Use of znf652 as a breast cancer marker
By detecting transcriptional and heterozygous deletions of the ZNF652 gene, and combining romedixin with anti-PD-L1 antibodies, the diagnostic and treatment challenges of breast cancer, especially triple-negative breast cancer, have been solved, improving diagnostic sensitivity and treatment effectiveness.
Patent Information
- Application Number
- CN202210937550.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-05
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2042-08-05
AI Technical Summary
Current technologies lack sensitive and effective diagnostic biomarkers for breast cancer, especially for the diagnosis and treatment of triple-negative breast cancer. The low response rate of anti-PD-L1 monotherapy has become a bottleneck in breast cancer treatment.
Using the ZNF652 gene as a biomarker, by detecting its transcriptional and heterozygous loss, combined with romedixin and anti-PD-L1 antibody, we can guide the diagnosis, treatment, and prognostic assessment of breast cancer.
The effects or results that can be achieved through ZNF652 gene detection technology.
Smart Images

Figure CN116144768B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to the application of ZNF652 as a breast cancer diagnostic marker and the combined use of Romidepsin and PD-L1 antibody. BACKGROUND
[0002] Breast cancer is the leading cause of morbidity and mortality in women. The 2021 Cancer Statistics Report published by the American Cancer Society shows that the three most common cancers in women are breast cancer (30%), lung cancer, and colorectal cancer. At the same time, the mortality rate of breast cancer (15%) is also the second highest among female tumors. The main reason is that breast cancer has no typical clinical symptoms in the early stage, and is often overlooked by patients. By the time it is discovered, most patients are already in the advanced stage of breast cancer, and the prognosis is poor. Therefore, early and effective screening and treatment are very important for improving patient prognosis. Current clinical screening and diagnostic methods for breast cancer mainly focus on imaging, ultrasound, pathology, and detection of serum tumor markers, and there is still a lack of indicators that can sensitively and effectively diagnose breast cancer, guide clinical drug use, and evaluate prognosis. Therefore, exploring new tumor markers for the diagnosis, drug guidance, and prognosis of breast cancer is a problem that needs to be solved in the field.
[0003] In breast cancer, it is clinically divided into four main subtypes according to the status of estrogen (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2): luminal A, luminal B, HER2-positive, and triple-negative breast cancer. Among them, triple-negative breast cancer has the characteristics of youth, strong invasiveness, early recurrence, distant metastasis, and low five-year survival rate, and is currently a difficult point and bottleneck in the treatment of breast cancer. Triple-negative breast cancer is the most immunogenic subtype of breast cancer, with high PD-L1 expression, and the level of PD-L1 expression on the surface of tumor cells has a certain positive correlation with the efficacy of anti-PD-L1 drugs. Therefore, PD-L1 antibody blockade is highly expected in the treatment of triple-negative breast cancer. However, the response rate of anti-PD-L1 monotherapy in breast cancer is only 5% to 20%, which is the main bottleneck of its application. Therefore, developing new combination therapy regimens is of great significance and is an urgent challenge in the field of tumor immunology. SUMMARY
[0004] To solve the above problems, the first aspect of the present application provides the use of ZNF652 gene as a marker in the preparation of a kit for assessing the risk of cancer occurrence and / or prognosis.
[0005] In some embodiments, the ZNF652 gene as a marker includes transcription of the ZNF652 gene and / or loss of heterozygosity (LOH) of the ZNF652 gene.
[0006] The second aspect of the present application provides use of a detection reagent for ZNF652 gene transcription and / or loss of heterozygosity in the preparation of a kit for evaluating the risk or prognosis of cancer.
[0007] In some embodiments, the cancer is breast cancer. Preferably, the breast cancer is luminal A, luminal B, HER2-positive and triple-negative breast cancer; further preferably, the breast cancer is triple-negative breast cancer.
[0008] In some embodiments, the transcription level of the gene is detected by a combination of one or more of real-time fluorescent quantitative PCR and high-throughput sequencing; preferably, the detection reagent for the ZNF652 gene comprises primers and / or probes for ZNF652 real-time fluorescent quantitative PCR detection; more preferably, the primers and / or probes for ZNF652 real-time fluorescent quantitative PCR detection have the sequences shown in SEQ ID NO: 4-5.
[0009] In some embodiments, the reagent detects the level of the protein by a combination of one or more of BCA protein quantification, immunohistochemistry, Western blot and ELISA; preferably, the detection reagent for the ZNF652 protein comprises a ZNF652-specific antibody.
[0010] The third aspect of the present application provides a kit for evaluating the risk and / or prognosis of breast cancer, comprising: a reagent for detecting the transcription level of ZNF652 gene, a reagent for detecting the level of ZNF652 protein and / or a reagent for detecting the loss of heterozygosity (LOH) of ZNF652; optionally, the kit comprises instructions for evaluating the risk and / or prognosis according to the detection results.
[0011] The fourth aspect of the present application provides a system for evaluating the risk and / or prognosis of breast cancer, comprising: 1) reagents for detecting the transcription level of ZNF652, the level of ZNF652 protein and / or the loss of heterozygosity (LOH) of ZNF652; 2) a device comprising a data input module, a data comparison module and a conclusion output module.
[0012] The fifth aspect of the present application provides use of a ZNF652 gene expression detection reagent in the preparation of a kit for guiding anti-PD-L1 immunotherapy and guiding the combined use of anti-PD-L1 antibodies.
[0013] The sixth aspect of the present application provides use of an HDAC inhibitor combined with an anti-PD-L1 antibody in the preparation of a breast cancer treatment drug.
[0014] In some embodiments, the HDAC inhibitor is romidepsin.
[0015] In some embodiments, the breast cancer is triple negative breast cancer.
[0016] The present application has the following beneficial effects compared with the prior art:
[0017] 1) The present application first discovers that the degree of ZNF652 gene loss of heterozygosity, mRNA level is related to the occurrence, development and prognosis of breast cancer (especially triple negative breast cancer). High degree of ZNF652 gene loss of heterozygosity, low ZNF652 mRNA level is related to high risk of occurrence, fast development, high malignancy and poor prognosis. ZNF652 can be used as a marker for evaluating the risk of breast cancer occurrence and prognosis.
[0018] 2) The present application discovers that the expression level of PD-L1 is increased after ZNF652 knockdown. The expression level of ZNF652 has a certain guiding effect in guiding anti-PD-L1 immunotherapy of triple negative breast cancer patients, developing combination drug and evaluating prognosis in clinic.
[0019] 3) The present application discovers that the combination of selective histone deacetylase (HDAC) inhibitor Romidepsin and anti-PD-L1 antibody can reduce the growth of triple negative breast cancer and improve the survival rate, which provides an important theoretical basis for the treatment of clinical triple negative breast cancer. BRIEF DESCRIPTION OF DRAWINGS
[0020] Other features, objects and advantages of the present application will become more apparent from the following detailed description of non-limiting embodiments with reference to the attached drawings:
[0021] Figure 1 Based on the data analysis of TCGA, the occurrence of LOH (loss of heterozygosity) of ZNF652 gene in various types of tumor samples was analyzed.
[0022] Figure 2 Based on the data analysis of TCGA, the occurrence of LOH (loss of heterozygosity) of ZNF652 gene in luminal A, luminal B, HER2 positive and triple negative breast cancer was analyzed.
[0023] Figure 3 Based on the data analysis of TCGA, the expression difference of ZNF652 in breast cancer and normal people was analyzed.
[0024] Figure 4 Based on the data analysis of TCGA, the expression difference of ZNF652 in different types of breast tumors was analyzed
[0025] Figure 5 ZNF652 inhibits the expression of PD-L1 at the mRNA level.
[0026] Figure 6ZNF652 inhibits the expression of PD-L1 at the protein level.
[0027] Figure 7 A schematic diagram showing that low expression of ZNF652 promotes the proliferation ability of MDA-MB-231 cells.
[0028] Figure 8 A schematic diagram showing that low expression of ZNF652 promotes the invasion ability of MDA-MB-231 cells.
[0029] Figure 9 A schematic diagram showing that low expression of ZNF652 inhibits the killing ability of T cells.
[0030] Figure 10 Combination of Romidepsin and anti-PD-L1 antibody can more effectively inhibit the tumor growth of triple-negative breast cancer model mice and improve the survival rate. DETAILED DESCRIPTION
[0031] So that the objects, technical solutions and advantages of the embodiments of the present application are more apparent, the technical solutions of the embodiments of the present application will be described clearly and completely below with reference to the drawings of the embodiments of the present application. Obviously, the described embodiments are some of the embodiments of the present application, rather than all the embodiments of the present application. Based on the described embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort belong to the scope of protection of the present application.
[0032] Unless otherwise defined, the technical terms or scientific terms used herein should be understood as the usual meanings understood by those of ordinary skill in the art to which the present application belongs.
[0033] The method of the present application and its effects will be described below in combination with specific embodiments.
[0034] Example 1 Analysis of heterozygous deletion of ZNF652 gene
[0035] Using the whole genome sequencing results of 10522 tumor samples of 33 types in the TCGA database, the changes in gene copy number were analyzed, and it was found that ZNF652 gene was prone to heterozygous deletion in the following 17 representative tumors, such as OV (ovarian serous cystadenocarcinoma), KICH (kidney chromophobe carcinoma), ACC (adrenal cortex carcinoma), UCS (uterine sarcoma), LUSC (lung squamous carcinoma), ESCA (esophageal carcinoma), BRCA (breast invasive carcinoma), STAD (gastric cancer), READ (rectal adenocarcinoma), UCEC (endometrial carcinoma), COAD (colon cancer), LUAD (lung adenocarcinoma), SKCM (cutaneous melanoma), and PAAD (pancreatic cancer). Figure 1). Further we classified the breast cancer, and found that the proportion of ZNF652 LOH was different in luminal A, luminal B, HER2 positive and triple negative breast cancer, which was proportional to the malignancy of the tumor Figure 2
[0036] Example 2 Analysis of the expression of ZNF652 gene in breast cancer
[0037] The expression of ZNF652 gene in 61 cases of breast normal tissue and 76 cases of tumor tissue data was obtained from the TCGA database, and analyzed by Oncomine tool. The results showed that compared with normal tissue, the mRNA level in breast tumor sample was significantly reduced Figure 3 ), especially in triple negative breast cancer Figure 4
[0038] Example 3 Study of ZNF652 knockdown and overexpression in MDA-MB-231
[0039] 3.1 Effect of ZNF652 knockdown and overexpression on PD-L1 expression
[0040] The shRNA shZNF652#1 (SEQ ID NO: 1, GGTGCACTCCTTGCAGCATTC) and shZNF652#2 (SEQ ID NO: 2, GCACCAGTCCAGAAAGCTAAG) of ZNF652 and the control sequence shCTR (SEQ ID NO: 3, TTCTCCGAACGTGTCACGT) were respectively cloned into the pLKO.1 vector, and then the recombinant pLKO.1 vector, and two packaging plasmids psPAX2 and pMD2.G were co-transfected into HEK293T cells. The supernatant was collected at 24 hours and 48 hours, mixed twice, filtered with a 0.45 μm filter after centrifugation at 1250 rpm for 5 minutes, and then concentrated by ultrafiltration tube centrifugation. The concentrated virus liquid was added to the triple-negative breast cancer MDA-MB-231 cells in a six-well plate, and 10 μg / ml polybrene was added. The infected cells were added with 2 μg / ml puromycin and / or neomycin (Merck) for screening. The target gene ZNF652 coding region and FLAG tag were cloned into the viral plasmid of the pLVX-IRES-puro vector core; then the recombinant protein expression plasmid FLAG-ZNF652 corresponding to the empty Vector, and two packaging plasmids psPAX2 and pMD2.G were co-transfected into HEK293T cells, and the supernatant of HEK-293T cells collected at 48 hours and 72 hours was ultrafiltrated and concentrated into lentivirus; BT549 cells were seeded into a 6-well plate, and each well was infected with an appropriate amount of concentrated lentivirus, and 10 μg / ml Polybrene was used to improve the infection efficiency; 2 μg / ml puromycin was used to screen the cells for 4 days. The cells were collected at 48 h after infection and screening, and Western blotting and fluorescence quantitative PCR experiments were performed. The upstream primer sequence for ZNF652 is shown in SEQ ID NO: 4 (5-GCTGGTTGAAAACTGTGCTGT-3’); and the downstream primer sequence is shown in SEQ ID NO: 5 (5’-GAAGATGGCACTTGACCACGA-3’).
[0041] It was found that after knocking down ZNF652 in MDA-MB-231, the mRNA and protein levels of PD-L1 were increased; at the same time, after overexpressing ZNF652 in BT549, the expression level of cell PD-L1 was reduced. Figure 5 and Figure 6 )
[0042] 3.2 Effect of ZNF652 knockdown on cell clonogenicity
[0043] The MDA-MB-231 cells stably transfected with shRNA were used to analyze the colony formation ability. The cells were counted and transferred to 6-well plates at 5000 cells per well, and cultured in a 37°C incubator for 14 days, with medium changed every two days. Finally, the cells were washed twice with cold PBS, fixed with 4% paraformaldehyde at room temperature for 10 minutes, stained with 0.1% crystal violet staining solution for 20 minutes, and washed with PBS. It was found that after knocking down ZNF652, the number of cell colonies increased, and the colony growth ability was stronger Figure 7 ).
[0044] 3.3 Effect of ZNF652 Knockdown on Cell Invasion Ability
[0045] The MDA-MB-231 cells stably transfected with shRNA were used to perform a Transwell experiment. After 24 hours of culture, the cells were stained and analyzed, and it was found that after knocking down ZNF652, the number of cells passing through the basement membrane increased significantly, and the cell invasion ability was significantly enhanced Figure 8 ).
[0046] 3.4 Effect of ZNF652 Knockdown on T Cell Killing Ability
[0047] The MDA-MB-231 cells stably transfected with shRNA were used to perform a T cell killing experiment. After 72 hours of co-culture of tumor cells MDA-MB-231 and T cells, it was found that after knocking down ZNF652, the survival ability of tumor cells was significantly higher than that of the non-knocking down group, indicating that the killing ability of T cells on MDA-MB-231 cells was significantly reduced after knocking down ZNF652 Figure 9 ).
[0048] Example 4 Combination of Romidepsin and Anti-PD-L1 Antibody for Treating Breast Cancer
[0049] BALB / c mice were selected and injected with 5×10 5 Mouse breast cancer cells 4T-1 to perform a tumor formation experiment, and an in vivo combination treatment of anti-PD-L1 and HDAC1 / 2 inhibitor romidepsin was carried out. The mice were randomly divided into:
[0050] 1) Control group (Vehicle+IgG group): PBS+IgG (100 μg / 100 μL, intraperitoneal injection);
[0051] 2) Anti-PD-L1 treatment group (Vehicle+anti-PD-L1 group): PBS+αPD-L1 (BE0101, BioXcell, 100 μg / 100 μL, intraperitoneal injection);
[0052] 3) HDAC inhibitor treatment group (romidepsin + IgG group): romidepsin (0.75 mg / kg, intraperitoneal injection) + IgG (100 μg / 100 μL, intraperitoneal injection);
[0053] 4) HDAC inhibitor and anti-PD-L1 combination treatment group (romidepsin + anti-PD-L1 group): romidepsin (0.75 mg / kg, intraperitoneal injection) + aPD-L1 (BE0101, BioXcell, 100 μg / 100 μL, intraperitoneal injection). The HDAC inhibitor romidepsin was administered every 3 days from 3 days after inoculation, and the anti-PD-L1 antibody was administered on days 5, 10, and 15 after inoculation, and control treatments were performed, respectively.
[0054] Tumor size was measured and calculated using the formula 1 / 2 x length x width2from day 5 after injection. It was found that the combination of romidepsin and anti-PD-L1 antibody had a significantly better inhibitory effect on tumors than either romidepsin or anti-PD-L1 antibody alone. Figure 10 ).
[0055] The above shows and describes the basic principles and main features of the present application and the advantages of the present application, and it is obvious to those skilled in the art that the present application is not limited to the details of the above exemplary embodiments, and the present application can be implemented in other specific forms without departing from the spirit or essential characteristics of the present application. Therefore, the embodiments should be considered as exemplary and non-limiting, and the scope of the present application is defined by the appended claims rather than the above description, and therefore all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in the present application. Any reference signs in the claims should not be considered as limiting the claims involved.
[0056] Furthermore, it should be understood that although the present specification is described in terms of embodiments, not every embodiment contains only one independent technical solution, and the description of the specification in this way is only for the sake of clarity, and those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that those skilled in the art can understand.
Claims
1. Use of a ZNF652 gene expression detection reagent in the preparation of a triple-negative breast cancer anti-PD-L1 immunotherapy guidance kit.
2. Use of a ZNF652 gene expression detection reagent in the preparation of a triple-negative breast cancer anti-PD-L1 antibody medication guidance kit.