Genetically Modified Maize Event LP026-3 and Its Detection Method
By providing specific nucleic acid sequences and detection methods, the problem of difficult to distinguish and detect genetically modified corn events in the prior art is solved, and the rapid and accurate identification of genetically modified corn event LP026-3 is achieved, ensuring the high insect resistance and herbicide tolerance of corn without affecting yield.
Patent Information
- Application Number
- CN202211161749.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-23
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2042-09-23
AI Technical Summary
The prior art is difficult to accurately distinguish and detect different GM corn events, especially those generated using the same DNA construct, making it difficult to identify commercial GM corn events with excellent insect resistance and glyphosate herbicide tolerance.
A nucleic acid sequence and its detection method are provided. Through specific nucleic acid sequences and primer pairs or probes, the presence of transgenic corn event LP026-3 can be quickly and accurately identified, including SEQ ID NO: 1-7 and its complementary sequences, for DNA amplification and strict hybridization, ensuring the specificity and accuracy of the detection.
The rapid and accurate identification of the genetically modified corn event LP026-3 was achieved, ensuring high resistance to lepidopteran insects and high tolerance to glyphosate herbicides without affecting corn yield, and providing a stable detection method to track transgenic inserts.
Smart Images

Figure CN116144671B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and relates to a detection method for genetically modified plants and their products, in particular to a genetically modified maize event LP026-3 that is resistant to insects and tolerant to glyphosate herbicide application, and a nucleic acid sequence and method for detecting genetically modified maize LP026-3. Background Art
[0002] Maize (Zea mays L.) is a major food crop in many regions of the world. Biotechnology has been applied to maize to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in maize production, especially resistance to Lepidoptera insects (such as Ostrinia furnacalis, Helicoverpa armigera, Spodoptera frugiperda, Mythimna separata, etc.). Maize resistance to Lepidoptera insects can be obtained by genetically modifying the maize plant to express a Lepidoptera insect resistance gene. Another important agronomic trait is herbicide tolerance, especially tolerance to glyphosate herbicide. Maize tolerance to glyphosate herbicide can be obtained by genetically modifying the maize plant to express a glyphosate herbicide tolerance gene (such as epsps).
[0003] It is known that the expression of exogenous genes in plants is affected by their insertion positions in the maize genome, possibly due to the proximity of chromatin structure (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. Therefore, it is usually necessary to screen a large number of events to identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression levels of introduced genes can vary greatly among events; there may also be differences in the spatial or temporal patterns of expression, such as differences in the relative expression of transgenes between different plant tissues, and this difference is manifested in that the actual expression pattern may not be consistent with the expression pattern expected by the transcriptional regulatory elements in the introduced gene construct. Therefore, it is usually necessary to generate hundreds or thousands of different events and screen out a single event with the expected transgene expression level and expression pattern for commercial purposes from these events. Such transformed events have excellent resistance to lepidopteran pests (such as Ostrinia furnacalis, Spodoptera frugiperda, Mythimna separata, Spodoptera frugiperda, Helicoverpa armigera, Agrotis ypsilon, and Conogethes punctiferalis, etc.) and glyphosate herbicides and do not affect maize yield, and the transgenic traits can be introgressed into other genetic backgrounds by hybridization using conventional breeding methods. The offspring generated by this hybridization method maintain the transgenic expression characteristics and trait performances of the original transformant. Applying this strategic model can ensure reliable gene expression in many varieties, with stable resistance to lepidopteran pests (such as Ostrinia furnacalis, Spodoptera frugiperda, Mythimna separata, Spodoptera frugiperda, Helicoverpa armigera, Agrotis ypsilon, and Conogethes punctiferalis, etc.) and glyphosate herbicides, protecting these varieties from damage by major lepidopteran pests, having a broad-spectrum weed control ability, and being well adapted to local growth conditions.
[0004] It would be beneficial to be able to detect the presence of a specific event to determine whether the offspring of a sexual cross contain the gene of interest. In addition, methods for detecting specific events will also help to comply with relevant regulations. For example, foods derived from recombinant crops require formal approval and labeling before being put on the market. It is possible to detect the presence of transgenes by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods usually focus on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the inserted transgenic DNA is known, the above methods cannot be used to distinguish different events, especially those generated with the same DNA construct. Therefore, currently, a pair of primers spanning the junction of the inserted T-DNA and flanking DNA is often used by PCR to identify specific transgenic events, specifically, the first primer contained in the flanking sequence and the second primer contained in the inserted sequence. Summary of the Invention
[0005] The object of the present invention is to provide a transgenic maize event LP026-3, a nucleic acid sequence for detecting the maize plant event LP026-3, and a detection method thereof, which can accurately and rapidly identify whether a biological sample contains a DNA molecule of a specific transgenic maize event LP026-3.
[0006] To achieve the above object, the present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO:1-7 (i.e., SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7) and their complementary sequences. In some embodiments, the nucleic acid sequence is derived from a plant, seed or cell containing the maize event LP026-3, and a representative sample of the seed (classified as maize seed LP026-3) containing the event was deposited with the China Center for Type Culture Collection (abbreviation: CCTCC, address: Wuhan, China) on April 15, 2022 under the deposit number CCTCC NO:P202208. In some embodiments, the nucleic acid sequence is an amplicon for diagnosing the presence of the maize event LP026-3.
[0007] In some embodiments of the present invention, the present invention provides a nucleic acid sequence comprising at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence includes SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence includes SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence includes SEQ ID NO:5 or its complementary sequence.
[0008] The SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5'-end of the inserted sequence in the transgenic maize event LP026-3. The SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence at the maize insertion site and the DNA sequence at the 5'-end of the inserted sequence. The presence of the transgenic maize event LP026-3 can be identified by containing the SEQ ID NO:1 or its complementary sequence. The SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3'-end of the inserted sequence in the transgenic maize event LP026-3. The SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3'-end of the inserted sequence and the flanking genomic DNA sequence at the maize insertion site. The presence of the transgenic maize event LP026-3 can be identified by containing the SEQ ID NO:2 or its complementary sequence.
[0009] The nucleic acid sequences provided by the present invention can be at least 11 or more consecutive polynucleotides of any part of the transgenic insertion sequence in SEQ ID NO:3 or its complementary sequence (the first nucleic acid sequence), or at least 11 or more consecutive polynucleotides of any part of the 5'-flanking maize genomic DNA region in SEQ ID NO:3 or its complementary sequence (the second nucleic acid sequence). The nucleic acid sequence can further be a part of SEQ ID NO:3 that is homologous to or complementary to the complete SEQ ID NO:1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for generating an amplification product. When the amplification product generated by using the DNA primer pair in the DNA amplification method is an amplification product including SEQ ID NO:1, the presence of transgenic maize event LP026-3 or its progeny can be diagnosed. As is well known to those skilled in the art, the first and second nucleic acid sequences do not have to consist only of DNA, but can also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probes or primers described in the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, which can be selected from the nucleotides described in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. When selected from the nucleotides shown in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, the probes and primers can be about 17 to 50 or more consecutive nucleotides in length. SEQ ID NO:3 or its complementary sequence is a sequence of 1177 nucleotides located near the insertion junction at the 5'-end of the insertion sequence in transgenic maize event LP026-3. SEQ ID NO:3 or its complementary sequence consists of a 677-nucleotide maize flanking genomic DNA sequence (nucleotides 1-677 of SEQ ID NO:3), a 383-nucleotide pLP026 construct DNA sequence (nucleotides 678-1060 of SEQ ID NO:3), and a 3'-end DNA sequence of 117 nucleotides of the Nos terminator (nucleotides 1061-1177 of SEQ ID NO:3). The presence of transgenic maize event LP026-3 can be identified by including SEQ ID NO:3 or its complementary sequence.
[0010] The nucleic acid sequence can be at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any part of the transgene insertion sequence in SEQ ID NO:4 or its complementary sequence, or at least 11 or more consecutive nucleotides (fourth nucleic acid sequence) of any part of the 3'-flanking maize genomic DNA region in SEQ ID NO:4 or its complementary sequence. The nucleic acid sequence can further be a part of SEQ ID NO:4 that is homologous to or complementary to SEQ ID NO:2 including the complete SEQ ID NO:2. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences in a DNA amplification method for generating an amplification product include a DNA primer pair. When the amplification product generated by using the DNA primer pair in the DNA amplification method is an amplification product including SEQ ID NO:2, the presence of transgenic maize event LP026-3 or its progeny can be diagnosed. SEQ ID NO:4 or its complementary sequence is a sequence of 1032 nucleotides in transgenic maize event LP026-3 located near the insertion junction at the 3'-end of the insertion sequence. SEQ ID NO:4 or its complementary sequence consists of a 53-nucleotide tNos (nopaline synthase) transcription terminator sequence (nucleotides 1-53 of SEQ ID NO:4), a 172-nucleotide pLP026 construct DNA sequence (nucleotides 54-225 of SEQ ID NO:4), and an 807-nucleotide maize integration site flanking genomic DNA sequence (nucleotides 226-1032 of SEQ ID NO:4). The presence of transgenic maize event LP026-3 can be identified by including SEQ ID NO:4 or its complementary sequence.
[0011] SEQ ID NO:5 or its complementary sequence is a sequence of 17611 nucleotides characterizing transgenic maize event LP026-3, and the specific genomic and genetic elements it contains are shown in Table 1. The presence of transgenic maize event LP026-3 can be identified by including SEQ ID NO:5 or its complementary sequence.
[0012] Table 1. Genomic and genetic elements contained in SEQ ID NO:5
[0013]
[0014]
[0015] The nucleic acid sequence or its complementary sequence can be used in DNA amplification methods to generate amplification products, and the presence of transgenic maize event LP026-3 or its progeny in a biological sample can be diagnosed by detecting the amplification products; the nucleic acid sequence or its complementary sequence can be used in nucleotide detection methods to detect the presence of transgenic maize event LP026-3 or its progeny in a biological sample.
[0016] The present invention provides a DNA primer pair, comprising a first primer and a second primer, wherein each of the first primer and the second primer comprises a fragment of SEQ ID NO:5 or its complementary sequence, and when used in an amplification reaction together with DNA containing maize event LP026-3, an amplification product for detecting maize event LP026-3 in a sample is generated.
[0017] In some embodiments, the first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:10; the second primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:11 or SEQ ID NO:14.
[0018] In some embodiments of the present invention, the amplification product comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.
[0019] Further, the amplification product comprises the 1st-11th or 12th-22nd consecutive nucleotides in SEQ ID NO:1 or its complementary sequence, or the 1st-11th or 12th-22nd consecutive nucleotides in SEQ ID NO:2 or its complementary sequence.
[0020] Even further, the amplification product comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, or SEQ ID NO:7 or its complementary sequence.
[0021] In the above technical solution, the primer comprises at least one of the nucleic acid sequences. Specifically, the primer comprises a first primer and a second primer, the first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14.
[0022] The present invention also provides a DNA probe, which comprises a fragment of SEQ ID NO:5 or its complementary sequence, and the DNA probe hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule that does not contain a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence under stringent hybridization conditions.
[0023] In some embodiments, the DNA probe comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.
[0024] In some embodiments, the DNA probe is labeled with a fluorescent group.
[0025] In some embodiments, the probe comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; further, the probe comprises the 1st-11th or 12th-22nd consecutive nucleotides in SEQ ID NO:1 or its complementary sequence, or the 1st-11th or 12th-22nd consecutive nucleotides in SEQ ID NO:2 or its complementary sequence.
[0026] The present invention also provides a labeled nucleic acid molecule, which comprises a fragment of SEQ ID NO:5 or its complementary sequence, and the labeled nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule that does not contain a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence under stringent hybridization conditions.
[0027] In some embodiments, the labeled nucleic acid molecule comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.
[0028] In one embodiment, the labeled nucleic acid molecule comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence;
[0029] In some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.
[0030] Further, the present invention provides a method for detecting the presence of DNA containing transgenic maize event LP026-3 in a sample, comprising:
[0031] (1) contacting the sample to be detected with the DNA primer pair in a nucleic acid amplification reaction;
[0032] (2) performing a nucleic acid amplification reaction;
[0033] (3) detecting the presence of the amplification product;
[0034] The amplification product comprises a nucleic acid sequence selected from the sequences SEQ ID NO:1-7 and their complementary sequences, indicating the presence of DNA containing transgenic maize event LP026-3 in the test sample.
[0035] The present invention also provides a method for detecting the presence of DNA containing transgenic maize event LP026-3 in a sample, comprising:
[0036] (1) contacting the sample to be detected with the DNA probe and / or the marker nucleic acid molecule;
[0037] (2) hybridizing the sample to be detected with the probe and / or the marker nucleic acid molecule under stringent hybridization conditions;
[0038] (3) detecting the hybridization of the sample to be detected with the probe and / or the marker nucleic acid molecule.
[0039] The stringent conditions may be hybridization in a solution of 6×SSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) at 65°C, followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.
[0040] Wherein, detecting the hybridization of the sample to be detected and the marker nucleic acid molecule, and then analyzing by marker-assisted breeding to determine that insect resistance and / or herbicide tolerance is genetically linked to the marker nucleic acid molecule.
[0041] The present invention also provides a DNA detection kit, comprising: a DNA primer pair for generating amplicons for diagnosing transgenic maize event LP026-3, a probe specific to SEQ ID NO: 1-7, or a labeled nucleic acid molecule specific to SEQ ID NO: 1-7. Specifically, the detection kit comprises the probe, primer pair or labeled nucleic acid molecule of the present invention.
[0042] In some embodiments, the present invention provides a DNA detection kit comprising at least one DNA molecule, the DNA molecule comprising at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 4 or its complementary sequence, which can be used as a DNA primer or probe specific to transgenic maize event LP026-3 or its progeny.
[0043] Further, the DNA molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO: 2 or its complementary sequence.
[0044] Even further, the DNA molecule comprises a homologous sequence of SEQ ID NO: 1 or its complementary sequence, a homologous sequence of SEQ ID NO: 2 or its complementary sequence, a homologous sequence of SEQ ID NO: 6 or its complementary sequence, or a homologous sequence of SEQ ID NO: 7 or its complementary sequence. To achieve the above object, the present invention also provides a plant cell comprising nucleic acid sequences encoding insect-resistant Cry1Ab, Cry2Ab and Cry1Fa proteins, a nucleic acid sequence encoding a glyphosate herbicide-tolerant EPSPS protein, and a nucleic acid sequence of a specific region, the nucleic acid sequence of the specific region comprising the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7.
[0045] The sequences provided by the present invention include the sequences listed in Table 2 below:
[0046] Table 2. Sequences related to the present invention
[0047]
[0048]
[0049]
[0050] The present invention also provides a method for protecting maize plants from insect infestation, comprising providing at least one transgenic maize plant cell comprising transgenic maize event LP026-3 in the diet of a target insect; the target insect that ingests the transgenic maize plant cell is inhibited from further feeding on the maize plant.
[0051] The present invention also provides a method for protecting maize plants from damage caused by herbicides, comprising growing at least one transgenic maize plant comprising transgenic maize event LP026-3. In some embodiments, the method comprises applying an effective dose of glyphosate herbicide to a field in which at least one transgenic maize plant is grown, the transgenic maize plant comprising transgenic maize event LP026-3.
[0052] The present invention also provides a method for controlling weeds in a field in which maize plants are grown, comprising applying an effective dose of glyphosate herbicide to a field in which at least one transgenic maize plant is grown, the transgenic maize plant comprising transgenic maize event LP026-3.
[0053] The present invention also provides a method for cultivating maize plants resistant to insects, comprising: sowing at least one maize seed comprising transgenic maize event LP026-3;
[0054] growing the maize seed into a maize plant;
[0055] infesting the maize plant with a target insect, and / or spraying the maize plant with an effective dose of glyphosate herbicide, and harvesting a plant with reduced plant damage compared to other plants that do not comprise transgenic maize event LP026-3.
[0056] In some embodiments, the present invention provides a method for cultivating maize plants resistant to insects and tolerant to glyphosate herbicide, comprising:
[0057] sowing at least one maize seed comprising transgenic maize event LP026-3;
[0058] growing the maize seed into a maize plant;
[0059] spraying the maize plant with an effective dose of glyphosate herbicide, and harvesting a plant with reduced plant damage compared to other plants that do not have transgenic maize event LP026-3, the plant with reduced plant damage being also resistant to feeding damage by insects.
[0060] In some embodiments, the present invention also provides a method for generating a maize plant resistant to insects, comprising introducing the transgenic maize event LP026-3 into the genome of the maize plant and selecting a maize plant with reduced plant damage to insect feeding. In some embodiments, the method comprises: sexually crossing a first parental maize plant of the transgenic maize event LP026-3 resistant to insects with a second parental maize plant lacking insect resistance to produce a large number of progeny plants; infesting the progeny plants with a target insect; and selecting the progeny plants having reduced plant damage compared to other plants without the transgenic maize event LP026-3.
[0061] In some embodiments, the present invention also provides a method for generating a maize plant tolerant to glyphosate herbicide, comprising introducing the transgenic maize event LP026-3 into the genome of the maize plant and selecting a maize plant tolerant to glyphosate. In some embodiments, the method comprises: sexually crossing a first parental maize plant of the transgenic maize event LP026-3 tolerant to glyphosate herbicide with a second parental maize plant lacking glyphosate tolerance to produce a large number of progeny plants; treating the progeny plants with glyphosate herbicide; and selecting the progeny plants tolerant to glyphosate.
[0062] In some embodiments, the present invention also provides a method for generating a maize plant resistant to insects and tolerant to glyphosate herbicide application, comprising: introducing the transgenic maize event LP026-3 into the genome of the maize plant and selecting a maize plant tolerant to glyphosate and having insect resistance. In some embodiments, the method comprises sexually crossing a first parental maize plant of the transgenic maize event LP026-3 tolerant to glyphosate and having insect resistance with a second parental maize plant lacking glyphosate tolerance and / or insect resistance to produce a large number of progeny plants; treating the progeny plants with glyphosate; selecting the progeny plants tolerant to glyphosate, and the progeny plants tolerant to glyphosate are also resistant to insect feeding damage.
[0063] The present invention also provides a composition derived from the transgenic maize event LP026-3, and the composition is maize flour, cornmeal, corn oil, corn silk or corn starch. In some embodiments, the composition may be agricultural products or commodities such as maize flour, cornmeal, corn oil, corn starch, corn gluten, tortillas, cosmetics or fillers. If a sufficient expression level is detected in the composition, the composition is expected to contain nucleic acid sequences capable of diagnosing the presence of transgenic maize event LP026-3 material in the composition. Specifically, the composition includes, but is not limited to, corn oil, corn grits, cornmeal, corn gluten, tortillas, corn starch, and any other food to be used as a food source for animal consumption, or alternatively as an ingredient in an expanding agent or cosmetic composition for cosmetic use, etc.
[0064] The detection method and / or kit based on probes or primer pairs of the present invention can be used to detect the nucleic acid sequences of transgenic maize event LP026-3 such as those shown in SEQ ID NO:1 or SEQ ID NO:2 in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 to diagnose the presence of transgenic maize event LP026-3.
[0065] In summary, the transgenic maize event LP026-3 of the present invention has dual traits of insect resistance and herbicide tolerance, and has the following advantages: 1) It is free from economic losses caused by Lepidoptera pests (such as the main pests in maize planting areas, including Ostrinia furnacalis, Mythimna separata, Spodoptera frugiperda, Helicoverpa armigera, Agrotis ypsilon and Conogethes punctiferalis, etc.); 2) The ability to apply agricultural herbicides containing glyphosate to maize crops for broad-spectrum weed control; 3) The maize yield is not reduced. Specifically, the event LP026-3 of the present invention has a high resistance level to target pests, and can cause a pest mortality rate of up to 100%, protecting plants with a damage rate as low as 0%; it has a high tolerance to glyphosate herbicides, protecting plants with a damage rate as low as 0%; and plants containing this event have excellent agronomic traits, and the yield percentage can be as high as 100%. In addition, the genes encoding insect resistance and glyphosate tolerance traits are linked on the same DNA segment and exist at a single locus in the genome of transgenic maize event LP026-3, which improves the breeding efficiency and enables the tracking of transgenic insertion fragments in breeding populations and their offspring using molecular markers. At the same time, the primer or probe sequences provided in the detection method of the present invention can produce amplification products identified as transgenic maize event LP026-3 or its offspring, and can quickly, accurately and stably identify the presence of plant materials derived from transgenic maize event LP026-3.
[0066] Term
[0067] The following definitions and methods can better define the present invention and guide those of ordinary skill in the art to implement the present invention. Unless otherwise stated, terms are understood according to the conventional usage of those of ordinary skill in the art.
[0068] The term "maize" refers to Zea mays, and includes all plant varieties that can be crossbred with maize, including wild maize species.
[0069] The term "comprising" means "including but not limited to". The term "processed product" refers to the product obtained by processing raw materials such as plants and seeds, such as compositions and the like.
[0070] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include but are not limited to plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, and the above plant parts are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecule of the present invention and thus at least partially consist of transgenic cells.
[0071] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence (5' non-coding sequence) before the coding sequence and the regulatory sequence (3' non-coding sequence) after the coding sequence. A "natural gene" refers to a gene that is naturally found with its own regulatory sequence. A "chimeric gene" refers to any gene that is not a natural gene and contains regulatory and coding sequences that are not naturally found. An "endogenous gene" refers to a natural gene that is located at its natural position in the genome of an organism. An "exogenous gene" refers to a foreign gene that currently exists in the genome of an organism and was not originally present, and also refers to a gene introduced into a recipient cell through a transgenic step. An exogenous gene can contain a natural gene or a chimeric gene inserted into a non-natural organism. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where recombinant DNA has been inserted can be referred to as an "insertion site" or a "target site".
[0072] "Flanking DNA" can include genomic DNA that naturally occurs in an organism such as a plant or exogenous (heterologous) DNA introduced through a transformation process, such as a fragment associated with a transformation event. Thus, flanking DNA can include a combination of native and exogenous DNA. In the present invention, "flanking region" or "flanking sequence" or "genomic border region" or "genomic border sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500 or 5000 base pairs or longer that is located immediately upstream or downstream of and adjacent to an initially exogenous inserted DNA molecule. When the flanking region is located downstream, it can also be referred to as "left border flanking" or "3' flanking" or "3' genomic border region" or "genomic 3' border sequence", etc. When the flanking region is located upstream, it can also be referred to as "right border flanking" or "5' flanking" or "5' genomic border region" or "genomic 5' border sequence", etc.
[0073] Transformation procedures that cause random integration of exogenous DNA result in transformants containing different flanking regions that are specific to each transformant. When recombinant DNA is introduced into a plant by traditional hybridization, its flanking region generally does not change. A transformant will also contain unique junctions between a heterologous insert DNA and a segment of genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. A "junction" is the point at which two specific DNA fragments are joined. For example, a junction exists at the position where the insert DNA joins the flanking DNA. Junction points also exist in the transformed organism where two DNA fragments are joined together in a manner modified from that found in the native organism. "Junction DNA" refers to DNA that contains a junction point.
[0074] The present invention provides a transgenic maize event designated LP026-3 and its progeny, the transgenic maize event LP026-3 being maize plant LP026-3, which includes plants and seeds of the transgenic maize event LP026-3 and their plant cells or their renewable parts, and plant parts of the transgenic maize event LP026-3, including but not limited to cells, pollen, ovules, flowers, buds, roots, stems, silk, inflorescences, ears, leaves, and products from maize plant LP026-3, such as corn flour, cornmeal, corn oil, corn syrup, corn silk, corn starch, and biomass left in the maize crop field.
[0075] The transgenic maize event LP026-3 of the present invention contains a DNA construct that, when expressed in a plant cell, confers resistance to insects and tolerance to the glyphosate herbicide to the transgenic maize event LP026-3.
[0076] In some embodiments of the present invention, the DNA construct comprises four tandem expression cassettes. The first expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operably linked to a nucleic acid sequence of the insect-resistant Cry2Ab protein (cCry2Ab) of Bacillus thuringiensis, the Cry2Ab protein having lepidopteran insect resistance; the second expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operably linked to a nucleic acid sequence of the insect-resistant Cry1Fa protein (cCry1Fa) of Bacillus thuringiensis, the Cry1Fa having lepidopteran insect resistance; the third expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operably linked to a nucleic acid sequence of the Cry1Ab protein, the nucleic acid sequence of the Cry1Ab protein being mainly resistant to lepidopteran insects. The fourth expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operably linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), the nucleic acid sequence of the EPSPS protein being tolerant to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible and / or tissue-specific promoters, and the suitable promoters include, but are not limited to, cauliflower mosaic virus (CaMV) 35S promoter, figwort mosaic virus (FMV) 35S promoter, ubiquitin promoter, actin promoter, nopaline synthase (NOS) promoter of Agrobacterium tumefaciens, octopine synthase (OCS) promoter, yellow leaf curl virus promoter of Cestrum, patatin promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, rolD promoter of Agrobacterium rhizogenes, and Suc2 promoter of Arabidopsis thaliana.The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants. The suitable polyadenylation signal sequence includes, but is not limited to, the polyadenylation signal sequence derived from the nopaline synthase (NOS) gene of Agrobacterium tumefaciens, the cauliflower mosaic virus (CaMV) 35S terminator, the polyadenylation signal sequence derived from the protease inhibitor II (PINII) gene, and the polyadenylation signal sequence derived from the α-tubulin gene.
[0077] In addition, the expression cassette may further include other genetic elements, which include, but are not limited to, enhancers and nucleic acid coding sequences of signal peptides / transit peptides. The enhancer can enhance the gene expression level. The enhancer includes, but is not limited to, the tobacco etch virus (TEV) translation activator, the CaMV 35S enhancer, and the FMV 35S enhancer. The signal peptide / transit peptide can direct the Cry1Ab protein and / or the EPSPS protein to be transported outside the cell or to specific organelles or compartments inside the cell. For example, the chloroplast transit peptide sequence is used to target the chloroplast, or the 'KDEL' retention sequence is used to target the endoplasmic reticulum.
[0078] The Cry1Ab, Cry2Ab, and Cry1Fa genes can be isolated from Bacillus thuringiensis (Bt), and the nucleic acid sequences of the Cry1Ab, Cry2Ab, and Cry1Fa genes can be optimized or otherwise modified to increase the stability and availability of transcripts in transformed cells.
[0079] In some embodiments of the present invention, the maize cells, seeds, or plants containing the transgenic maize event LP026-3 sequentially contain SEQ ID NO:1, the nucleic acid sequence at positions 678-16804 of SEQ ID NO:5, and SEQ ID NO:2 in their genomes, or contain SEQ ID NO:5.
[0080] The "Lepidoptera", with the scientific name Lepidoptera, includes two types of insects, moths and butterflies, and is the order with the most agricultural and forestry pests, such as the Asian corn borer, cotton bollworm, oriental armyworm, fall armyworm, Athetis lepigone, and peach fruit borer.
[0081] The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene can be isolated from the Agrobacterium tumefaciens sp. strain CP4, and the polynucleotide encoding the EPSPS gene can be optimized for codons or otherwise modified to increase the stability and availability of the transcript in the transformed cells. The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selectable marker gene.
[0082] The term "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with "glyphosate herbicide" means treatment with any herbicide formulation containing glyphosate. The selection of the application rate of a glyphosate formulation to achieve an effective biological dose is within the skill of an ordinary agronomist. Treatment of a field containing plant material derived from the transgenic maize event LP026-3 with any herbicide formulation containing glyphosate will control the growth of weeds in the field and will not affect the growth or yield of the plant material derived from the transgenic maize event LP026-3.
[0083] The DNA construct is introduced into the plant by a transformation method, which includes but is not limited to, Agrobacterium-mediated transformation, particle bombardment transformation, and pollen tube pathway transformation.
[0084] The Agrobacterium-mediated transformation method is a commonly used method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border common sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, and subsequently, the Agrobacterium cells are used to infect plant tissues, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.
[0085] The particle bombardment transformation method is to bombard plant cells with a vector containing foreign DNA (particle-mediated biolistic transformation).
[0086] The pollen tube pathway transformation method utilizes the natural pollen tube pathway (also known as the pollen tube guiding tissue) formed after plant pollination, and through the nucellar pathway, the foreign DNA is carried into the embryo sac.
[0087] After transformation, transgenic plants must be regenerated from the transformed plant tissues, and the progeny with foreign DNA are selected using suitable markers.
[0088] A DNA construct is a combination of DNA molecules linked together that provides one or more expression cassettes. Specifically, the DNA construct is a plasmid capable of self-replicating in bacterial cells and containing different restriction endonuclease sites, which are used to introduce DNA molecules providing functional gene elements, namely promoters, introns, leader sequences, coding sequences, 3'-terminator regions, and other sequences. The expression cassettes contained in the DNA construct include gene elements necessary for the transcription of messenger RNA, and the expression cassettes can be designed to be expressed in prokaryotic or eukaryotic cells. The expression cassettes of the present invention are designed to be most specifically expressed in plant cells.
[0089] A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, i.e., including at least one nucleic acid expression cassette containing a target gene, inserted into the plant genome by transgenic methods to generate a plant population, regenerating the plant population, and selecting specific plants with the characteristics of insertion at specific genomic loci. The term "event" refers to the original transformant containing the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny obtained by sexual hybridization between the transformant and individuals of other varieties containing the heterologous DNA. Even after repeated backcrossing with the backcross parent, the inserted DNA and the flanking genomic DNA from the transformant parent are present at the same chromosomal position in the hybrid progeny. The term "event" also refers to the DNA sequence from the original transformant, which contains the inserted DNA and the flanking genomic sequences closely adjacent to the inserted DNA, and this DNA sequence is expected to be transferred to the progeny generated by sexual hybridization between a parental line containing the inserted DNA (such as the original transformant and its self-progeny) and a parental line without the inserted DNA, and the progeny has received the inserted DNA containing the target gene.
[0090] "Recombinant" in the present invention refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is thus produced by artificial intervention. Such artificial intervention can produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments that are otherwise separated, for example, by chemical synthesis or by manipulating isolated nucleic acid segments by genetic engineering techniques. The techniques for nucleic acid manipulation are well known.
[0091] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered due to the presence of heterologous nucleic acid, and the "transgenic" includes the original transgenic organism so altered and the progeny individuals generated from the original transgenic organism by sexual hybridization or asexual reproduction. In the present invention, the term "transgenic" does not include genomic (chromosomal or extrachromosomal) alterations by conventional plant breeding methods or natural-occurring events such as random allogamy, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0092] In the present invention, "heterologous" means that the first molecule is not normally found in nature in combination with the second molecule. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Thus such a molecule is heterologous to the host and has been artificially introduced into the genome of the host cell.
[0093] Culturing the transgenic maize event LP026-3 that is resistant to Lepidoptera insects and tolerant to glyphosate herbicide can be achieved by the following steps: First, sexually cross a first parental maize plant with a second parental maize plant to produce a diverse population of first-generation progeny plants, where the first parental maize plant consists of maize plants cultivated from the transgenic maize event LP026-3 and its progeny, and the transgenic maize event LP026-3 and its progeny are obtained by transformation with an expression cassette of the present invention that is resistant to Lepidoptera insects and tolerant to glyphosate herbicide, and the second parental maize plant lacks resistance to Lepidoptera insects and / or tolerance to glyphosate herbicide; then select the progeny plants that are resistant to the infestation of Lepidoptera insects and / or tolerant to glyphosate herbicide, and maize plants that are resistant to Lepidoptera insects and tolerant to glyphosate herbicide can be cultivated. These steps can further include backcrossing the progeny plants with Lepidoptera insect resistance and / or glyphosate tolerance to the second parental maize plant or a third parental maize plant, and then selecting the progeny by infestation with Lepidoptera insects, application of glyphosate herbicide or by identification with a molecular marker related to the trait (such as a DNA molecule containing the junction sites identified at the 5' end and 3' end of the inserted sequence in the transgenic maize event LP026-3), so as to produce maize plants that are resistant to Lepidoptera insects and tolerant to glyphosate herbicide.
[0094] It should also be understood that two different transgenic plants can also be hybridized to produce progeny containing two independent, separately added foreign genes. Self-crossing of appropriate progeny can result in progeny plants that are homozygous for both added foreign genes. Backcrossing to the parental plants and outcrossing with non-transgenic plants as described above are also contemplated, as is asexual reproduction.
[0095] The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule can be attached, such as, for example, a radioisotope, a ligand, a chemiluminescent agent, or an enzyme. Such a probe is complementary to one strand of the target nucleic acid, and in the present invention, the probe is complementary to a DNA strand from the genome of transgenic maize event LP026-3, whether the genomic DNA is from transgenic maize event LP026-3 or seeds or from plants or seeds or extracts of transgenic maize event LP026-3. The probes of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of the target DNA sequence.
[0096] The term "primer" is an isolated nucleic acid molecule that anneals by nucleic acid hybridization to a complementary target DNA strand to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (such as DNA polymerase). The primer pairs of the present invention relate to their use in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.
[0097] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising the full length or fragments of SEQ ID NO: 1-7 can be used as primers and probes for detecting maize event LP026-3 and can be readily designed by those skilled in the art using the sequences provided herein.
[0098] Probes and primers are generally 11 or more polynucleotides in length, preferably 18 or more polynucleotides in length, more preferably 24 or more polynucleotides in length, and most preferably 30 or more polynucleotides in length. Such probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and retain the ability to hybridize to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers in the present invention have complete DNA sequence identity with the contiguous nucleic acids of the target sequence.
[0099] Primers and probes based on the flanking genomic DNA and the insert sequence of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic maize event LP026-3 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises a transgenic insert sequence and a maize genomic flanking region, and a fragment of the DNA molecule can be used as a primer or a probe.
[0100] The nucleic acid probes and primers of the present invention hybridize to the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic maize event LP026-3 in a sample. Nucleic acid molecules or fragments thereof are capable of specific hybridization to other nucleic acid molecules under certain circumstances. As used in the present invention, two nucleic acid molecules are said to be capable of specific hybridization to one another if they can form an antiparallel double-stranded nucleic acid structure. If two nucleic acid molecules show complete complementarity, one nucleic acid molecule is said to be the "complement" of the other. As used in the present invention, two nucleic acid molecules are said to show "complete complementarity" when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient stability to permit them to anneal and bind to one another at least under conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they can hybridize to one another with sufficient stability to permit them to anneal and bind to one another under conventional "high stringency" conditions. Deviations from complete complementarity are permissible as long as such deviations do not completely prevent the formation of a double-stranded structure between the two molecules. In order for a nucleic acid molecule to serve as a primer or probe, it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.
[0101] As used in the present invention, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing with the complementary strand of a matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization are known to those skilled in the art, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at about 45°C, followed by washing with 2.0× SSC at 50°C. For example, the salt concentration in the washing step can be selected from about 2.0× SSC at 50°C for low stringency conditions to about 0.2× SSC at 50°C for high stringency conditions. In addition, the temperature conditions in the washing step can range from room temperature of about 22°C for low stringency conditions to about 65°C for high stringency conditions. The temperature conditions and the salt concentration can both be changed, or one can remain unchanged while the other variable is changed. Specifically, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules or their complementary sequences in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or any fragment of the above sequences, under moderately stringent conditions, for example, at about 2.0× SSC and about 65°C. More specifically, a nucleic acid molecule of the present invention specifically hybridizes with one or more nucleic acid molecules or their complementary sequences in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or any fragment of the above sequences, under highly stringent conditions. In the present invention, the preferred marker nucleic acid molecule has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7, or their complementary sequences, or any fragment of the above sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7, or their complementary sequences, or any fragment of the above sequences. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, and SEQ ID NO:7 can be used as markers in plant breeding methods to identify the offspring of genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including but not limited to, fluorescence labeling, radioactive labeling, antibody-based labeling, and chemiluminescence labeling.
[0102] For amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refers to conditions in a DNA thermal amplification reaction that allow the primer to hybridize only to the target nucleic acid sequence, a primer having a wild-type sequence corresponding to the target nucleic acid sequence (or its complementary sequence) that is capable of binding to the target nucleic acid sequence and preferably producing a unique amplification product, the amplification product being the amplicon.
[0103] The term "specifically binds (to the target sequence)" means that a probe or primer hybridizes only to the target sequence in a sample containing the target sequence under stringent hybridization conditions.
[0104] As used in the present invention, "amplified DNA", "amplification product" or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a maize plant was produced by sexual hybridization with transgenic maize event LP026-3 of the present invention, or whether a maize sample collected from a field contains transgenic maize event LP026-3, or whether a maize extract, such as a meal, flour or oil, contains transgenic maize event LP026-3, DNA extracted from a maize plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA of transgenic maize event LP026-3. The primer pair includes a first primer derived from a flanking sequence adjacent to the insertion site of the inserted foreign DNA in the plant genome and a second primer derived from the inserted foreign DNA. The amplicon has a certain length and sequence that is also diagnostic for the transgenic maize event LP026-3. The length range of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.
[0105] Optionally, the primer pair can be derived from the flanking genomic sequences on both sides of the inserted DNA to produce an amplicon that includes the entire inserted nucleic acid sequence. One of the primer pairs derived from the plant genomic sequence can be located at a certain distance from the inserted DNA sequence, and the range of this distance can be from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in a DNA thermal amplification reaction.
[0106] The nucleic acid amplification reaction can be achieved by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well-known to those skilled in the art. The PCR amplification method has been developed to amplify genomic DNA of 22 kb and phage DNA of 42 kb. These methods and other DNA amplification methods in the art can be used in the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic maize event LP026-3 can be amplified by using the provided primer sequences for the genome of the transgenic maize event LP026-3, and after amplification, standard DNA sequencing can be performed on the PCR amplicon or the cloned DNA.
[0107] The DNA detection kit based on the DNA amplification method may contain DNA primer molecules, which specifically hybridize to the target DNA under appropriate reaction conditions and amplify the diagnostic amplicon. The kit may provide an agarose gel-based detection method or many methods for detecting diagnostic amplicons known in the prior art. The kit provided by the present invention contains DNA primers that are homologous or complementary to any part of the maize genomic region of SEQ ID NO: 3 or SEQ ID NO: 4, and that are homologous or complementary to any part of the transgenic insertion region of SEQ ID NO: 5. In particular, the primer pair useful in the DNA amplification method is SEQ ID NO: 8 and SEQ ID NO: 9, which amplify a diagnostic amplicon homologous to a part of the 5'-transgenic / genomic region of the transgenic maize event LP026-3, wherein the amplicon includes SEQ ID NO: 1. Other DNA molecules used as DNA primers can be selected from SEQ ID NO: 5.
[0108] The amplicons generated by these methods can be detected by a variety of techniques. One method is GeneticBit Analysis, which designs a DNA oligonucleotide strand spanning the inserted DNA sequence and the adjacent flanking genomic DNA sequence. The oligonucleotide strand is immobilized in the wells of a microtiter plate. After PCR amplification of the target region (using one primer each in the inserted sequence and the adjacent flanking genomic sequence), the single-stranded PCR product can hybridize to the immobilized oligonucleotide strand and serve as a template for a single-base extension reaction, which uses DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained by fluorescence or ELISA-like methods. The signal represents the presence of the insertion / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions are successful.
[0109] Another method is the Pyrosequencing technique. This method designs an oligonucleotide strand that spans the inserted DNA sequence and the adjacent genomic DNA binding site. This oligonucleotide strand is hybridized with the single-stranded PCR product of the target region (using one primer each within the inserted sequence and the adjacent flanking genomic sequence), and then incubated with DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine-5'-phosphosulfate, and luciferin. dNTPs are added separately, and the generated light signal is measured. The light signal represents the presence of the inserted / flanking sequence, indicating that the amplification, hybridization, and single-base or multi-base extension reactions are successful.
[0110] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) is also a method that can be used to detect the amplicons of the present invention. Using this method requires designing an oligonucleotide strand that spans the inserted DNA sequence and the adjacent genomic DNA binding site. This oligonucleotide strand is hybridized with the single-stranded PCR product of the target region (using one primer each within the inserted sequence and the adjacent flanking genomic sequence), and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single-base extension results in the insertion of ddNTPs. This insertion can be measured for the change in its polarization using a fluorometer. The change in polarization represents the presence of the inserted / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions are successful.
[0111] Taqman is described as a method for detecting and quantitatively analyzing the presence of a DNA sequence, which is detailed in the instructions provided by the manufacturer. A brief example is as follows. Design a FRET oligonucleotide probe that spans the inserted DNA sequence and the adjacent genomic flanking binding site. This FRET probe and the PCR primers (using one primer each within the inserted sequence and the adjacent flanking genomic sequence) are subjected to a cycling reaction in the presence of a thermostable polymerase and dNTPs. The hybridization of the FRET probe results in the cleavage of the fluorescent part and the quenching part on the FRET probe and the release of the fluorescent part. The generation of the fluorescent signal represents the presence of the inserted / flanking sequence, indicating that the amplification and hybridization are successful.
[0112] Based on the principle of hybridization, suitable techniques for detecting plant materials derived from the transgenic maize event LP026-3 may also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. In particular, the suitable techniques include incubating the probe and the sample, washing to remove unbound probe, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe. For example, a radiolabeled probe can be detected by exposing and developing an X-ray film, or an enzyme-labeled probe can be detected by a color change resulting from substrate conversion.
[0113] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe spanning the inserted DNA sequence and the adjacent genomic flanking junction site was designed. The unique structure of the FRET probe results in its containing a secondary structure that can keep the fluorescent part and the quenching part in close proximity. The FRET probe and PCR primers (one primer each in the inserted sequence and the adjacent flanking genomic sequence) are subjected to a cycling reaction in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, hybridization of the FRET probe and the target sequence leads to the loss of the probe secondary structure, thus spatially separating the fluorescent part and the quenching part, generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the inserted / flanking sequence, indicating that the amplification and hybridization are successful.
[0114] Other described methods, such as microfluidics, provide methods and devices for separating and amplifying DNA samples. Optical dyes are used to detect and assay specific DNA molecules. Electronic sensors for detecting DNA molecules or nanotube devices containing nanobeads that bind specific DNA molecules and can thus be detected are useful for detecting the DNA molecules of the present invention.
[0115] The compositions of the present invention and methods described or known in the field of DNA detection can be used to develop DNA detection kits. The kits are useful for identifying the presence of the DNA of the transgenic maize event LP026-3 in a sample and can also be used to cultivate maize plants containing the DNA of the transgenic maize event LP026-3. The kits may contain DNA primers or probes that are homologous or complementary to at least a part of SEQ ID NO:1, 2, 3, 4, or 5, or may contain other DNA primers or probes that are homologous or complementary to the DNA contained in the transgenic genetic elements of the DNA, and these DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods.
[0116] Contained in the maize genome and inFigure 1 The DNA structure of the binding site of the transgenic insertion sequence described in Table 1 to the maize genome includes: the maize LP026-3 flanking genomic region at the 5' end of the transgenic insertion sequence, a part of the insertion sequence from the right border region (RB) of Agrobacterium, the first expression cassette consists of the figwort mosaic virus 35s promoter (prFMV), operably linked to the maize heat shock protein gene HSP70 protein intron (iZmHSP70), operably linked to the maize chloroplast transit peptide 2 (spZmCTP2), operably linked to the insect-resistant Cry2Ab protein (cCry2Ab) of Bacillus thuringiensis, and operably linked to the transcriptional terminator of nopaline synthase (tNos); the second expression cassette consists of the tandem repeat of the maize ubiquitin gene promoter Ubi containing an enhancer region (prZmUbi), operably linked to the insect-resistant gene Cry1Fa (cCry1Fa) of Bacillus thuringiensis, and operably linked to the terminator ORF25PolyA from Agrobacterium tumefaciens pTi15955; the third expression cassette consists of the cauliflower mosaic virus 35S promoter (pr35S), operably linked to the 5' untranslated leader sequence (lWtCab) of the wheat chloroplast a / b binding protein, operably linked to the rice actin gene 1 intron (iOsAct1), operably linked to the insect-resistant Cry1Ab protein (cCry1Ab) of Bacillus thuringiensis, and operably linked to the terminator of the benzenesulfonamide-inducible gene 2 (tIn2); the fourth expression cassette consists of the rice actin 1 promoter (prOsAct1), operably linked to the Arabidopsis chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase (cEPSPS) of Agrobacterium sp. strain CP4, and operably linked to the transcriptional terminator of nopaline synthase (tNos). A part of the insertion sequence from the left border region (LB) of Agrobacterium, and the maize plant LP026-3 flanking genomic region (SEQ ID NO:5) at the 3' end of the transgenic insertion sequence. In the DNA amplification method, the DNA molecule as a primer can be any part of the transgenic insertion sequence in the transgenic maize event LP026-3, or any part of the DNA region of the flanking maize genome in the transgenic maize event LP026-3.
[0117] The transgenic maize event LP026-3 can be combined with other transgenic maize varieties, such as maize with tolerance to herbicides (e.g., glufosinate, dicamba, etc.) or transgenic maize varieties carrying other insect-resistant genes (e.g., against chafers, white grubs, Diabrotica undecimpunctata howardi, etc.). All these various combinations of different transgenic events, when bred together with the transgenic maize event LP026-3 of the present invention, can provide improved hybrid transgenic maize varieties that are resistant to multiple pests and tolerant to multiple herbicides. These varieties can exhibit more excellent characteristics such as increased yield compared to non-transgenic varieties and single-trait transgenic varieties.
[0118] The present invention provides the transgenic maize event LP026-3, a nucleic acid sequence for detecting maize plants containing this event, and its detection method. The transgenic maize event LP026-3 is resistant to feeding damage by Lepidoptera pests and tolerant to the phytotoxic effects of agricultural herbicides containing glyphosate. This dual-trait maize plant expresses the Cry1Ab, Cry2Ab, and Cry1Fa proteins of Bacillus thuringiensis, which provide resistance to feeding damage by Lepidoptera pests (such as Ostrinia furnacalis, Spodoptera frugiperda); and it expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium sp. strain CP4, which confers glyphosate tolerance to the plant. The dual-trait maize has the following advantages: 1) protection from economic losses caused by Lepidoptera pests (such as Ostrinia furnacalis, Mythimna separata, Spodoptera frugiperda, Helicoverpa armigera, Agrotis ypsilon, and Conogethes punctiferalis, etc.); 2) the ability to apply agricultural herbicides containing glyphosate to maize crops for broad-spectrum weed control; 3) no reduction in maize yield. Specifically, the event LP026-3 of the present invention has a high level of resistance to target pests, with a pest mortality rate of up to 100% and a plant damage rate as low as 0%; it has a high tolerance to glyphosate herbicides, with a plant damage rate as low as 0%; and the plants containing this event have excellent agronomic traits, with a yield percentage as high as 100%. In addition, the genes encoding insect resistance and glyphosate tolerance traits are linked on the same DNA segment and exist at a single locus in the genome of the transgenic maize event LP026-3, which provides enhanced breeding efficiency and enables the tracking of transgenic insertion fragments in breeding populations and their progeny using molecular markers. At the same time, the primer or probe sequences provided in the detection method of the present invention can generate amplification products diagnostic of the transgenic maize event LP026-3 or its progeny, enabling the rapid, accurate, and stable identification of the presence of plant materials derived from the transgenic maize event LP026-3. BRIEF DESCRIPTION OF THE DRAWINGS
[0119] Figure 1 It is a schematic structural diagram of the binding site of the transgenic insertion sequence for detecting the nucleic acid sequence of maize plant LP026-3 and its detection method of the present invention to the maize genome;
[0120] Figure 2 Schematic diagram of the recombinant expression vector pLP026 for the nucleic acid sequence of maize plant LP026-3 and its detection method according to the present invention;
[0121] Figure 3 In vitro resistance effect of transgenic maize containing transgenic maize event LP026-3 according to the present invention against Lepidoptera pests;
[0122] Figure 4 Artificial inoculation effect diagram of transgenic maize containing transgenic maize event LP026-3 according to the present invention in the field against Ostrinia furnacalis;
[0123] Figure 5 Artificial inoculation effect diagram of transgenic maize containing transgenic maize event LP026-3 according to the present invention in the field against Helicoverpa armigera;
[0124] Figure 6 Field effect diagram of transgenic maize containing transgenic maize event LP026-3 according to the present invention under natural occurrence conditions of Conogethes punctiferalis;
[0125] Figure 7 Field effect diagram of transgenic maize containing transgenic maize event LP026-3 according to the present invention under natural occurrence conditions of Spodoptera exigua;
[0126] Figure 8 Field effect diagram of transgenic maize containing transgenic maize event LP026-3 according to the present invention under natural occurrence conditions of Spodoptera frugiperda.
[0127] Figure 9 Field effect diagram of transgenic maize containing transgenic maize event LP026-3 according to the present invention at the recommended field spraying concentration of 4-fold dose of glyphosate herbicide. Detailed implementation manners
[0128] The present invention is further described in detail below through examples. Through these exemplary descriptions, the features and advantages of the present invention will become clearer and more distinct.
[0129] Here, the professional term "exemplary" means "serving as an example, embodiment or illustration". Any embodiment described as "exemplary" here does not have to be construed as superior or better than other embodiments.
[0130] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0131] The technical solutions of the present invention for detecting the nucleic acid sequence of maize plant LP026-3 and its detection method are further described below through specific embodiments.
[0132] Example 1 Cloning and Transformation
[0133] 1.1 Vector Cloning
[0134] A recombinant expression vector pLP026 was constructed using standard gene cloning techniques (as Figure 2 shown). The vector pLP026 contains 4 tandem transgenic expression cassettes. The first expression cassette consists of the figwort mosaic virus 35s promoter (prFMV), operably linked to the intron of the maize heat shock protein gene HSP70 (iZmHSP70), operably linked to the maize chloroplast transit peptide 2 (spZmCTP2), operably linked to the insect-resistant Cry2Ab protein of Bacillus thuringiensis (cCry2Ab), and operably linked to the transcriptional terminator of nopaline synthase (tNos); the second expression cassette consists of the tandem repeated maize ubiquitin gene promoter Ubi containing an enhancer region (prZmUbi), operably linked to the insect-resistant gene Cry1Fa of Bacillus thuringiensis (cCry1Fa), and operably linked to the terminator ORF25PolyA from Agrobacterium tumefaciens pTi15955; the third expression cassette consists of the cauliflower mosaic virus 35S promoter (pr35S), operably linked to the 5'-untranslated leader sequence of the wheat chloroplast a / b binding protein (lWtCab), operably linked to the intron of the rice actin gene 1 (iOsAct1), operably linked to the insect-resistant Cry1Ab protein of Bacillus thuringiensis (cCry1Ab), and operably linked to the terminator of the benzenesulfonamide-inducible gene 2 (tIn2); the fourth expression cassette consists of the rice actin 1 promoter (prOsAct1), operably linked to the Arabidopsis chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase of Agrobacterium sp. strain CP4 (cEPSPS), and operably linked to the transcriptional terminator of nopaline synthase (tNos). The vector pLP026 was transformed into Agrobacterium tumefaciens LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by the liquid nitrogen method, and the transformed cells were screened using 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) as a selection marker.
[0135] 1.2 Plant Transformation
[0136] Transformation was carried out using the conventional Agrobacterium infection method. Immature maize embryos cultured aseptically were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pLP026 into the maize genome to generate transgenic maize events.
[0137] For Agrobacterium-mediated maize transformation, briefly, immature embryos were isolated from maize and contacted with an Agrobacterium suspension, wherein the Agrobacterium was capable of transferring the nucleic acid sequences of the cry1Ab, cry2Ab, cry1Fa genes and the nucleic acid sequence of the epsps gene to at least one cell of one of the immature embryos (Step 1: Infection step). In this step, the immature embryos were specifically immersed in the Agrobacterium suspension (OD660 = 0.4 - 0.6, infection medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetosyringone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3)) to initiate inoculation. The immature embryos were co-cultured with the Agrobacterium for a period of time (3 days) (Step 2: Co-culture step). Specifically, the immature embryos were cultured on a solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) after the infection step. After this co-culture stage, there could be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (such as cefotaxime) was present in the recovery medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8), and the selection agent for the plant transformant was not added (Step 3: Recovery step). Specifically, the immature embryos were cultured on a solid medium with antibiotics but without the selection agent to eliminate the Agrobacterium and provide a recovery period for the infected cells. Then, the inoculated immature embryos were cultured on a medium containing the selection agent (N-(phosphonomethyl)glycine) and the growing transformed calli were selected (Step 4: Selection step). Specifically, the immature embryos were cultured on a screening solid medium with the selection agent (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8), resulting in the selective growth of the transformed cells. Then, the calli were regenerated into plants (Step 5: Regeneration step). Specifically, the calli growing on the medium containing the selection agent were cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.
[0138] The selected resistant calli were transferred onto an MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH = 5.8) and cultured at 25°C for differentiation. The differentiated seedlings were transferred onto an MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8), cultured at 25°C until they reached about 10 cm in height, and then transferred to a greenhouse for cultivation until fruiting. In the greenhouse, they were cultured at 28°C for 16 hours per day and then at 20°C for 8 hours.
[0139] 1.3 Identification and screening of transgenic events
[0140] A total of 1,500 independent transgenic T0 plants were generated. Through molecular detection of all T0 plants (including the copy number of target genes, insertion sites, etc.), evaluation of target traits (insect resistance and herbicide tolerance), and agronomic traits, after excluding abnormal transformant plants, LP026-3 was selected.
[0141] Example 2 Detection of transgenic maize event LP026-3 using TaqMan
[0142] Approximately 100 mg of leaves from transgenic maize event LP026-3 were taken as samples, and their genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit. The copy numbers of cry1Ab, cry2Ab, cry1Fa, and epsps were detected by Taqman probe fluorescence quantitative PCR method. At the same time, wild-type maize plants were used as controls and detected and analyzed according to the above method. The experiment was repeated 3 times and the average value was taken.
[0143] The specific method is as follows:
[0144] Step 11: Take 100 mg of leaves from transgenic maize event LP026-3, grind them into a homogenate in a mortar with liquid nitrogen, and take 3 replicates for each sample;
[0145] Step 12: Extract the genomic DNA of the above samples using Qiagen's DNeasy Plant Mini Kit, and refer to its product manual for the specific method;
[0146] Step 13: Measure the concentration of genomic DNA of the above samples using NanoDrop 2000 (Thermo Scientific);
[0147] Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, and the range of the concentration value is 80-100 ng / μl;
[0148] Step 15: Use the Taqman probe fluorescence quantitative PCR method to identify the copy number of the samples. Use the samples with known copy numbers that have been identified as the standards, and use the samples of wild-type corn plants as the controls. Each sample has 3 replicates, and take the average value; the fluorescence quantitative PCR primer and probe sequences are as follows:
[0149] The following primers and probes are used to detect the cry1Ab gene sequence:
[0150] Primer 1: TGGGAGGACGGAATGATATTG as shown in SEQ ID NO:16 in the sequence listing;
[0151] Primer 2: AACTCGTCCGTGAGCATCATC as shown in SEQ ID NO:17 in the sequence listing;
[0152] Probe 1: AACTCCGCGCTGCGATGAATCC as shown in SEQ ID NO:18 in the sequence listing;
[0153] The following primers and probes are used to detect the cry2Ab gene sequence:
[0154] Primer 3: GGACAGAGGCACCGCATT as shown in SEQ ID NO:19 in the sequence listing;
[0155] Primer 4: CGGGTCTGCAAGCAAACG as shown in SEQ ID NO:20 in the sequence listing;
[0156] Probe 2: TCCACTTGGCGGTTGAACTCCTCC as shown in SEQ ID NO:21 in the sequence listing;
[0157] The following primers and probes are used to detect the cry1Fa gene sequence:
[0158] Primer 5: GCTATGTCCAGTCCCCAACCT as shown in SEQ ID NO:22 in the sequence listing;
[0159] Primer 6: CAAGCTGCTAACCTGCACTTGT as shown in SEQ ID NO:23 in the sequence listing;
[0160] Probe 3: CCCAAACGACACAGCGTCGCG as shown in SEQ ID NO:24 in the sequence listing;
[0161] The following primers and probes are used to detect the epsps gene sequence:
[0162] Primer 7: GCAAATCCTCTGGCCTTTCC as shown in SEQ ID NO:25 in the sequence listing;
[0163] Primer 8: TGAAGGACCGGTGGGAGAT as shown in SEQ ID NO:26 in the sequence listing;
[0164] Probe 4: CGTCCGCATTCCCGGCGA as shown in SEQ ID NO:27 in the sequence listing;
[0165] The PCR reaction system is
[0166]
[0167] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1× TE buffer, and is stored in amber tubes at 4°C.
[0168] The PCR reaction conditions are
[0169]
[0170] The data is analyzed using SDS 2.3 software (Applied Biosystems) to obtain the single-copy transgenic maize event LP026-3.
[0171] Example 3 Detection of Transgenic Maize Event LP026-3
[0172] 3.1 Genomic DNA Extraction
[0173] DNA extraction was carried out according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 grams of young leaves of transgenic maize event LP026-3 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB Buffer [20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)] preheated at 65 °C was added. The pH was adjusted to 8.0 with NaOH. After thorough mixing, extraction was carried out at 65 °C for 90 min; 0.5 volume of phenol and 0.5 volume of chloroform were added, and the mixture was inverted and mixed well; centrifugation was carried out at 12,000 rpm (revolutions per minute) for 10 min; the supernatant was aspirated, 1 volume of isopropanol was added, the centrifuge tube was gently shaken, and it was left to stand at -20 °C for 30 min; centrifugation was carried out again at 12,000 rpm for 10 min; the DNA was collected at the bottom of the tube; the supernatant was discarded, and the precipitate was washed with 0.5 mL of ethanol with a volume concentration of 70%; centrifugation was carried out at 12,000 rpm for 5 min; vacuum drying or air drying was carried out in a laminar flow hood; the DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20 °C.
[0174] 3.2 Analysis of flanking DNA sequences
[0175] The concentration of the above-extracted DNA sample was measured to make the concentration of the sample to be measured between 80-100 ng / μL. The genomic DNA was digested with the selected restriction endonucleases SpeI, PstI, BssHII (5'-end analysis) and SacI, KpnI, XmaI, NheI (3'-end analysis) respectively. In each digestion system, 26.5 μL of genomic DNA, 0.5 μL of the above-selected restriction endonuclease and 3 μL of digestion buffer were added, and digested at an appropriate temperature for 1 hour. After the digestion was completed, 70 μL of absolute ethanol was added to the digestion system, incubated on ice for 30 min, centrifuged at 12,000 rpm for 7 min, the supernatant was discarded, and dried. Then 8.5 μL of double-distilled water (ddH2O), 1 μL of 10X T4 Buffer and 0.5 μL of T4 ligase were added and ligated overnight at 4 °C. A series of nested primers were used for PCR amplification to isolate the 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for isolating the 5' transgenic / genomic DNA included SEQ ID NO:13 and SEQ ID NO:34 as the first primers, SEQ ID NO:35 and SEQ ID NO:36 as the second primers, and SEQ ID NO:13 as the sequencing primer. The primer combination for isolating the 3' transgenic / genomic DNA included SEQ ID NO:15 and SEQ ID NO:37 as the first primers, SEQ ID NO:38 and SEQ ID NO:39 as the second primers, and SEQ ID NO:15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.
[0176] The obtained amplicons were electrophoresed on a 2.0% agarose gel to separate the PCR reactants, and then the target fragments were separated from the agarose matrix using a QIAquick Gel Extraction Kit (Catalog #_28704, Qiagen Inc., Valencia, CA). Then the purified PCR products were sequenced (e.g., ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).
[0177] The 5' and 3' flanking sequences and the junction sequences were confirmed using standard PCR methods. The 5' flanking sequence and the junction sequence can be confirmed using SEQ ID NO:8 or SEQ ID NO:12, in combination with SEQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:34. The 3' flanking sequence and the junction sequence can be confirmed using SEQ ID NO:11 or SEQ ID NO:14, in combination with SEQ ID NO:10, SEQ ID NO:15 or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Table 3. Those skilled in the art will understand that other primer sequences can also be used to confirm the flanking sequences and the junction sequences.
[0178] DNA sequencing of the PCR product provides DNA that can be used to design other DNA molecules that serve as primers and probes for the identification of maize plants or seeds derived from the transgenic maize event LP026-3.
[0179] It was found that the maize genomic sequence shown at nucleotides 1-677 of SEQ ID NO:5 is flanking the right border (5' flanking sequence) of the insertion sequence in the transgenic maize event LP026-3, and the maize genomic sequence shown at nucleotides 16805-17611 of SEQ ID NO:5 is flanking the left border (3' flanking sequence) of the insertion sequence in the transgenic maize event LP026-3. The 5' junction sequence is listed in SEQ ID NO:1, and the 3' junction sequence is listed in SEQ ID NO:2.
[0180] 3.3, PCR Conjunctivity Assay
[0181] Junction sequences are relatively short polynucleotide molecules that are novel DNA sequences and are diagnostic for the DNA of transgenic maize event LP026-3 when detected in a polynucleic acid detection assay. The junction sequence of SEQ ID NO:1 consists of 11 bp each on one side of the T-DNA RB region insertion site and the maize genomic DNA insertion site of transgenic maize event LP026-3. The junction sequence of SEQ ID NO:2 consists of 11 bp each on one side of the T-DNA LB region insertion site and the other side of the maize genomic DNA insertion site of transgenic maize event LP026-3. Longer or shorter polynucleotide junction sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The junction sequences (5'-junction region SEQ ID NO:1 and 3'-junction region SEQ ID NO:2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The junction sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences in transgenic maize event LP026-3 and can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic maize event LP026-3 DNA. The said SEQ ID NO:6 (nucleotides 678-1177 of SEQ ID NO:3) spans the LP026 construct DNA sequence and the tNos transcriptional termination sequence, and the SEQ ID NO:7 (nucleotides 1-225 of SEQ ID NO:4) spans the tNos transcriptional termination sequence and the LP026 construct DNA sequence.
[0182] In addition, by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4 to generate an amplicon, the primer generates a diagnostic amplicon of transgenic maize event LP026-3 when used in a PCR method.
[0183] Specifically, a PCR product is generated from the 5'-end of the transgenic insertion sequence, and this PCR product is a part of the genomic DNA flanking the 5'-end of the T-DNA insertion sequence in the genome of plant material derived from transgenic maize event LP026-3. This PCR product contains SEQ ID NO:3. For PCR amplification, primer 11 (SEQ ID NO:8) that hybridizes to the genomic DNA sequence flanking the 5'-end of the transgenic insertion sequence and primer 12 (SEQ ID NO:9) located in the transgenic tNos transcriptional termination sequence are designed.
[0184] A PCR product is generated from the 3' end of the transgenic insertion sequence, which contains a portion of the genomic DNA flanking the 3' end of the T-DNA insertion sequence in the genome of plant material derived from the transgenic maize event LP026-3. This PCR product contains SEQ ID NO:4. For PCR amplification, primer 14 (SEQ ID NO:11) that hybridizes to the genomic DNA sequence flanking the 3' end of the transgenic insertion sequence, and primer 13 (SEQ ID NO:10) that pairs with the tNos transcriptional termination sequence at the 3' end of the insert are designed.
[0185] The DNA amplification conditions described in Tables 3 and 4 can be used for the above PCR zygosity test to generate diagnostic amplicons for the transgenic maize event LP026-3. Detection of the amplicons can be carried out by using a Stratagene Robocycle, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermal cycler, etc., or by methods and equipment known to those skilled in the art.
[0186] Table 3. PCR procedures and reaction mixture conditions for identification of the 5' transgenic insert / genomic junction region of the transgenic maize event LP026-3
[0187]
[0188] Table 4. Perkin-Elmer 9700 thermal cycler conditions
[0189]
[0190]
[0191] Mix gently. If there is no thermal cover on the thermal cycler, add 1 - 2 drops of mineral oil on top of each reaction. Perform PCR using the cycling parameters in Table 4 on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R - Biorad, Hercules, CA), Perkin - Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in the calculated mode. The Perkin - Elmer 9700 thermal cycler should be run with the ramp speed set to the maximum value.
[0192] The experimental results showed that primers 11 and 12 (SEQ ID NO:8 and 9), when used in the PCR reaction of the transgenic maize event LP026 - 3 genomic DNA, produced an amplification product of a 1177 - bp fragment, and when used in the PCR reactions of untransformed maize genomic DNA and non - LP026 - 3 maize genomic DNA, no fragment was amplified; primers 13 and 14 (SEQ ID NO:10 and 11), when used in the PCR reaction of the transgenic maize event LP026 - 3 genomic DNA, produced an amplification product of a 1032 - bp fragment, and when used in the PCR reactions of untransformed maize genomic DNA and non - LP026 - 3 maize genomic DNA, no fragment was amplified.
[0193] The PCR zygosity assay can also be used to identify whether the materials derived from the transgenic maize event LP026 - 3 are homozygous or heterozygous. Use primer 15 (SEQ ID NO:12), primer 16 (SEQ ID NO:13), and primer 17 (SEQ ID NO:14), or primer 16 (SEQ ID NO:13), primer 17 (SEQ ID NO:14), and primer 18 (SEQ ID NO:15) in the amplification reaction to generate diagnostic amplicons of the transgenic maize event LP026 - 3. The DNA amplification conditions described in Tables 5 and 6 can be used for the above zygosity test to generate diagnostic amplicons of the transgenic maize event LP026 - 3.
[0194] Table 5. Zygosity assay reaction mixture
[0195]
[0196]
[0197] Table 6, Conditions of the Conjugation Assay in Perkin-Elmer 9700 Thermal Cycler
[0198]
[0199] PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the cycling parameters in Table 6. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in the calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to the maximum value.
[0200] In the amplification reaction, a biological sample containing template DNA contains DNA for diagnosing the presence of transgenic maize event LP026-3 in the sample. Alternatively, the reaction will produce two different DNA amplicons from a biological sample containing DNA from the maize genome that is heterozygous for the allele corresponding to the inserted DNA present in transgenic maize event LP026-3. These two different amplicons will correspond to a first amplicon from the wild-type maize genome locus and a second amplicon that diagnoses the presence of transgenic maize event LP026-3 DNA. A maize DNA sample that produces only a single amplicon corresponding to the second amplicon described for the heterozygous genome can diagnostically determine the presence of transgenic maize event LP026-3 in the sample, and the sample is produced from maize seeds that are homozygous for the allele corresponding to the inserted DNA present in transgenic maize plant LP026-3. It should be noted that primer pairs for transgenic maize event LP026-3 are used to produce amplicons that are diagnostic for the genomic DNA of transgenic maize event LP026-3. These primer pairs include, but are not limited to, primers 11 and 12 (SEQ ID NO:8 and 9), and primers 13 and 14 (SEQ ID NO:10 and 11), for use in the DNA amplification method described. Additionally, a control primer pair 9 and 10 (SEQ ID NO:28 and SEQ ID NO:29) for amplifying an endogenous maize gene is included as an internal standard for the reaction conditions. Analysis of a DNA extraction sample of transgenic maize event LP026-3 should include a positive tissue DNA extract control for transgenic maize event LP026-3, a negative DNA extract control from a non-transgenic maize event LP026-3, and a negative control without a template maize DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO:3 or SEQ ID NO:4, or their complementary sequences, can be used when they are used in a DNA amplification reaction to respectively produce an amplicon containing SEQ ID NO:1 or SEQ ID NO:2 that is diagnostic for tissue from a transgenic event maize plant LP026-3. The DNA amplification conditions described in Tables 2 - 5 can be used with appropriate primer pairs to produce diagnostic amplicons of transgenic maize event LP026-3. An extract that presumptively contains maize plant or seed DNA containing transgenic maize event LP026-3, or a product derived from transgenic maize event LP026-3, that produces an amplicon diagnostic for transgenic maize event LP026-3 when tested in a DNA amplification method can be used as a template for amplification to determine the presence of transgenic maize event LP026-3.
[0201] Example 4 Detection of Transgenic Maize Event LP026-3 by Southern Blot Hybridization
[0202] 4.1 DNA Extraction for Southern Blot Hybridization
[0203] Southern blot analysis was performed using homozygous transformation events of the T4 and T5 generations. Approximately 5 to 10 g of plant tissue was ground in a mortar and pestle in liquid nitrogen. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone, 3% sarcosyl, 20% ethanol) and incubated at 37 °C for 30 minutes. During incubation, the sample was mixed once with a sterile loop. After incubation, an equal volume of chloroform / isopentanol (24:1) was added, gently mixed by inverting, and centrifuged at 4000 rpm for 20 minutes. The aqueous layer was collected, and DNA was precipitated by centrifuging at 4000 rpm for 5 minutes after adding 0.54 volume of isopropanol. The supernatant was discarded, and the DNA pellet was resuspended in 500 μL of TE. To degrade any existing RNA, the DNA and 1 μL of 30 mg / mL RNase A were incubated at 37 °C for 30 minutes, centrifuged at 4000 rpm for 5 minutes, and DNA was precipitated by centrifuging at 14000 rpm for 10 minutes in the presence of 0.5 volume of 7.5 M ammonium acetate and 0.54 volume of isopropanol. After discarding the supernatant, the pellet was washed with 500 μL of 70% ethanol by volume, dried, and resuspended in 100 μL of TE.
[0204] 4.2 Restriction Enzyme Digestion
[0205] The DNA concentration was quantitatively detected using a spectrophotometer or fluorometer (using 1× TAE and GelRED dye). In a 100 μL reaction system, 5 μg of DNA was digested each time. The genomic DNA was digested with the restriction enzymes BamHI and HindIII respectively, and partial sequences of Cry2Ab and EPSPS on the T-DNA were used as probes; the genomic DNA was digested with the restriction enzymes AvrII and HindIII respectively, and partial sequences of Cry1Ab and Cry1Fa on the T-DNA were used as probes. For each enzyme, the digest was incubated overnight at the appropriate temperature. The samples were rotated using a speed vacuum to reduce the volume to 30 μL.
[0206] 4.3, Gel Electrophoresis
[0207] Add bromophenol blue loading dye to each sample derived from Example 4.2, and load each sample onto a 0.7% agarose gel containing ethidium bromide, and perform electrophoresis separation in TBE electrophoresis buffer, and electrophorese the gel overnight at 20 volts.
[0208] Wash the gel in 0.25 M HCl for 15 minutes to depurinate DNA, and then wash with water. Set up Southern blot hybridization as follows: Place 20 thick dry blotting papers in a tray, and then place 4 thin dry blotting papers on top. Pre-wet 1 thin blotting paper in 0.4 M NaOH and place it on the stack of papers, then place a Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wet in 0.4 M NaOH on it. Place the gel on top, ensuring there are no air bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers are placed on top of the gel, and the buffer tray is filled with 0.4 M NaOH. Connect the gel stack and the buffer tray with a wick pre-soaked in 0.4 M NaOH to transfer the DNA to the membrane. Perform DNA transfer for approximately 4 hours at room temperature. After transfer, rinse the Hybond membrane in 2×SSC for 10 seconds, and bind the DNA to the membrane by UV cross-linking.
[0209] 4.4, Hybridization
[0210] Suitable DNA sequences were amplified by PCR for probe preparation. The DNA probes were SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33, or were partially homologous or complementary to the above sequences. 25 ng of probe DNA was boiled in 45 μL of TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5 μL of 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37 °C for 15 minutes. The probe was purified by centrifugation through a MicroSpin G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. The probe activity was measured using a scintillation counter. The Hybond membrane was prehybridized by wetting it with 20 mL of pre-warmed Church prehybridization solution (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA) at 65 °C for 30 minutes. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. An appropriate amount of probe (1 million counts per 1 mL of prehybridization buffer) was added to the prehybridization buffer, and hybridization was carried out overnight at 65 °C. The next day, the hybridization buffer was discarded, and after rinsing with 20 mL of Church wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), the membrane was washed in 150 mL of Church wash solution 1 at 65 °C for 20 minutes. This process was repeated 2 times with Church wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). The membrane was exposed to a phosphor screen or X-ray film to detect the positions where the probe bound.
[0211] Each Southern included two control samples: (1) DNA from negative (untransformed) segregants, which was used to identify any endogenous maize sequences that could hybridize to the element-specific probe; (2) DNA from positive segregants, in which HindIII-digested pLP026 was introduced, and the amount was equivalent to one copy number based on the probe length, to illustrate the sensitivity of the experiment in detecting a single gene copy within the maize genome.
[0212] The hybridization data provided conclusive evidence to support TaqMan TMPCR analysis indicated that the maize plant LP026-3 contained a single copy of the Cry2Ab, Cry1Fa, Cry1Ab, and EPSPS genes. Using the Cry2Ab probe, digestion with BamHI and HindIII produced single bands of approximately 2.9 kb and 9.2 kb, respectively; using the Cry1Fa probe, digestion with AvrII and HindIII produced single bands of approximately 10.0 kb and 13.0 kb, respectively; using the Cry1Ab probe, digestion with AvrII and HindIII produced single bands of approximately 9.1 kb and 13.0 kb, respectively; using the EPSPS probe, digestion with BamHI and HindIII produced single bands of approximately 9.9 kb and 13.0 kb, respectively. This indicated that one copy each of Cry1Ab, Cry2Ab, Cry1Fa, and EPSPS was present in the maize transformation event LP026-3.
[0213] Example 5 Insect Resistance Detection
[0214] 5.1 Bioassay of Maize Plant LP026-3
[0215] The transgenic maize event LP026-3 and two wild-type maize plants (non-transgenic, transformation recipient control (CK-)) were bioassayed against Ostrinia furnacalis, Spodoptera frugiperda, Conogethes punctiferalis, Athetis lepigone, Mythimna seperata, Agrotis ypsilon, Helicoverpa armigera, and Spodoptera exigua according to the following method:
[0216] Fresh leaves (at V3-V4 stage) were separately collected from transgenic maize event LP026-3 and wild-type maize plants (non-transgenic, transformation receptor control (CK-)). The leaves were rinsed thoroughly with sterile water and then dried with absorbent paper. Next, the leaf veins were removed, and the leaves were cut into strips approximately 1 cm × 3 cm in size. One to three strips (determined according to the insect's food intake) were placed on filter paper at the bottom of a round plastic petri dish. The filter paper was moistened with distilled water. Ten newly hatched larvae reared artificially were introduced into each petri dish. After covering the petri dishes for the insect tests, the results were counted after 5 days under the conditions of a temperature of 26-28 °C, a relative humidity of 70%-80%, and a photoperiod (light / dark) of 16:8. The mortality rate was counted, and the resistance level was identified by the corrected mortality rate (Corrected mortality rate (%) = (1 - number of survivors / number of insects inoculated - wild-type control mortality rate) / (1 - wild-type control mortality rate) × 100%). The results are shown in Table 7 and Figure 3 as follows.
[0217] Table 7. In vitro insecticidal bioassay results of transgenic maize event LP026-3 - Mortality rate (%)
[0218]
[0219] 5.2. Determination of field insecticidal effect of transgenic maize event LP026-3
[0220] (1) Asian corn borer
[0221] The resistance of transgenic maize event LP026-3 to the main target pest Asian corn borer in the field was identified by the method of live insect inoculation. Insects were inoculated at the 4-6 leaf stage and silking stage (the silk of the female ear was 3-5 cm long) of maize. Insects were inoculated twice at each stage, 50 insects each time, and the interval between the two inoculations was one week. Fourteen days after inoculation at the whorl stage, the feeding situation of the upper and middle leaves of maize plants by Asian corn borers was investigated plant by plant, and the leaf feeding level of Asian corn borers was recorded. After inoculation at the silking stage, the damage degree of the female ear and the damage situation of the plants were investigated before harvest, including the damaged length of the maize female ear, the number of boreholes, the length of the borehole tunnels, the instar and the number of surviving larvae. The resistance of transgenic maize event LP026-3 to Asian corn borer was evaluated using the "grading standard for the damage degree of Asian corn borer to maize whorl leaves" as an index. The results are shown in Figure 4And Table 12. At the silking stage, the ears of corn were dissected for investigation, and the statistical results are shown in Table 13. The results showed that at the whorl stage, the average leaf-eating level of transgenic maize event LP026-3 was significantly lower than that of the transformation receptor control (CK-); at the silking stage, the ear damage rate, the number of surviving larvae, the tunnel length, and the ear damage level of transgenic maize event LP026-3 were all significantly lower than those of the transformation receptor control (CK-). Generally speaking, at the whorl stage and the silking stage, transgenic maize event LP026-3 had good resistance to Asian corn borer.
[0222] Table 8. Grading standards for the damage degree of Asian corn borer to corn whorl
[0223] Leaf-eating level Symptom description 1 The leaf is not damaged, or there are only needle-like (≤1 mm) insect holes on the leaf 2 There are only a small number of bullet-hole sized (≤5 mm) insect holes on individual leaves 3 A small number of leaves have bullet-hole sized (≤5 mm) insect holes 4 Individual leaves have notches (≤10 mm) 5 A small number of leaves have notches (≤10 mm) 6 Some leaves have notches (≤10 mm) 7 Individual leaves are partially eaten, and a small number of leaves have large notches (≤10 mm) 8 A small number of leaves are eaten, and some leaves have large notches (≤10 mm) 9 Most of the leaves are eaten
[0224] Table 9. Evaluation standards for the resistance of corn to Asian corn borer
[0225] Average leaf-eating level at the whorl stage Resistance level 1.0-2.9 Highly resistant (HR) 3.1-4.9 Resistant (R) 5.0-6.9 Moderately resistant (MR) 7.0-8.9 Susceptible (S) 9.0 Highly susceptible (HS)
[0226] Table 10. Grading standards for the damage degree of Asian corn borer to corn at the ear stage
[0227]
[0228]
[0229] Table 11. Evaluation standards for the resistance of corn at the ear stage to Asian corn borer
[0230] Average damage level of the female ear Resistance type 1-2.0 Highly resistant (HR) 2.1-3.0 Resistant (R) 3.1-5.0 Moderately resistant (MR) 5.1-7.0 Susceptible (S) ≥7.1 Highly susceptible (HS)
[0231] Table 12. Resistance results of transgenic maize event LP026-3 to Asian corn borer at the whorl stage
[0232] Item / plant LP026-3 CK- Average leaf-eating level 1.23 9.3 Resistance level Highly resistant Highly susceptible
[0233] Table 13. Resistance results of transgenic maize event LP026-3 to Asian corn borer at the silking stage
[0234] Item / plant LP026-3 CK- Damage rate of female ear (%) 0 100 Number of surviving larvae 0 16 Tunnel length (cm) 0 1.9 Damage level of female ear 0 6.7 Resistance level Highly resistant Susceptible
[0235] (2) Mythimna separata
[0236] Artificial insect inoculation was carried out at the whorl stage (4 - 6 leaves) of maize, with a total of 2 inoculations. 20 second-instar Mythimna separata larvae reared artificially were inoculated into the whorl of each maize plant. 3 days after the first inoculation, the second inoculation was carried out with the same number of larvae as the first. 14 days after the inoculation, the damage degree of maize leaves caused by Mythimna separata was investigated. According to the damage degree of maize leaves caused by Mythimna separata, the average value of the damage level (leaf-eating level) of Mythimna separata to maize leaves in each plot was calculated. The judgment criteria are shown in Table 14, and then the resistance level of maize to Mythimna separata was judged according to the criteria in Table 15. The resistance results of transgenic maize event LP026-3 to Mythimna separata at the whorl stage are shown in Table 16. The results show that transgenic maize event LP026-3 has a good resistance level to Mythimna separata, and the notch ratio and leaf-eating level of transgenic maize event LP026-3 are significantly lower than those of the transformation receptor control (CK-).
[0237] Table 14. Grading criteria for the damage degree of maize leaves caused by Mythimna separata
[0238] Damage level of female ear Symptom description 1 The leaf is not damaged, or there are only needle-like (≤1 mm) insect holes on the leaf 2 There are only a small number of bullet-hole sized (≤5 mm) insect holes on individual leaves 3 A small number of leaves have bullet-hole sized (≤5 mm) insect holes 4 Individual leaves have notches (≤10 mm 5 A small number of leaves have notches (≤10 mm) 6 Some leaves have notches (≤10 mm) 7 Individual leaves are partially eaten, and a small number of leaves have large notches (≤10 mm) 8 A small number of leaves are eaten, and some leaves have large notches (≤10 mm) 9 Most of the leaves are eaten
[0239] Table 15. Resistance evaluation criteria for maize to Mythimna separata
[0240] Average damage level of female ear Resistance type 1.0-2.0 Highly resistant (HR) 2.1-4.0 Resistant (R) 4.1-6.0 Moderately resistant (MR) 6.1-8.0 Susceptible (S) 8.1-9.0 Highly susceptible (HS)
[0241] Table 16. Resistance results of transgenic maize event LP026-3 to Mythimna separata at the whorl stage
[0242] Item / plant LP026-3 CK- Average leaf-eating level 1.3 7.8 Resistance level Highly resistant Susceptible
[0243] (3) Helicoverpa armigera
[0244] Artificial insect inoculation was carried out on transgenic maize event LP026-3 at the silking stage. A total of 2 inoculations were carried out, and 20 newly hatched larvae reared artificially were inoculated into the silks of each maize plant. 3 days after the first inoculation, the second inoculation was carried out with the same number of larvae as the first. 14 - 21 days after the inoculation, the damage rate of the female ear, the number of surviving larvae per female ear, and the damaged length of the female ear were investigated plant by plant. Usually, the investigation starts 14 days after the inoculation. If the damage level of the negative control material (CK-) reaches susceptible or highly susceptible, it is regarded as effective. If it does not reach the corresponding level, the investigation can be postponed appropriately, but if the corresponding level is still not reached 21 days after the inoculation, this inoculation is regarded as invalid. According to the damage rate of the female ear, the number of surviving larvae, and the damaged length of the female ear (cm), the average value of the damage level of Helicoverpa armigera to the female ear at the ear stage of maize in each plot was calculated. The judgment criteria are shown in Table 17, and then the resistance level of maize at the ear stage to Helicoverpa armigera was judged according to the criteria in Table 18. The resistance results of transgenic maize event LP026-3 to Helicoverpa armigera at the silking stage are as follows Figure 5As shown in Table 19. The results showed that the transgenic maize event LP026-3 had a high resistance level to Helicoverpa armigera, and the damage rate of the female ear, the number of surviving larvae, the damaged length of the female ear, and the damage level of the female ear of the transgenic maize event LP026-3 were significantly lower than those of the transformation receptor control (CK-).
[0245] Table 17. Grading standard for the damage degree of maize female ears by Helicoverpa armigera
[0246] Damage level of female ear Symptom description 0 The female ear is not damaged 1 Only the silk is damaged 2 The top of the ear is damaged by 1 cm 3+ For each additional 1 cm of damage below the top of the ear, the corresponding damage level increases by 1 level …N
[0247] Table 18. Resistance evaluation standard of maize female ears to Helicoverpa armigera
[0248] Average damage level of female ear Resistance type 0-1.0 Highly resistant (HR) 1.1-3.0 Resistant (R) 3.1-5.0 Moderately resistant (MR) 5.1-7.0 Susceptible (S) ≥7.1 Highly susceptible (HS)
[0249] Table 19. Resistance results of transgenic maize event LP026-3 to Helicoverpa armigera at the silking stage
[0250]
[0251]
[0252] (4) Conogethes punctiferalis
[0253] In July 2021, a field natural infestation experiment of Conogethes punctiferalis was carried out in the transgenic maize planting base in Jian'an District, Xuchang City, Henan Province. 14 - 21 days after the initial pest infestation, and when the control (CK-) plants were mostly damaged by 4 - 5 instar larvae, the damage rate of Conogethes punctiferalis to maize plants was investigated plant by plant. The resistance results of the transgenic maize event LP026-3 to Conogethes punctiferalis are as Figure 6 shown in Table 20. The results showed that under the natural occurrence conditions of Conogethes punctiferalis, compared with the control (CK-), the damage rate of Conogethes punctiferalis to the transgenic maize event LP026-3 was significantly reduced, indicating that the transgenic maize event LP026-3 had a high resistance to Conogethes punctiferalis.
[0254] Table 20. Resistance results of transgenic maize event LP026-3 to Conogethes punctiferalis under natural infestation conditions
[0255] Item / plant LP026-3 CK- Damage rate (%) 0 75
[0256] (5) Spodoptera exigua
[0257] In March 2021, a field natural infestation experiment of Spodoptera exigua was carried out in the transgenic maize planting base in Yazhou District, Sanya City, Hainan Province. 10 - 15 days after the initial pest infestation, and when the control (CK-) plants were mostly damaged by 4 - 6 instar larvae, the damage rate of Spodoptera exigua to maize plants was investigated plant by plant. The resistance results of the transgenic maize event LP026-3 to Spodoptera exigua are as Figure 7As shown in Table 21. The results showed that under the natural occurrence conditions of Spodoptera exigua, compared with the control (CK-), the damage rate of Spodoptera exigua to the transgenic maize event LP026-3 was significantly reduced, indicating that the transgenic maize event LP026-3 had high resistance to Spodoptera exigua.
[0258] Table 21. Resistance results of transgenic maize event LP026-3 to Spodoptera exigua under natural insect infection conditions
[0259] Item / plant LP026-3 CK- Damage rate (%) 0 95
[0260] (6) Spodoptera frugiperda
[0261] In March 2021, a field natural insect infection experiment of Spodoptera frugiperda was carried out in the transgenic maize planting base in Yazhou District, Sanya City, Hainan Province. 10-15 days after the initial occurrence of insect pests, and when the control (CK-) was mostly damaged by 4-6 instar old larvae, the damage rate of Spodoptera frugiperda to maize plants was investigated plant by plant. The resistance results of transgenic maize event LP026-3 to Spodoptera frugiperda are shown in Table 22, and the field resistance effect is shown in Figure 8 . The results showed that under the natural occurrence conditions of Spodoptera frugiperda, compared with the control (CK-), the damage rate of Spodoptera frugiperda to the transgenic maize event LP026-3 was significantly reduced, indicating that the transgenic maize event LP026-3 had high resistance to Spodoptera frugiperda.
[0262] Table 22. Resistance results of transgenic maize event LP026-3 to Spodoptera frugiperda under natural insect infection conditions
[0263] Item / plant LP026-3 CK- Damage rate (%) 0 100
[0264] Example 6 Detection of herbicide tolerance of maize transformation events
[0265] In this experiment, Roundup herbicide (41% glyphosate isopropylammonium aqueous solution) was selected for spraying. A randomized block design was adopted with 3 replicates. The plot area was 15m 2(5m × 3m), row spacing 60cm, plant spacing 25cm, conventional cultivation and management, with a 1m-wide isolation belt between plots. The transgenic maize event LP026-3 was subjected to the following two treatments: 1) not sprayed; 2) sprayed with Roundup herbicide at a dose of 1680 g a.e. / ha at the V3 leaf stage, and then sprayed again with Roundup herbicide at the same dose at the V8 stage. It should be noted that glyphosate herbicides with different contents and formulations are converted into the form of equivalent glyphosate acid for the following conclusions. The phytotoxicity symptoms were investigated 1 week and 2 weeks after application, and the yield of each plot was measured at harvest. The classification criteria for the phytotoxicity of glyphosate herbicides on maize are shown in Table 23. The herbicide injury rate was used as an evaluation index to evaluate the herbicide tolerance of the transformation event. Specifically, the herbicide injury rate (%) = ∑(number of plants damaged at the same level × level number) / (total number of plants × highest level); where the herbicide injury rate refers to the glyphosate injury rate, and the glyphosate injury rate was determined based on the phytotoxicity survey results 2 weeks after glyphosate treatment. The maize yield of each plot was the total yield (weight) of the corn kernels in the middle 3 rows of each plot. The yield difference between different treatments was measured in the form of a yield percentage, and the yield percentage (%) = sprayed yield / unsprayed yield. The results of the herbicide tolerance of the transgenic maize event LP026-3 and the maize yield results are as Figure 9 shown in Table 24.
[0266] Table 23. Classification criteria for the phytotoxicity of glyphosate herbicides on maize
[0267]
[0268]
[0269] Table 24. Results of the herbicide tolerance of the transgenic maize event LP026-3 to glyphosate herbicides and maize yield results
[0270] Item / plant LP026-3 CK- Glyphosate damage rate (%) (sprayed with clear water) 0 0 Glyphosate damage rate (%) (Roundup 800 ml / acre, recommended application rate 150 - 250 ml / acre) 0 100 Yield percentage (%) (Roundup 800 ml / acre, recommended application rate 150 - 250 ml / acre) 100 0
[0271] The results showed that in terms of the herbicide (glyphosate) injury rate: 1) The injury rate of the transgenic maize event LP026-3 was basically 0 under the treatment of glyphosate herbicide (800 ml / mu). Therefore, the transgenic maize event LP026-3 has good tolerance to glyphosate herbicides.
[0272] In terms of yield: There was no significant difference in the yield of the transgenic maize event LP026-3 between the two treatments of not spraying and spraying 800 ml / mu of glyphosate. After spraying the glyphosate herbicide, the yield of the transgenic maize event LP026-3 basically did not decrease. Therefore, it further shows that the transgenic maize event LP026-3 has good tolerance to glyphosate herbicides.
[0273] In summary, through TaqMan TMAnalysis (see Example 2) detected the presence of cry1Ab, cry2Ab, cry1Fa, and epsps genes in the regenerated transgenic maize plants and characterized the copy numbers of the insect resistance and glyphosate herbicide tolerance lines. Based on the copy numbers of the target genes, good insect resistance, glyphosate herbicide tolerance, and agronomic trait performance (see Examples 5 and 6), event LP026-3 was selected as excellent through screening. It has a single-copy transgene, good insect resistance, glyphosate herbicide tolerance, and agronomic trait performance (Examples 5 and 6).
[0274] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A nucleic acid molecule of the transgenic maize event LP026-3, characterized in that, The nucleic acid molecule comprises the sequence shown in SEQ ID NO:5 or its complementary sequence. The nucleic acid molecule is derived from a transgenic plant, seed or cell comprising the transgenic maize event LP026-3. Maize seeds comprising said event have been deposited under accession number CCTCC NO:P202208.
2. A DNA primer pair, comprising a first primer and a second primer, characterized in that, When the first primer and the second primer are used in an amplification reaction together with DNA containing the transgenic maize event LP026-3, an amplicon of the transgenic maize event LP026-3 in the test sample is generated. The first primer is selected from SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:
14. Maize seeds comprising said event have been deposited under accession number CCTCC NO:P202208.
3. A method for detecting the presence of DNA of transgenic maize event LP026-3 in a sample, characterized in that, Comprising: (1) contacting a test sample with the DNA primer pair according to claim 2 in a nucleic acid amplification reaction; (2) performing a nucleic acid amplification reaction; (3) detecting the presence of the amplification product; If the sequence of the amplification product comprises any one of the sequences of SEQ ID NO:1-4 or its complementary sequence, it indicates that the test sample contains the DNA of the transgenic maize event LP026-3. Maize seeds comprising said event have been deposited under accession number CCTCC NO:P202208.
4. A DNA detection kit, characterized in that, Comprising: The DNA primer pair according to claim 2.
5. A method for protecting maize plants from insect attack, characterized in that, Comprising providing at least one transgenic maize plant cell comprising the nucleic acid molecule of the transgenic maize event LP026-3 according to claim 1 in the diet of a target insect; the target insect feeding on the transgenic maize plant cell is inhibited from further feeding on the maize plant. Maize seeds comprising said event have been deposited under accession number CCTCC NO:P202208. The insect is a Lepidoptera insect.
6. A method for protecting maize plants from damage caused by herbicides, characterized in that, Planting at least one transgenic maize plant comprising the nucleic acid molecule of the transgenic maize event LP026-3 according to claim 1, and applying an effective dose of glyphosate herbicide. Maize seeds comprising said event have been deposited under accession number CCTCC NO:P202208. The herbicide is glyphosate.
7. A method for controlling weeds in a field of planted maize plants, characterized in that, Comprising applying an effective dose of glyphosate herbicide to a field in which at least one transgenic maize plant is planted, the transgenic maize plant comprising the nucleic acid molecule of the transgenic maize event LP026-3 according to claim 1. Maize seeds comprising said event have been deposited under accession number CCTCC NO:P202208.
8. A method for cultivating a maize plant that is resistant to insects and / or tolerant to glyphosate herbicide, characterized in that, Comprising: Planting at least one maize seed comprising the nucleic acid molecule of the transgenic maize event LP026-3 according to claim 1; Growing the maize seed into a maize plant; Infest the maize plants with a target insect and / or spray the maize plants with an effective dose of glyphosate herbicide, and harvest plants with reduced plant damage compared to other plants that do not have the transgenic maize event LP026-3. Maize seeds containing the event have been deposited under accession number CCTCC NO: P202208. The insect is a Lepidoptera insect.
Citation Information
Patent Citations
Detection of AAD-12 soybean event 416
CA2781622A1
Transgenic maize event LP007-4 and detection method thereof
CN112831585A