0064] The fourth aspect of the present invention provides a recombinant strain, and the recombinant strain contains the aforementioned gene or the aforementioned recombinant vector.
[0065] The recombinant vector of the present invention can be transformed, transduced or transfected into a host cell (strain) by conventional methods in the art. In the present invention, the host cell is any probiotic that can grow in an animal body and is beneficial to the body, preferably at least one of Escherichia coli, Saccharomyces, Lacticacid bacteria, and Bacillus subtilis, and more preferably, the host cell is Escherichia coli, and more preferably Escherichia coli Nissle1917 (abbreviated as EcN).
[0066] When the probiotic Escherichia coli Nissle1917 is used as the starting strain in the present invention, a recombinant strain is obtained by transforming it with the recombinant vector containing the nanobody Nb7 provided by the present invention. The probiotic colonizes in the intestine, so that the nanobody Nb7 can be continuously generated in the body, neutralize the target virus, and realize the delivery of the nanobody into the body of pigs based on the probiotic, so as to prevent and / or treat porcine reproductive and respiratory syndrome (PRRS), and there will be no situation where the dose of the nanobody is too low, too high or the residence time is too short to play a role; due to the adhesion of the probiotic, it can establish a first line of defense at the mucosal invasion point, prevent the PRRSV virus from invading the body, and effectively prevent the infection of PRRS, especially suitable for postpartum care of sows.
[0067] The fifth aspect of the present invention provides a bacterial agent, which contains the aforementioned recombinant strain.
[0068] In the present invention, the bacterial agent can exist in liquid form or solid form. The bacterial agent can contain excipients conventionally added in the preparation of bacterial agents in the art, and those skilled in the art can select according to needs. Preferably, relative to each gram of the bacterial agent, the content of the recombinant strain is 10 5 -10 10 CFU, and more preferably 10 7 -10 9 CFU.
[0069] The sixth aspect of the present invention provides the application of the aforementioned nanobody Nb7, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain or the aforementioned bacterial agent in the preparation of a drug for preventing and / or treating porcine reproductive and respiratory syndrome.
[0070] In the present invention, the drug for preventing and / or treating porcine reproductive and respiratory syndrome (PRRS) can be a vaccine or a therapeutic drug, especially suitable for postpartum care of sows to prevent PRRS infection. Preferably, the drug further comprises a pharmaceutically acceptable excipient, and the excipient can be any excipient currently available in the art for drug preparation, as long as the excipient does not affect the functions and effects of the active ingredient (i.e., the nanobody Nb7, gene, recombinant vector or recombinant strain as described above).
[0071] The drug can use only the nanobody Nb7 (gene, recombinant vector or recombinant strain) as described above as the active ingredient, or it can be used in combination with other antibodies (or drug components) as the active ingredient. The other antibodies (or drug components) can be any antibodies (or drug components) against PRRSV virus in the art, any antibodies (or drug components) that can regulate the function of the aforementioned nanobody Nb7 in the art, or antibodies (or drug components) related to the prevention and treatment of derivative diseases associated with PRRSV virus.
[0072] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to exemplarily explain and illustrate the content of the present invention, and are not used to limit the scope of the present invention.
[0073] In the following examples, the gene fragments used were all synthesized by Beijing Tsingke Biotechnology Co., Ltd. Without special instructions, the reagents used were all purchased from regular chemical or biological reagent suppliers, and the purity was analytical pure.
[0074] In the following examples, the preparation process of 0.1M CaCl2 solution is as follows: Take 11.1 g of calcium chloride, add 1 L of ddH2O, and sterilize it by autoclaving at 121 °C for 20 min with moist heat;
[0075] The preparation process of 0.1M CaCl2 + 10% glycerol solution is as follows: Take 11.1 g of calcium chloride and 100 mL of glycerol, add 1 L of ddH2O, and sterilize it by autoclaving at 121 °C for 20 min with moist heat under high temperature and high pressure;
[0076] The preparation process of LB liquid medium is as follows: Add 10 g of tryptone, 10 g of sodium chloride and 5 g of yeast extract into 1 L of ddH2O, and sterilize it by autoclaving at 121 °C for 20 min with moist heat;
[0077] The preparation process of LB solid medium is as follows: Add 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract and 17.5 g of agar into 1 L of ddH2O, and sterilize it by autoclaving at 121 °C for 20 min with moist heat.
[0078] Example 1
[0079] This example is used to illustrate the acquisition of the recombinant vector pTrc99a-Nb7
[0080] 1. Primer design
[0081] The inventors designed the nucleotide sequence shown in SEQ ID NO:2 as the coding gene for the nanobody Nb7 (the nucleotide sequence is shown in SEQ ID NO:1). According to the nucleotide sequence of Nb7, the specific primer pair Nb7-F (the nucleotide sequence is shown in SEQ ID NO:3) and Nb7-R (the nucleotide sequence is shown in SEQ ID NO:4) was designed and synthesized using Snapgene software, and was synthesized and identified by Beijing Tsingke Biotechnology Co., Ltd.;
[0082] Nb7-F (SEQ ID NO:3): GGTAACCTGGGTACCCTGAC, Nb7-R (SEQ ID NO:4): CTACAGTTGGATCCGGCCCA
[0083] 2. Construction of the recombinant vector pTrc99a-Nb7
[0084] (1) Using the primer pair Nb7-F and Nb7-R, and the Nb7-PET28a plasmid sequence (the nucleotide sequence is shown in SEQ ID NO:13) screened out in the previous work as the DNA template, PCR amplification was carried out. The PCR reaction system was: Premix (25 μl), ddH2O (22 μl), upstream and downstream primers (1 μl each), DNA template (1 μl); The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min, 1 cycle; The PCR product was analyzed by agarose gel electrophoresis, and the result was as Figure 2 shown, and the target fragment Nb7 (411 bp) was recovered by cutting the gel;
[0085] (2) Sal I and Nco I (both purchased from TAKARA, the product numbers are 1636 and 1620 respectively) were used to double-digest the target fragment Nb7 and the pTrc99a vector (preserved and provided by the laboratory of Professor Huang He of Nanjing Normal University), and the digested products were ligated (the ligation reaction system was: vector 1 μl, recovered fragment 5 μl, T4 DNA ligase (TAKARA) 1 μl, 10*Buffer 1 μl, ddH2O 2 μl, and the ligation reaction conditions were 16°C for 16 h), and the recombinant vector pTrc99a-Nb7 (the nucleotide sequence is shown in SEQID NO:7) was obtained, and its map was as Figure 1 shown
[0086] (3) Transformation verification of the recombinant plasmid pTrc99a-Nb7
[0087] The preserved glycerol strain of Escherichia coli DH5α (purchased from Tsingke Biotechnology Co., Ltd., with the catalog number TSC-C14) was inoculated into 2 mL of LB liquid medium at an inoculation amount of 1% by volume and cultured at 37 °C and 220 rpm for 12 h to obtain culture I; the obtained culture I was inoculated into 100 mL of LB liquid medium at an inoculation amount of 1% by volume and cultured at 37 °C for 2 h until OD = 0.6 - 0.7 to obtain bacterial liquid I; the bacterial liquid I was aliquoted into 50 mL centrifuge tubes, placed on ice and cooled and allowed to stand for 30 min to stop the growth of the bacteria, centrifuged at 4000 rpm for 10 min in a 4 °C centrifuge, the supernatant was discarded, and the bacterial cell pellet I was collected; 30 mL of pre-cooled 0.1 M CaCl2 solution was added to the centrifuge tube to resuspend the bacterial cell pellet I, centrifuged at 4 °C and 4000 r / min for 10 min, the supernatant was poured off, and the bacterial cell pellet II was collected; 50 mL of 0.1 M CaCl2 solution was added to the centrifuge tube, the pellet was gently pipetted and mixed evenly, allowed to stand on ice for 30 min, centrifuged at 4 °C and 4000 r / min for 10 min, the supernatant was poured off, and the bacterial cell pellet III was collected; 1% pre-cooled 0.1 M CaCl2 + 10% glycerol solution was added to the centrifuge tube, the pellet was gently pipetted and mixed evenly, and aliquoted at 100 μL per tube to obtain competent cells DH5α, which were stored at -80 °C for later use;
[0088] The DH5α competent cells and the recombinant vector pTrc99a-Nb7 were melted on ice respectively, gently shaken to mix the internal cells evenly, then 10 μL of the above recombinant vector pTrc99a-Nb7 was added to the competent cells DH5α, gently mixed, and then allowed to stand in an ice bath for 30 min; the above mixture was heat-shocked in a 42 °C water bath for 90 s, and then quickly transferred to an ice bath and allowed to stand for 3 min, noting that the centrifuge tube should not be shaken during this process; 1 mL of the pre-prepared sterile and antibiotic-free LB liquid medium was added to the centrifuge tube, and cultured with shaking at 220 rpm in a 37 °C shaker for 50 min to resuscitate the bacteria; after centrifuging at 3000 rpm for 3 min, 1 mL of the supernatant was removed, and the remaining bacterial cell pellet was pipetted and mixed evenly and spread on the LB solid medium plate, and incubated overnight in a 37 °C incubator to grow light white single colonies;
[0089] Pick a certain number of single colonies and use the specific primer pairs Nb7-pTrc99a-Test-F (nucleotide sequence as shown in SEQ ID NO: 5) and Nb7-pTrc99a-Test-R (nucleotide sequence as shown in SEQ ID NO: 6) to perform PCR identification on them (the PCR system is shown in Table 2). The reaction conditions are: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 1 cycle. Analyze the results of the PCR products by agarose gel electrophoresis. The appearance of a band around 650 bp indicates that the recombinant vector pTrc99a-Nb7 has been successfully transferred into the Escherichia coli Dh5α strain.
[0090] Nb7-pTrc99a-Test-F (SEQ ID NO: 5): CTGCGCGGCGAGCGGCTTTAC, Nb7-pTrc99a-Test-R (SEQ ID NO: 6): CTGCTTAATTTGATGCCTGGC;
[0091] Table 2
[0092]
[0093] (4) Extraction of the recombinant plasmid pTrc99a-Nb7
[0094] Inoculate the verified single colonies into 6 mL of LB liquid medium containing 100 μg / mL of ampicillin and culture them overnight at 37°C on a shaker at 220 rpm for about 12 - 16 h. Use a plasmid miniprep kit (purchased from Axygen, product number AP-MN-P-50) to extract the plasmid pTrc99a-Nb7 from the bacterial solution to obtain the recombinant plasmid pTrc99a-Nb7.
[0095] Example 2
[0096] This example is used to illustrate the acquisition of the recombinant strain pTrc99a-Nb7-Nissle1917.
[0097] (1) Take the glycerol stock strain of Escherichia coli Nissle 1917 (preserved and provided by the laboratory of Professor Huang He at Nanjing Normal University) and inoculate it into 2 mL of LB liquid medium at an inoculation amount of 1% by volume. Incubate at 37 °C and 220 rpm for 12 h to obtain culture II; inoculate the obtained culture II into 100 mL of LB liquid medium at an inoculation amount of 1% by volume and incubate at 37 °C for 2 h until OD = 0.6 - 0.7 to obtain bacterial liquid II; aliquot bacterial liquid II into 50 mL centrifuge tubes, place on ice and cool and let stand for 30 min to stop the growth of the bacteria, centrifuge at 4000 rpm for 10 min in a 4 °C centrifuge, discard the supernatant, and collect the bacterial cell pellet IV; add 30 mL of pre-cooled 0.1 M CaCl2 solution to the centrifuge tube respectively to resuspend the bacterial cell pellet IV, centrifuge at 4 °C and 4000 r / min for 10 min, pour out the supernatant, and collect the bacterial cell pellet V; add 50 mL of 0.1 M CaCl2 solution to the centrifuge tube respectively, gently pipette to mix the pellet evenly, let stand on ice for 30 min, centrifuge at 4 °C and 4000 r / min for 10 min, pour out the supernatant, and collect the bacterial cell pellet VI; add 1% pre-cooled 0.1 M CaCl2 + 10% glycerol solution to the centrifuge tube, gently pipette to mix the pellet evenly, aliquot at 100 μL per tube to obtain Nissle 1917 competent cells, and store at -80 °C for later use;
[0098] (2) Melt the Nissle 1917 competent cells and the recombinant plasmid pTrc99a-Nb7 obtained in Example 1 on ice respectively, gently shake to mix the internal cells evenly, then add 10 μL of the recombinant plasmid pTrc99a-Nb7 to the Nissle 1917 competent cells, gently mix, and let stand in an ice bath for 30 min; place the above mixture in a 42 °C water bath for heat shock for 90 s, and then quickly transfer it to an ice bath and let stand for 3 min, note that the centrifuge tube should not be shaken during this process; add 1 mL of the previously prepared sterile and antibiotic-free LB liquid medium to the centrifuge tube, incubate at 37 °C on a shaker at 220 rpm for 50 min to resuscitate the bacteria; after centrifuging at 3000 rpm for 3 min, remove 1 mL of the supernatant, pipette the remaining bacterial cell pellet evenly and spread it on the LB solid medium plate, and incubate in a 37 °C incubator overnight to grow light white single colonies;
[0099] (3) Pick a certain number of single colonies and use the specific primer pairs Nb7-pTrc99a-Test-F (nucleotide sequence as shown in SEQ ID NO: 5) and Nb7-pTrc99a-Test-R (nucleotide sequence as shown in SEQ ID NO: 6) to perform PCR identification on them (the PCR system is shown in Table 2). The reaction conditions are: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 1 cycle. The PCR products are subjected to agarose gel electrophoresis. The analysis results are as Figure 3 shown. A band of about 650 bp appears, indicating that the recombinant vector pTrc99a-Nb7 has been successfully transferred into Escherichia coli Nissle 1917, and the recombinant strain pTrc99a-Nb7-Nissle1917 is obtained.
[0100] (4) Induced expression of Nb7 protein in the recombinant strain pTrc99a-Nb7-Nissle1917
[0101] Inoculate the recombinant strain pTrc99a-Nb7-Nissle1917 screened in step (3) into an LB liquid medium containing 100 μg / mL ampicillin, and culture it at 37°C and a rotation speed of 220 rpm for 12 h to obtain a freshly cultured recombinant strain pTrc99a-Nb7-Nissle1917 bacterial solution. Inoculate the bacterial solution into 100 mL of LB liquid medium and culture it in a shaker at 37°C. When OD = 0.6 - 0.8, add 0.8 M IPTG as an inducer and perform low-temperature induction culture in a shaker at 22°C for 24 h to obtain an induced expression bacterial solution; centrifuge the induced expression bacterial solution at 8000 rpm in a 4°C centrifuge to remove the supernatant. The bacterial cell precipitate is washed and resuspended twice with PBS buffer and then centrifuged to separate the lysed supernatant and the lysed precipitate; add 30 μL of the lysed supernatant and 30 μL of the lysed precipitate (resuspended with an equal amount of PBS) to 10 μL of 4X protein loading buffer (purchased from Solarbio Science & Technology Co., Ltd., product number P1015) respectively, perform boiling denaturation, and then perform SDS-PAGE protein gel electrophoresis to confirm whether there are corresponding protein bands. The results are as Figure 4 shown (wherein, the Marker is purchased from Sangon Biotech (Shanghai) Co., Ltd., number C610011-0250). Figure 4 The box mark in
[0102] (5) Verify the band of the target protein gel by Western Blot
[0103] Inoculate the freshly cultured recombinant strain pTrc99a-Nb7-Nissle1917 bacterial solution into 100 mL of LB liquid medium and culture it in a shaker at 37 °C for 24 h; centrifuge the bacterial solution at 8000 rpm in a 4 °C centrifuge to remove the supernatant, resuspend the bacterial pellet twice with PBS buffer by pipetting and then centrifuge again to separate the disrupted supernatant and disrupted pellet; add 30 μL of the disrupted supernatant and 30 μL of the disrupted pellet (resuspended with an equal volume of PBS) to 10 μL of 4X protein loading buffer (purchased from Solarbio Science & Technology Co., Ltd., product number P1015), perform boiling denaturation and then centrifuge to take the supernatant for SDS-PAGE protein gel electrophoresis; after the electrophoresis is completed, cut the protein gel according to the required size and soak it in the electrophoresis transfer buffer for 20 min, select a suitable polyvinylidene fluoride membrane (PVDF membrane) and double-layer filter paper according to the size of the protein gel, immerse the PVDF membrane in fresh methanol for activation, transfer it to the electrophoresis transfer buffer for soaking after 30 s of activation, and at the same time soak the filter paper and sponge in the transfer solution in advance. Stack the PVDF membrane, protein gel and double-layer filter paper to form a sandwich structure, remove the air bubbles between them with a roller, assemble the transfer system in accordance with the Tianneng transfer electrophoresis cell instruction manual, set the electrophoresis instrument to a constant current of 100 mA and perform electrophoresis for 1 h; after the transfer is completed, place the PVDF membrane in 5% skim milk powder and block it at room temperature for 1 h. After blocking, wash the PVDF membrane twice with PBST buffer, 5 min each time. Dilute the rabbit anti-His tag monoclonal antibody at a ratio of 1:1000, place the PVDF membrane in the antibody dilution solution and incubate it overnight in a 4 °C refrigerator; after the incubation with the primary antibody is completed, wash the PVDF membrane twice with PBST buffer, 5 min each time; dilute the HRP-labeled goat anti-rabbit monoclonal antibody at a ratio of 1:5000, place the PVDF membrane in the antibody dilution solution and incubate it in a 25 °C constant temperature shaker for 1 h; after the incubation with the secondary antibody is completed, wash the PVDF membrane twice with neutral PBS buffer containing 0.05% Tween 20 (PBST), 5 min each time; place the PVDF membrane in the ECL hypersensitive luminescent solution for 60 s for color development, and then use a gel imaging system to take an image. The results are as Figure 5 shown (wherein, the Marker was purchased from Shanghai Beyotime Biotechnology Co., Ltd., product number p0075), thereby confirming the successful expression of the nanobody Nb7 in the recombinant strain pTrc99a-Nb7-Nissle1917.
[0104] Example 3
[0105] 1. Verify the effectiveness of the purified antibody protein by ELISA (enzyme-linked immunosorbent assay)
[0106] Qualitative verification of the antibody binding effectiveness was carried out using the Porcine Porcine reproductive and respiratory syndrome virus antibody (PDCOV-Ab) ELISA detection kit (brand number YX-PG-L12365) produced by Shanghai Yuanxin Biotechnology Co., Ltd.:
[0107] Take out the required strips from the aluminum foil bag after equilibration at room temperature; set up negative control wells, positive control wells and sample wells. Add 50 μL of negative control and positive control in the ELISA detection kit to the negative control wells and positive control wells respectively. Do three parallel sets for both negative and positive samples; first add 10 μL of the sample to be tested (i.e., the target protein Nb7) to the sample wells to be tested, and then add 40 μL of the sample diluent in the ELISA detection kit. Take the concentration of this target protein Nb7 as gradient 1, and set three gradients of sample gradients 1, 0.5, and 0.25, each doing three parallel sets; then add 100 μL of the detection antigen labeled with horseradish peroxidase (HRP) to each well of the negative control wells, positive control wells and sample wells. Seal the reaction wells with a sealing film and incubate in a 37°C water bath or incubator for 60 min; discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1 min, discard the washing solution, pat dry on absorbent paper, and repeat the washing of the plate 5 times like this; add 50 μL of chromogenic substrate A and B to each well, and incubate at 37°C in the dark for 15 min; add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 min. The results are shown in Table 3.
[0108] Evaluation of test effectiveness: The average OD value of the positive control wells ≥ 1.00;
[0109] The average OD value of the negative control wells ≤ 0.15;
[0110] Calculation of the cut-off value: Cut-off value = average value of negative control wells + 0.15;
[0111] Negative judgment: If the OD value of the sample < cut-off value, the sample is negative;
[0112] Positive judgment: If the OD value of the sample > cut-off value, the sample is positive.
[0113] Table 3
[0114] Parallel 1 Parallel 2 Parallel 3 Mean Positive control 3.599 3.342 3.412 3.451 Negative control 0.062 0.058 0.042 0.054 Sample gradient 1 1.228 1.313 1.244 1.262 Sample gradient 0.5 1.124 1.254 1.189 1.189 Sample gradient 0.25 1.121 1.14 1.177 1.146
[0115] According to the data in Table 3, the average OD value of the positive control wells is 3.451, which is greater than 1.00, and the average OD value of the negative control wells is 0.054, which is less than 0.15. The experiment is valid; among them, the cut-off value is 0.3, and the average OD values of each sample gradient are all greater than 0.3, indicating that the antibody of the target protein Nb7 has good immunogenicity and binding ability to porcine reproductive and respiratory syndrome virus.
[0116] 2. Perform MTT toxicity test on porcine intestinal epithelial cells IPEC-J2 with the recombinant strain pTrc99a-Nb7-Nissle1917
[0117] Take out the stored IPEC-J2 cells (preserved and provided by the laboratory of Professor He Huang of Nanjing Normal University) from liquid nitrogen for cell resuscitation. Take out the cryopreservation tube from the liquid nitrogen container and directly immerse it in warm water at 37°C, and shake it from time to time to make it melt as soon as possible; take out the cryopreservation tube from the 37°C water bath, open the lid, suck out the cell suspension with a pipette, add it to a centrifuge tube and add more than 10 times the culture medium, and mix well; centrifuge at a speed of 1000 rpm for 4 min; discard the supernatant, add DMEM-F12 culture medium containing 10% calf serum to resuspend the cells (calf serum is purchased from Zhejiang Tianhang Biotechnology Co., Ltd., fetal bovine serum with the number 11011-8611 Sijiqing; DMED-F12 medium is purchased from Jiangsu KeyGen Biotech Co., Ltd., number KGM12500N-500), count, adjust the cell density, inoculate the culture flask, and culture statically in a 37°C, 5% CO2 incubator; change the culture medium once the next day and continue to culture for one more day; use trypsin (purchased from Jiangsu KeyGen Biotech Co., Ltd., number KGY0012) to digest the cells in the logarithmic phase, centrifuge and collect after termination, make a cell suspension, and adjust its concentration to 5×10 4 / ml; inoculate 100 μl of the cells with adjusted concentration into a 96-well cell culture plate and culture for 24 h;
[0118] Put the inoculated cell culture plate into the incubator and culture for 24 h until the cell monolayer covers the bottom of the well (96-well flat bottom plate). Add the metabolic supernatants of pTrc99a-Nb7-1917 with concentration gradients of 1 / 12.5, 1 / 25, 1 / 50, 1 / 100 and the metabolic supernatants of Escherichia coli Nissle 1917 with the same concentration gradients respectively, and incubate in a 5% CO2, 37°C incubator for 24 h. Observe the effect of the drug under an inverted microscope;
[0119] Add 100 μl of MTT solution (0.5 mg / ml, that is, 0.5% MTT, diluted with DMED-F12 basal medium) to each well and continue to culture for 4 h; terminate the culture and prepare to dissolve the crystals. Aspirate the MTT, add 150 μl of DMSO to each well, place it on a shaker and oscillate at low speed for 10 min to fully dissolve the crystals. At the OD of the enzyme-linked immunosorbent detector 570nmMeasure the absorbance values of each well and calculate the cell survival rate to determine whether the recombinant strain pTrc99a-Nb7-Nissle1917 obtained in Example 2 is toxic to cells. The results are shown in Table 4. The experimental data shown in Table 4 indicate that the recombinant strain pTrc99a-Nb7-Nissle1917 obtained in Example 2 has no active effect on cell growth.
[0120] Table 4 Cell survival rate
[0121]
[0122] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the technical concept scope of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the disclosed content of the present invention and fall within the protection scope of the present invention.
Claims
1. A nanobody Nb7, characterized in that, The nanobody is as follows: (1) a protein with the amino acid sequence shown in SEQ ID NO:1; (2) a tag facilitating purification is connected to the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO:1; and / or, a signal peptide sequence beneficial for protein secretion and expression is connected to the amino terminus of the amino acid sequence shown in SEQ ID NO:1; The tag facilitating purification is selected from at least one of Poly-Arg, Poly-His, FLAG, Strep-tag II and c-myc. The amino acid sequences of Poly-Arg, Poly-His, FLAG, Strep-tag II and c-myc are shown in SEQ ID NO:8-12. The signal peptide sequence is pelB, and the nucleotide sequence is shown in SEQ ID NO:
14.
2. A gene encoding a nanobody, characterized in that, This gene is the nucleotide sequence encoding the nanobody Nb7 described in claim 1.
3. The gene according to claim 2, characterized in that, The gene is the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:
1.
4. The gene according to claim 3, characterized in that The gene has the nucleotide sequence shown in SEQ ID NO:
2.
5. A recombinant vector, characterized in that, The recombinant vector contains the gene described in any one of claims 2 to 4.
6. The recombinant vector according to claim 5, characterized in that, The expression vector of the recombinant vector is the pTrc99a vector.
7. A recombinant strain, characterized in that, The recombinant strain expresses the gene described in any one of claims 2 to 4 or contains the recombinant vector described in claim 5 or 6.
8. The recombinant strain according to claim 7, characterized in that, The starting strain of the recombinant strain is selected from at least one of Escherichia coli, yeast, lactic acid bacteria and Bacillus subtilis.
9. The recombinant strain according to claim 8, characterized in that, The starting strain of the recombinant strain is Escherichia coli Nissle1917.
10. A bacterial agent, characterized in that, The bacterial agent contains the recombinant strain described in any one of claims 7 to 9.
11. The microbial agent according to claim 10, wherein The bacterial agent is a liquid bacterial agent and / or a solid bacterial agent.
12. Use of the nanobody Nb7 described in claim 1, the gene described in any one of claims 2 to 4, the recombinant vector described in claim 5 or 6, the recombinant strain described in any one of claims 7 to 9, or the bacterial agent described in claim 10 or 11 in the preparation of a drug for binding to porcine reproductive and respiratory syndrome virus.
Citation Information
Patent Citations
Specific binding PRRS (Porcine Reproductive and Respiratory Syndrome) virus non-structural protein Nsp9 nanobody and application thereof
CN104710528A
Nano antibody of PRRSV N protein, and preparation method and application of nano-antibody
CN112457397A