Application of a reagent overexpressing HS3ST5 gene in promoting viral infection and recombinant CHO-K1 cell line

By constructing a recombinant lentiviral plasmid overexpressing the HS3ST5 gene and screening the CHO-K1 cell line, the problem of insufficient HS3ST5 gene expression was solved, the viral adsorption and replication capabilities were improved, and a basis for viral infection models was provided.

CN116144707BActive Publication Date: 2026-02-13LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211248062.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-12
Publication Date
2026-02-13
Estimated Expiration
2042-10-12

AI Technical Summary

Technical Problem

There is a lack of cell lines that stably express the HS3ST5 gene in the current technology, and the effects of HS3ST5 on viral infection are not well studied, especially its effects on the adsorption, internalization and replication of viruses such as foot-and-mouth disease virus (FMDV).

Method used

A recombinant lentiviral plasmid overexpressing the HS3ST5 gene was constructed, and a recombinant CHO-K1 cell line stably expressing HS3ST5 was obtained through transfection and screening. The effect of HS3ST5 on viral infection was studied using this cell line.

Benefits of technology

A recombinant CHO-K1 cell line stably expressing HS3ST5 was successfully established, which promoted the adsorption, internalization, and gene replication of viruses such as FMDV, improved viral replication capacity, and provided a tool for studying viral pathogenic mechanisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116144707B_ABST
    Figure CN116144707B_ABST
Patent Text Reader

Abstract

The application provides an application of a reagent overexpressing a HS3ST5 gene in promoting virus infection and a recombinant CHO-K1 cell line constructed by the reagent, and belongs to the technical field of genetic engineering. The application provides that a HS3ST5 fragment is cloned into a lentivirus vector to construct a recombinant lentivirus plasmid, and then the lentivirus is packaged by virus rescue, and then the lentivirus is used for infection of CHO-K1 cells to obtain a recombinant CHO-K1 cell line expressing the HS3ST5. The recombinant CHO-K1 cell stably expressing the HS3ST5 can promote adsorption, internalization, gene replication and progeny virus generation of FMDV, which provides a tool for studying a virus pathogenic mechanism and provides a basis for preparing a virus infection cell model subsequently.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to application of a reagent for overexpressing HS3ST5 gene in promoting virus infection and a recombinant CHO-K1 cell line. BACKGROUND

[0002] Heparan sulfate (HS) is a kind of linear sulfated heteropolysaccharide, which exists in large quantities on the surface of mammalian cells and extracellular matrix. HS can bind to a variety of ligands and is considered to be a non-specific cell surface receptor. Studies have found that HS helps virus infection through unique monosaccharide sequences, so HS can be used as a specific receptor for virus infection of target cells. Further studies have shown that HS is involved in the adsorption and endocytosis of viruses, which is conducive to the proliferation of viruses in host cells. Type 1 herpes simplex virus (HSV-1) and foot-and-mouth disease virus (FMDV) can use HS as a virus receptor to infect target cells. Many viruses such as dengue virus (DENV) and human immunodeficiency virus (HIV) use specific HS polysaccharide structures to infect cells. In addition, for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), HS has been confirmed to directly bind to angiotensin-converting enzyme 2 (ACE2) as an auxiliary receptor, promoting the adsorption and invasion of SARS-CoV-2 into host cells. Heparan sulfate 3-O-sulfotransferase (HS3ST) is a key enzyme in the biosynthesis of HS, which can catalyze the transfer of sulfate groups from a sulfate donor to the 3-OH position of glucosamine to form 3-O-sulfated HS. HS3ST includes seven isoforms, of which HS3ST5 has the strongest biological activity. At present, the research on the influence of HS3ST5 on virus infection is still very little, and there is no report on the construction of a stable HS3ST5-expressing cell line and its application.

[0003] Small RNA viruses play an important role in medicine and veterinary medicine, and their research results have important reference value. FMDV is a classic small RNA virus, which is often used as a model virus to study the interaction between virus and host. The use of viral receptors on the surface of host cells not only determines the invasion efficiency and replication ability of the virus, but also determines the host range and pathogenicity of the virus. During the adaptation of FMDV wild strains to cell culture, the virus acquired the ability to use HS as a receptor to infect cells. FMDV recognizes and binds to the HS receptor on the surface of the cell membrane to adsorb on the host cells, and then enters the cells through HS-mediated endocytosis. Studies on the interaction between FMDV and HS have focused on the efficiency and ability of different FMD strains and key amino acid residues in the same strain to utilize HS. It is not clear how HS modification enzyme HS3ST5 affects FMDV replication. SUMMARY

[0004] Therefore, the present application aims to provide a use of a reagent overexpressing HS3ST5 gene in promoting virus adsorption and invasion of host cells.

[0005] The present application provides a use of a reagent overexpressing HS3ST5 gene in promoting virus infection.

[0006] Preferably, the nucleotide sequence of the HS3ST5 gene is shown in SEQ ID NO: 1.

[0007] Preferably, the reagent overexpressing HS3ST5 gene comprises a recombinant lentivirus plasmid overexpressing HS3ST5 gene.

[0008] Preferably, the improvement of virus infectivity comprises promotion of the ability of virus adsorption and invasion of host cells, improvement of virus gene replication and progeny virus replication level.

[0009] Preferably, the virus comprises a virus using HS receptor to invade cells.

[0010] Preferably, the virus using HS receptor to invade cells comprises one or more of foot-and-mouth disease virus, severe acute respiratory syndrome coronavirus and herpes simplex virus.

[0011] The present application provides a recombinant cell line stably expressing HS3ST5, which overexpresses HS3ST5 protein.

[0012] The present application provides a construction method of the recombinant cell line stably expressing HS3ST5, comprising the following steps:

[0013] 1) constructing a recombinant lentivirus plasmid overexpressing HS3ST5 gene;

[0014] 2) co-transfecting the recombinant lentivirus plasmid overexpressing HS3ST5 gene and helper plasmid in step 1) into cells to rescue a recombinant lentivirus overexpressing HS3ST5;

[0015] 3) infecting CHO-K1 cells with the rescued recombinant lentivirus to obtain a recombinant cell line stably expressing HS3ST5 through screening.

[0016] Preferably, in step 1), the construction method uses primers containing Xba I and Not I enzyme cleavage sites to amplify HS3ST5 gene, and the obtained amplification fragment and lentivirus vector pLOV-CMV-EGFP are respectively Xba I and NotI double enzyme digestion, enzyme digestion fragment and linearization vector connection, identification, get overexpression HS3ST5 gene of recombinant lentivirus plasmid.

[0017] The application provides application of the stable recombinant CHO-K1 cell line expressing HS3ST5 or the stable recombinant CHO-K1 cell line expressing HS3ST5 obtained by the construction method in preparation of a virus infection cell model.

[0018] The application provides application of a reagent for overexpressing HS3ST5 gene in promoting virus infection. Experiments prove that a HS3ST5 fragment is obtained by amplification through an RT-PCR technology, is cloned into a lentivirus vector to construct a recombinant lentivirus plasmid, and then the lentivirus is packaged through virus rescue, and then CHO-K1 cells are infected to obtain a recombinant CHO-K1 cell line expressing HS3ST5. FMDV is used as a virus model, adsorption, internalization, gene replication and the level of progeny virus of FMDV on the recombinant CHO-K1 cell are determined, and finally the influence of the recombinant cell on the replication ability of FMDV is evaluated, and the results show that the recombinant CHO-K1 cell stably expressing HS3ST5 can promote the adsorption, internalization, gene replication and progeny virus generation of FMDV. It can be seen that overexpression of the HS3ST5 gene can affect the adsorption of FMDV on cells and promote the infection of FMDV. This provides a tool for studying the pathogenic mechanism of viruses and provides a basis for subsequent preparation of a virus infection cell model. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 HS3ST5 gene amplification results;

[0020] Figure 2 Expression results of the recombinant lentivirus plasmid with an EGFP tag in HEK-293T cells;

[0021] Figure 3 Expression results of EGFP in a monoclonal recombinant CHO-K1 cell strain;

[0022] Figure 4 HS3ST5 protein expression analysis results in the CHO-HS3ST5-OE-1 recombinant cell strain;

[0023] Figure 5 HS3ST5 mRNA level detection results in the CHO-HS3ST5-OE-1 recombinant cell strain;

[0024] Figure 6 Growth curve results of the recombinant CHO-K1 cell stably expressing HS3ST5;

[0025] Figure 7 Specific growth rate results of the recombinant CHO-K1 cell stably expressing HS3ST5;

[0026] Figure 8 Results of HS3ST5 protein expression during the passage of recombinant CHO-K1 cells;

[0027] Figure 9 Results of the influence of recombinant CHO-K1 cells stably expressing HS3ST5 on FMDV adsorption;

[0028] Figure 10 Results of the influence of recombinant CHO-K1 cells stably expressing HS3ST5 on FMDV internalization;

[0029] Figure 11 Results of the influence of recombinant CHO-K1 cells stably expressing HS3ST5 on FMDV gene replication;

[0030] Figure 12 Results of the influence of recombinant CHO-K1 cells stably expressing HS3ST5 on FMDV proliferation of the progeny. DETAILED DESCRIPTION

[0031] The application provides application of a reagent for overexpressing HS3ST5 genes in promoting virus infection.

[0032] In the application, the nucleotide sequence of the HS3ST5 gene is preferably as shown in SEQ ID NO: 1. The reagent for overexpressing the HS3ST5 gene preferably comprises a recombinant lentivirus plasmid for overexpressing the HS3ST5 gene. The virus preferably comprises a virus for invading cells by using HS receptors. In the embodiments of the application, the foot-and-mouth disease virus is taken as a representative of the virus for invading cells by using HS receptors, and the influence of the reagent for overexpressing the HS3ST5 gene on the virus infection ability is studied. In the embodiments of the application, the results show that overexpressing the HS3ST5 gene is beneficial to promoting the ability of the virus to adsorb and invade host cells, improving the virus gene replication and the replication level of the progeny virus.

[0033] The application provides a recombinant CHO-K1 cell line stably expressing HS3ST5, wherein the recombinant CHO-K1 cell line overexpresses HS3ST5 protein. The amino acid sequence of the HS3ST5 protein is as shown in SEQ ID NO: 2.

[0034] The application provides a construction method of the recombinant CHO-K1 cell line stably expressing HS3ST5, comprising the following steps:

[0035] 1) constructing a recombinant lentivirus plasmid for overexpressing HS3ST5 genes;

[0036] 2) co-transfect the recombinant lentivirus plasmid overexpressing HS3ST5 gene and the helper plasmid in step 1) into cells to rescue the recombinant lentivirus overexpressing HS3ST5;

[0037] 3) infect CHO-K1 cells with the rescued recombinant lentivirus to obtain a recombinant CHO-K1 cell line stably expressing HS3ST5 through screening.

[0038] In the present application, the construction method preferably uses a primer containing a Xba I and Not I enzyme cutting site to amplify the HS3ST5 gene, and the obtained amplification fragment and the lentivirus vector pLOV-CMV-EGFP are respectively Xba I and Not I double enzyme cut, the enzyme cutting fragment and the linearized vector are connected, and identified to obtain the recombinant lentivirus plasmid overexpressing HS3ST5 gene. The primer containing the Xba I and Not I enzyme cutting site includes a forward primer with a nucleotide sequence as shown in SEQ ID NO: 3 (CGTCTAGAATGAAAAAGCGTAGTAGTG) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4 (ATATGCGGCCGCGGGCCAGTTCAATGT). The amplification conditions are preferably 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 57℃ annealing for 1 min, and 72℃ extension for 2.5 min. The present application does not have special limitations on the method of enzyme cutting and connection, and the enzyme cutting and connection method known in the art can be used.

[0039] In the present application, the co-transfected cells preferably include components with a mass fraction of 10 parts of the recombinant lentivirus plasmid, 7.5 parts of the psPAX2 helper plasmid, and 2.5 parts of the pMD2.G helper plasmid. The transfection reagent when co-transfecting the cells is preferably Lipofectamine 2000. The present application does not have limitations on the type of cells, and the cells known in the art can be used. In the embodiments of the present application, HEK-293T cells are used as the infected cells.

[0040] In the present application, the rescue of the recombinant lentivirus overexpressing HS3ST5 is preferably screened with 2 μg / mL puromycin. Through RT-qPCR detection, the HS3ST5 mRNA level in the screened cell line is significantly increased, indicating that the recombinant cell line overexpressing HS3ST5 is successfully constructed.

[0041] In this invention, Western blot analysis showed no significant difference in the expression level of HS3ST5 protein between the 5th and 20th generations of the recombinant CHO-K1 cell line, indicating that the recombinant CHO-K1 cell line can stably express HS3ST5 protein. Meanwhile, growth curves and specific growth rates indicated that stable expression of HS3ST5 essentially does not affect the growth performance of CHO-K1 cells.

[0042] In this invention, recombinant CHO-K1 cells that stably express HS3ST5 promote the adsorption, internalization, gene replication, and progeny virus generation of FMDV.

[0043] This invention provides the application of the recombinant CHO-K1 cell line stably expressing HS3ST5 or the recombinant CHO-K1 cell line stably expressing HS3ST5 obtained by the construction method in the preparation of virus-infected cell models.

[0044] The following examples illustrate the application of a reagent for overexpressing the HS3ST5 gene provided by the present invention in promoting viral adsorption and invasion of host cells. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] A method for constructing a recombinant lentiviral plasmid overexpressing the HS3ST5 gene

[0047] 1. Materials

[0048] 1.1 Cells, Plasmids, and Viruses

[0049] BHK-21 cells were obtained from the China Center for Type Culture Collection, CHO-K1 cells from the American Center for Standard Biological Collection, HEK-293T cells from the China Center for Type Culture Collection, JM109 competent cells from TaKaRa, pMD2.G, psPAX2, and pLOV-CMV-EGFP plasmids from Invitrogen, and the classic O-type foot-and-mouth disease vaccine strain O / HN / CHA / 93 (Cathay) was provided by the National Foot-and-Mouth Disease Reference Laboratory of China.

[0050] 1.2 Main Reagents and Instruments

[0051] Rabbit-derived HS3ST5 polyclonal antibody was purchased from Novus Company, mouse-derived β-actin monoclonal antibody was purchased from Kangwei Century Company, RNeasy Mini Kit was purchased from Qiagen Company, phosphate buffer solution (PBS) was purchased from BI Biological Company, tragacanth was purchased from MPBiomedicals Company, high-sugar DMEM, MEM medium, F-12K, Lipofectamine 2000, Opti-MEM medium and trypsin were purchased from Invitrogen Company, fetal bovine serum (FBS) and puromycin were purchased from Gibco Company, plasmid small-scale extraction kit and plasmid large-scale extraction kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., lentivirus rapid detection card was purchased from Beijing Boaolong Immunological Technology Co., Ltd., ChamQ SYBR qPCR Master Mix was purchased from Norgen Biotek Corporation.

[0052] 1.3 Primer design and synthesis

[0053] According to the HS3ST5 gene sequence on NCBI, the primers were designed for RT-PCR amplification of HS3ST5 gene in CHO-K1 cells. The upstream primer was 5'-CGTCTAGAATGAAAAAGCGTAGTAGTG-3' (SEQ ID NO: 3), and the downstream primer was 5'-ATATGCGGCCGCGGGCCAGTTCAATGT-3' (SEQ ID NO: 4). The primers of GAPDH internal reference gene were as follows: the upstream primer was 5'-CAAGAAGGTGGTGAAGCA-3' (SEQ ID NO: 5), and the downstream primer was 5'-AAGTGGAAGAGTGAGTGTC-3' (SEQ ID NO: 6). The above primers were synthesized by Jinweizhi Biotechnology Company.

[0054] 2. Methods

[0055] 2.1 Amplification of HS3ST5 gene

[0056] The primers designed and synthesized above were used to amplify HS3ST5 gene. The PCR reaction system was as shown in Table 1, and the reaction conditions were as follows: reverse transcription at 50℃ for 30 min; pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 1 min, annealing at 57℃ for 1 min, extension at 72℃ for 2.5 min, for 35 cycles; and further extension at 72℃ for 10 min. The PCR product was subjected to 1% agarose gel electrophoresis, and then DNA agarose gel recovery was performed. The recovered product was sent to Jinweizhi Biotechnology Company for sequencing.

[0057] Table 1 RT-PCR system

[0058]

[0059] 2.2 Construction of overexpression HS3ST5 recombinant lentivirus plasmid

[0060] The lentivirus vector pLOV-CMV-EGFP was digested by Xba I and Not I, and the 8000 bp fragment was recovered. The recovered fragment and the HS3ST5 amplified fragment were ligated to construct the recombinant lentivirus plasmid, which was named pLOV-EGFP-CHO-HS3ST5. The pLOV-EGFP-CHO-HS3ST5 plasmid was preliminarily identified by enzyme digestion, and the positive plasmid was sent to Jiweizhi Biotechnology Co., Ltd. for sequencing. The sequencing primer was 5'-CGGTGAATGCTGGTGGCATC-3' (SEQ ID NO: 5). The correct positive recombinant plasmid was extracted in large quantities, as well as the helper plasmids pMD2.G and psPAX2.

[0061] 3. Results

[0062] 3.1 Amplification of HS3ST5 gene

[0063] The HS3ST5 gene was amplified using the RNA in CHO-K1 cells as a template. The agarose gel electrophoresis result showed that the HS3ST5 gene in CHO-K1 cells was successfully amplified. The electrophoretogram is shown in Figure 1 , and the size of the amplified product band was about 1000 bp.

[0064] 3.2 Construction and identification of recombinant lentivirus plasmid

[0065] The pLOV-CMV-EGFP vector was digested by Xba I and Not I, and two fragments were observed by agarose gel electrophoresis. The 8000 bp fragment was recovered and ligated with the amplified HS3ST5 fragment. After the ligation product was preliminarily identified by agarose gel electrophoresis, the positive clone was sent for identification. The results showed that the recombinant lentivirus plasmid pLOV-EGFP-CHO-HS3ST5 was successfully constructed. The positive plasmid with correct sequencing was extracted in large quantities and reserved for future use.

[0066] Example 2

[0067] Construction method of recombinant CHO-K1 cell line

[0068] 1. Rescue of overexpression HS3ST5 recombinant lentivirus

[0069] Normal HEK-293T cells were plated in 10 cm cell culture dishes, and when the cells were in good condition and the density reached 70%, plasmid transfection was performed using Lipofectamine 2000 transfection reagent (10 μg recombinant lentivirus plasmid + 7.5 μg psPAX2 auxiliary plasmid + 2.5 μg pMD2.G auxiliary plasmid). After 6 h, 4 ml of high-sugar DMEM complete medium was gently added to the cell culture dish, and the cells were incubated in a 37 °C incubator. During the incubation, the green fluorescence intensity of the transfected cells was observed multiple times using a fluorescence microscope. After 48 h, the cell supernatant was collected and filtered using a 0.45 um filter. The titer of the lentivirus in the supernatant was determined using a lentivirus rapid detection card, and the filtered lentivirus solution was stored at -30 °C for future use.

[0070] 2. Determination of the screening concentration of puromycin

[0071] CHO-K1 cells were plated in a six-well plate, and when the cell density reached 90%, the cells were treated with puromycin at concentrations of 1, 2, 3, 4, 5, and 6 μg / mL, respectively. The drug was added every 24 h. After 7 d, the survival of the cells in the six-well plate was observed. The lowest drug concentration at which no cells survived was the optimal concentration for puromycin screening.

[0072] 3. Construction of a recombinant CHO-K1 cell line stably expressing HS3ST5

[0073] The lentivirus and complete cell culture medium were mixed at a ratio of 1:1 by volume to prepare a mixed culture medium. Normal CHO-K1 cells were plated in a six-well plate and cultured with the mixed culture medium. When the cells covered the six-well plate, they were transferred to a cell culture flask and continued to be cultured with the mixed culture medium. The mixed culture medium was replaced every 24 h during the incubation. After 7 d, the green fluorescence of the cells infected with the lentivirus was observed using a fluorescence microscope. The cells infected with the lentivirus were treated with the optimal concentration of puromycin, and the complete medium with puromycin was replaced every 24 h. After 7 d, almost all the surviving CHO-K1 cells were recombinant cells carrying the recombinant lentivirus plasmid. The recombinant CHO-K1 cells overexpressing HS3ST5 were counted and diluted to a single cell, which was then added to a 96-well plate. After the cells grew into a mass, whether they were single clones was observed under a microscope. After the cells grew, the single clone recombinant cells were expanded and cryopreserved, and the expression level of HS3ST5 in the single clone recombinant cells was detected by Western Blot and real-time fluorescent quantitative PCR (RT-qPCR).

[0074] Results

[0075] Establishment and identification of a recombinant CHO-K1 cell line stably expressing HS3ST5

[0076] The positive recombinant lentivirus plasmid pLOV-EGFP-CHO-HS3ST5 was transfected into HEK-293T cells, and 48 h later, whether the cells emitted green fluorescence was observed under a fluorescence microscope. As shown in Figure 1 , strong green fluorescence was observed in the transfected cells under a fluorescence microscope. Since the recombinant lentivirus plasmid carries an EGFP protein tag, the successful expression of EGFP protein in HEK-293T cells indicates that the recombinant lentivirus plasmid has been successfully transfected into HEK-293T cells, indicating that the overexpression of the recombinant lentivirus rescue is successful. After treating CHO-K1 cells with gradient concentrations of puromycin, it was observed that after one week of screening with a minimum concentration of 2 μg / mL of puromycin, all the CHO-K1 cells died. Therefore, the optimal puromycin concentration for screening the CHO-K1 recombinant cell line was determined to be 2 μg / mL. After successfully rescued recombinant lentivirus infection and optimal concentration of puromycin screening of CHO-K1 cells, whether the cells emitted green fluorescence was observed under a fluorescence microscope. As shown in Figure 2 , strong green fluorescence was observed in the recombinant lentivirus-infected CHO-K1 cells under a fluorescence microscope, indicating that the recombinant lentivirus successfully infected CHO-K1 cells, indicating that the overexpression of HS3ST5 recombinant CHO-K1 cell line was successfully constructed. The constructed recombinant cell line was named CHO-HS3ST5-OE, and 3 single clone cell strains with strong fluorescence were selected from the recombinant cell line and frozen for later use (as shown in Figure 3 ). CHO-HS3ST5-OE-1 was selected for verification of HS3ST5 protein and mRNA expression levels. As shown in Figure 4 , the Western Blot results showed that compared with normal CHO-K1 cells, the recombinant cell strain CHO-HS3ST5-OE-1 successfully expressed HS3ST5 protein. As shown in Figure 5 , the RT-qPCR results showed that compared with normal CHO-K1 cells, the HS3ST5 mRNA level in CHO-HS3ST5-OE-1 was significantly increased. The above results indicate that the overexpression of HS3ST5 recombinant CHO-K1 cell line is successfully established.

[0077] Example 3

[0078] Growth curve and specific growth rate analysis of recombinant CHO-K1 cells stably expressing HS3ST5

[0079] After the recombinant CHO-K1 cells and normal CHO-K1 cells were fully grown, they were trypsinized and counted using a cell counting plate. Cell suspension was diluted with cell culture medium to a cell density of 4×10 5 / mL, then the cells were divided into 24-well plates, and the cells in 3 wells were counted every day for 10 days. The cell growth curve and specific growth rate curve were plotted according to the cell number.

[0080] The results are shown in Figure 6 , and the growth of all cells experienced a latent phase, exponential growth phase and stationary phase. The growth curve of CHO-HS3ST5-OE-1 recombinant cells was similar to that of CHO-K1 cells, and the cell number reached the peak on day 6 when the same cell density was inoculated. Figure 7 The specific growth rate of CHO-HS3ST5-OE-1 recombinant cells and CHO-K1 cells was similar, and the specific growth rate was negative after day 6, which was consistent with the growth curve results. The above results showed that stable expression of HS3ST5 did not affect the growth performance of CHO-K1 cells.

[0081] Example 4

[0082] Stable expression of HS3ST5 in recombinant CHO-K1 cells

[0083] In order to analyze the stability of HS3ST5 protein expression in the recombinant cell line, protein samples were collected from the 5th and 20th generations of cells to detect whether the expression of HS3ST5 protein was stable.

[0084] The stability of HS3ST5 protein expression in CHO-HS3ST5-OE-1 recombinant cells during subculture was analyzed by Western Blot. As Figure 8 , there was no significant difference in the expression level of HS3ST5 protein between the 5th and 20th generations of recombinant cell lines, indicating that HS3ST5 protein could be stably expressed in the recombinant cell line.

[0085] Example 5

[0086] Effect of recombinant CHO-K1 cells stably expressing HS3ST5 on FMDV adsorption

[0087] The effect of recombinant CHO-K1 cells on FMDV adsorption was evaluated by detecting the expression level of FMDV 3D mRNA. The cells were first counted, and then FMDV pre-cooled at 4°C was added at a MOI of 1. The FMDV was allowed to adsorb to the cells for 2 h at 4°C, and then the unadsorbed FMDV was washed away with 4°C pre-cooled PBS buffer. Subsequently, RNA lysis solution was added, and the sample was collected for RNA extraction. The level of 3D mRNA of FMDV adsorbed to the cell surface was detected by RT-qPCR. The detection primers used in RT-qPCR were referred to the primers in the published literature. The upstream primer for amplifying FMDV 3D gene was 5'-ACTGGGTTTTACAAACCTGTGA-3' (SEQ ID NO: 6), and the downstream primer was 5'-GCGAGTCCTGCCACGACGGA-3' (SEQ ID NO: 7). The upstream primer for amplifying the internal reference gene GAPDH gene was 5'-CAAGAAGGTGGTGAAGCA-3' (SEQ ID NO: 8), and the downstream primer was 5'-AAGTGGAAGAGTGAGTGTC-3' (SEQ ID NO: 9). The reverse transcription system of the RT-qPCR method is shown in Table 2, and the reverse transcription program was 37°C for 15 min and 85°C for 5 s. The amplification system of the RT-qPCR method is shown in Table 3, and the amplification reaction program was 95°C for 30 s pre-denaturation; 95°C for 5 s, 60°C for 30 s, 72°C for 30 s, 40 cycles; 95°C for 15 s, 60°C for 1 min, 95°C for 30 s, 60°C for 15 s. The relative mRNA copy number of FMDV 3D was calculated by the ΔΔCT method.

[0088] Table 2 RT-qPCR reverse transcription system of FMDV 3D

[0089]

[0090] Table 3 Amplification system of RT-qPCR of FMDV 3D

[0091]

[0092] The effect of CHO-HS3ST5-OE-1 recombinant cells on FMDV internalization was detected by RT-qPCR. As shown in Figure 6, compared with normal CHO-K1 cells, the mRNA level of FMDV in the recombinant CHO-K1 cells stably expressing HS3ST5 was significantly increased. The virus mRNA level in CHO-HS3ST5-OE-1 was 4.3 times that in the control cells, indicating that the recombinant CHO-K1 cells stably expressing HS3ST5 were beneficial to the adsorption of FMDV. Figure 9 ​

[0093] Example 6

[0094] Effect of recombinant CHO-K1 cells stably expressing HS3ST5 on FMDV internalization

[0095] The experimental steps for detecting FMDV internalization in recombinant CHO-K1 cells were as follows: the preliminary operation was the same as the adsorption experiment. Unadsorbed FMDV was washed away with PBS buffer pre-cooled at 4 °C. The cells were placed at 37 °C for 0.5 h, and then treated with PBS buffer at pH 2.5 for 5 min to inactivate the adsorbed but uninternalized virus. Subsequently, RNA lysis buffer was added, and RNA was extracted after the sample was collected. The 3D mRNA level of internalized FMDV was detected by RT-qPCR method described in Example 5.

[0096] The effect of CHO-HS3ST5-OE-1 recombinant cells on FMDV internalization was detected using RT-qPCR. Figure 10 Compared with normal CHO-K1 cells, the FMDV mRNA level in recombinant CHO-K1 cells that stably express HS3ST5 was significantly increased. The viral mRNA level in CHO-HS3ST5-OE-1 cells was 5.9 times that in control cells, indicating that recombinant CHO-K1 cells that stably express HS3ST5 are conducive to FMDV internalization.

[0097] Example 7

[0098] Effect of recombinant CHO-K1 cells stably expressing HS3ST5 on FMDV gene replication

[0099] Recombinant CHO-K1 cells were inoculated with the virus at an MOI of 1 and incubated at 37 °C. RNA lysis buffer was added and samples were collected at 5, 10, 15, 20, 25, 30, 35, and 40 h. RNA was extracted, and the 3D mRNA level of FMDV was detected using RT-qPCR.

[0100] The effect of CHO-HS3ST5-OE-1 recombinant cells on FMDV gene replication was detected using RT-qPCR. Figure 11 For all time points, the FMDV mRNA level in recombinant CHO-K1 cells stably expressing HS3ST5 was significantly increased compared to normal CHO-K1 cells. The FMDV mRNA levels in both CHO-HS3ST5-OE-1 recombinant cells and normal CHO-K1 cells peaked at 25 h, at which point the FMDV mRNA level in CHO-HS3ST5-OE-1 cells was 2.9 times that in control cells. These results indicate that recombinant CHO-K1 cells stably expressing HS3ST5 enhance FMDV gene replication.

[0101] Example 8

[0102] Effect of recombinant CHO-K1 cells stably expressing HS3ST5 on progeny FMDV propagation

[0103] Recombinant CHO-K1 cells stably expressing HS3ST5 were infected with FMDV and the progeny virus was quantified by plaque assay. Recombinant CHO-K1 cells and normal CHO-K1 cells were inoculated with FMDV at an MOI of 1 and incubated at 37 °C. Samples were collected at 4, 8, 12 and 16 h and the number of FMDV plaque forming units (PFU) in the samples was determined by plaque assay.

[0104] Samples of recombinant CHO-K1 cells and normal CHO-K1 cells infected with FMDV were collected at different time points and the progeny FMDV was quantified by plaque assay. As shown in Figure 8, the number of plaques on recombinant CHO-K1 cells stably expressing HS3ST5 was significantly higher than that on normal CHO-K1 cells at all time points. The number of FMDV plaques reached a peak at 25 h post-infection and the number of plaques in CHO-HS3ST5-OE-1 was 2.2 times that in control cells. These results indicated that recombinant CHO-K1 cells stably expressing HS3ST5 enhanced the propagation of progeny FMDV. Figure 12

[0105] ​From the above examples, the HS3ST5 fragment is obtained by RT-PCR technology amplification, cloned into pLOV-CMV-EGFP vector to construct a recombinant lentivirus plasmid, and then the recombinant lentivirus plasmid pLOV-EGFP-CHO-HS3ST5 is transfected into HEK-293T cells with the helper plasmids pMD2.G and psPAX2 by liposome transfection technology, the lentivirus packaged by the HEK-293T cells is harvested, and then the CHO-K1 cells are infected, and the recombinant CHO-K1 cell line expressing HS3ST5 is obtained after 10 days of continuous screening with puromycin. The monoclonal recombinant CHO-K1 cell strain stably expressing HS3ST5 is screened by limited dilution method and green fluorescence intensity observation. It is reported that the HS3ST1, 2, 4, 5 and 6 genes in CHO-K1 cells are transcribed but cannot express proteins, and the recombinant CHO-K1 cells successfully express the HS3ST5 protein, indicating that the CHO-K1 cells themselves have the ability to express the HS3ST5 protein, but may be regulated by various factors, resulting in the endogenous HS3ST5 protein expression of CHO-K1 cells being silenced or the level being too low to be detected. The genetic stability of the HS3ST5 protein expression in the 5th and 15th generation of recombinant CHO-K1 cells is also detected, and it is found that the positive monoclonal recombinant CHO-K1 cells screened can stably express the HS3ST5 protein, indicating that the HS3ST5 gene has been stably integrated into the CHO-K1 cells, and also indicating that the target cells obtained have good genetic stability. In addition, the growth rate and specific growth rate of the recombinant CHO-K1 cells are also analyzed, and the results show that the recombinant cells and normal cells have similar growth trends, indicating that overexpression of HS3ST5 does not affect the growth characteristics of CHO-K1 cells. In summary, the recombinant CHO-K1 cell line stably expressing HS3ST5 is successfully established.

[0106] The established recombinant CHO-K1 cells stably expressing HS3ST5 are used to measure the adsorption, internalization, gene replication and progeny virus level of FMDV on the recombinant CHO-K1 cells, and finally to evaluate the effect of the recombinant cells on the replication ability of FMDV. The results show that the recombinant CHO-K1 cells stably expressing HS3ST5 can promote the adsorption, internalization, gene replication and progeny virus production of FMDV. In summary, the recombinant CHO-K1 cells stably expressing HS3ST5 improve the replication ability of FMDV. It can also be seen that HS3ST5 affects the adsorption of FMDV to cells and thus affects the whole infection process of FMDV. This is consistent with the literature report that HS modified by HS3ST can promote the adsorption level of CMV and HSV-1 and other viruses and thus promote the infection of viruses.

[0107] The above merely describes the preferred embodiments of the present application, and it should be pointed out that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.

Claims

1. A recombinant CHO-K1 cell line stably expressing HS3ST5 gene, characterized in that, The method for constructing the recombinant CHO-K1 cell line stably expressing the HS3ST5 gene comprises the following steps: 1) Construct recombinant lentivirus plasmid overexpressing HS3ST5 gene; use lentivirus packaging system to package lentivirus, and transfect into HEK293T cells to obtain lentivirus particles Xba I and Not I amplify HS3ST5 gene by using primers containing restriction sites, obtain amplified fragment and lentivirus vector pLOV-CMV-EGFP by double digestion respectively Xba I and Not I, connect enzyme-digested fragment and linearized vector, identify, and obtain recombinant lentivirus plasmid overexpressing HS3ST5 gene The nucleotide sequence of the HS3ST5 gene is shown as SEQ ID NO: 1; 2) The recombinant lentivirus over-expressing the HS3ST5 gene is obtained by co-transfecting the recombinant lentivirus plasmid over-expressing the HS3ST5 gene and the helper plasmid into cells; 3) The recombinant CHO-K1 cell line stably expressing the HS3ST5 gene is obtained by infecting CHO-K1 cells with the obtained recombinant lentivirus and screening.

2. The recombinant CHO-K1 cell line stably expressing the HS3ST5 gene in the preparation of a virus-infected cell model, wherein the virus is foot-and-mouth disease virus.

Citation Information

Patent Citations

  • Recombinant lentiviral vector as well as recombinant lentivirus and application thereof

    CN109439688A

  • Purified and isolated heparan sulfate 3-o-sulfotransferase isoform 5 nucleic acids and polypeptides and therapeutic and screening methods using same

    US20060165673A1