CRISPR Detection Primer Set for Acinetobacter baumannii and Its Use

Abstract

The present invention relates to a CRISPR detection primer set for Acinetobacter baumannii and its use. The CRISPR detection primer set includes an amplification primer pair and a crRNA; the amplification primer pair is used to amplify the conserved sequence of Acinetobacter baumannii; the crRNA includes an anchor sequence and a guide sequence, the anchor sequence binds to the cas protein, and the guide sequence matches the target DNA fragment in the conserved sequence. By using this primer set, Acinetobacter baumannii can be detected by a gene detection technique based on the CRISPR technology, which has the advantages of rapidity and high sensitivity.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection based on CRISPR technology, and particularly to a CRISPR detection primer set for Acinetobacter baumannii and its use. Background Art

[0002] Acinetobacter baumannii belongs to Gram-negative bacteria and widely exists in nature. It is a conditional pathogen with strict fermentation conditions, aerobic, non-lactose-fermenting, without flagella and low mobility. At the same time, because Acinetobacter baumannii has a series of complex drug resistance mechanisms and tenacious viability, it has become the main source of hospital infections, especially in intensive care units. Infections with Acinetobacter baumannii usually cause bacteremia, pneumonia, meningitis, peritonitis, endocarditis, as well as urinary tract and skin infections, with a high fatality rate.

[0003] The detection and identification methods of Acinetobacter baumannii include smear morphological microscopy, isolation and culture, biochemical identification, immunological identification, molecular biology and other detection methods. Among them, the isolation and culture method is the gold standard for strain detection. However, due to the relatively long culture time, it is not conducive to timely clinical diagnosis and treatment. For traditional biochemical identification, since the biochemical phenotypes of Acinetobacter baumannii, Acinetobacter calcoaceticus, Acinetobacter genotype 3, and Acinetobacter genotype 13TU are very similar, it is also difficult to distinguish the intraspecific relationship. Although immunological identification has an advantage in detection and identification time, its detection sensitivity and specificity are not high. Molecular biology detection methods based on nucleic acid amplification are fast and sensitive in diagnosis, and DNA conserved region fragments can be used to distinguish Acinetobacter baumannii strains. In recent years, various isothermal nucleic acid amplification technologies such as LAMP and RPA have emerged and can be used for on-site detection, but they all have problems such as the lack of relatively effective means for detecting amplification products. Therefore, aiming at the problems of the long detection cycle of traditional Acinetobacter baumannii detection methods, delay in clinical diagnosis and treatment, and the need to further improve sensitivity, there is an urgent need to establish a detection technology that can be applied on-site, is simple, fast, and highly sensitive. Summary of the Invention

[0004] In view of the above problems, the present invention provides a CRISPR detection primer set for Acinetobacter baumannii. By using this primer set, Acinetobacter baumannii can be detected through gene detection technology based on CRISPR technology, which has the advantages of being fast and highly sensitive.

[0005] The present invention provides a CRISPR detection primer set for Acinetobacter baumannii, including an amplification primer pair and a crRNA; the amplification primer pair is used to amplify the conserved sequence of Acinetobacter baumannii; the crRNA includes an anchor sequence and a guide sequence, the anchor sequence binds to the cas protein, and the guide sequence matches the target DNA fragment in the conserved sequence.

[0006] The inventor designed a crRNA sequence targeting the conserved sequence of Acinetobacter baumannii and used CRISPR technology for detection. In the CRISPR-Cas system, the Cas protein, guided by the guide RNA, recognizes the target sequence and then activates the "collateral cleavage" activity. By adding a fluorescent reporter molecule to the system and leveraging the collateral cleavage activity of the Cas enzyme, the information of the sequence to be detected can be converted into a fluorescent signal. Through the coupling of RPA and the Cas protein, two-stage amplification of "sequence amplification" (completed by RPA) plus "enzymatic cascade" (completed by the Cas enzyme) can be achieved, thus exceeding the sensitivity of single-stage amplification such as Q-PCR. In addition, since the RPA amplification method does not require complex temperature changes, it gets rid of the dependence on sophisticated instruments such as QPCR machines, making the CRISPR-Cas technology have broad application prospects in point-of-care diagnosis.

[0007] In one embodiment, the conserved sequence is as shown in SEQ ID NO: 1.

[0008] Through a large number of screening and comparative experiments, the inventor found that the conserved sequence fragment shown in SEQ ID NO: 1 can specifically be used for detecting Acinetobacter baumannii and can achieve the technical effect of efficient detection through CRISPR technology.

[0009] In one embodiment, the crRNA sequence is selected from: SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0010] In one embodiment, the forward amplification primer in the amplification primer pair is selected from: SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8;

[0011] The reverse amplification primer in the amplification primer pair is selected from: SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

[0012] In one embodiment, the crRNA sequence is as shown in SEQ ID NO: 2.

[0013] Selecting the sequence shown in SEQ ID NO: 2 above as the crRNA sequence, the guide sequence therein (i.e., the targeted sequence for detection) can have a good detection effect.

[0014] In one embodiment, the forward amplification primer is as shown in SEQ ID NO: 6, and the reverse amplification primer is as shown in SEQ ID NO: 10.

[0015] After a large number of research experiments, the inventor of the present invention found that by using the above-mentioned forward amplification primer and the above-mentioned reverse amplification primer to form an amplification primer pair for RPA amplification, and then cooperating with the crRNA sequence shown in SEQ ID NO: 2 above, it has good amplification effect and sensitivity.

[0016] The present invention also provides the application of the above-mentioned CRISPR detection primer set for Acinetobacter baumannii in the development and / or preparation of products for the diagnosis and / or prognosis evaluation of diseases caused by Acinetobacter baumannii infection, and the diseases caused by Acinetobacter baumannii infection include: bacteremia, pneumonia, meningitis, peritonitis, endocarditis, urinary tract infection, or skin infection.

[0017] The above-mentioned product base can be a kit or an integrated detection device.

[0018] The present invention also provides a kit for detecting Acinetobacter baumannii, which includes the above-mentioned CRISPR detection primer set for Acinetobacter baumannii.

[0019] In one embodiment, the kit further includes a signal reporting probe and cas12a protein.

[0020] In one embodiment, the cas12a protein is Lbcas12a protein.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The CRISPR detection primer set for Acinetobacter baumannii of the present invention is designed by targeting the conserved sequence of Acinetobacter baumannii to obtain the crRNA sequence and the RPA amplification primer pair, and uses CRISPR technology for detection. In the CRISPR-Cas system, the Cas protein, under the guidance of the guide RNA, starts the "collateral cleavage" activity after recognizing the target sequence. At the same time, a fluorescent reporting molecule is added to the system, and by borrowing the collateral cleavage activity of the Cas enzyme, the conversion of the sequence information to be detected into a fluorescent signal is realized. Through the coupling of RPA and the Cas protein, it is possible to achieve two-stage amplification of "sequence amplification" (completed by RPA) plus "enzymatic cascade" (completed by the Cas enzyme), thus exceeding the sensitivity of single-stage amplification such as Q-PCR. In addition, because the RPA amplification method does not require complex temperature changes, it gets rid of the dependence on precision instruments such as QPCR machines, making the CRISPR-Cas technology have broad application prospects in the field diagnosis of Acinetobacter baumannii.

[0023] Meanwhile, the present inventors also selected target sequences through a large number of research experiments, designed and screened amplification primers and crRNA sequences. The finally obtained primer set not only has high amplification efficiency, good sensitivity, but also strong specificity, and can be applied to clinical detection. Compared with the traditional detection method of Acinetobacter baumannii, the CRISPR detection primer set of the present invention shortens the detection time of Acinetobacter baumannii, can complete the detection within 90 minutes, has high sensitivity, can detect Acinetobacter baumannii with a minimum of 200 copies / mL, and has no amplification for other non-Acinetobacter baumannii, with good specificity, and can be preferably used in the field of on-site detection of Acinetobacter baumannii. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the result diagram of specific screening in Example 1;

[0025] Figure 2 It is the result diagram of orthogonal amplification efficiency screening in Example 1;

[0026] Figure 3 It is the result diagram of sensitivity test in Example 2;

[0027] Figure 4 It is the result diagram of specificity test in Example 3. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0028] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below with reference to the relevant drawings. The preferred embodiments of the present invention are shown in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art belonging to the technical field of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0030] Unless otherwise specified, the reagents, materials, and equipment used in this embodiment are all commercially available sources; unless otherwise specified, the experimental methods are all conventional experimental methods in this field.

[0031] Example 1

[0032] Design and screening of CRISPR detection primer sequences for Acinetobacter baumannii.

[0033] I. Select the target sequence.

[0034] Based on previous research, after multiple screenings and sequence comparisons among different species, the inventor selected the conserved region sequence of Acinetobacter baumannii shown in SEQ ID NO: 1 as the target sequence, which can detect Acinetobacter baumannii. The specific sequence of SEQ ID NO: 1 is as follows:

[0035] ATGAGTCAGGCTACTTCAAATTCATCACGTTTTAACCTGCGCGCTCAAGTCGTCCAGACC

[0036] TTGCTAAAAGTTCAGCAAGGTCAATCGCTCGCTAGTATTTTAAATACACAGCTGAATCAA

[0037] GTAGCAGAGCGTGATCGTGCACTATTTCATGAACTTGTTTTAGGTACATTGCGCCAATGG

[0038] TTCGCACTTAAGTCAATTAGCCTGCCTTTACTCAGCAAACCTTTAAACAATGAGACAGTA

[0039] GAAACCTGCCTATACGTTGGCCTTTATCAAGTTTTATGCACGCGTATTGCAGCGCACGCT

[0040] GCCATCTCGGAAACAGTCGATGCGACTAAACAACTTGGTTTCCCTGCACTCAGTGGTAT

[0041] TGTTAATGCAATTTTGCGCCGAGCAACTCGCGAAACTGAAGACTTTGAACAAGGTTTAC

[0042] AGCAAGCGCATGGGTTACCAAGTTGGCTTTTTAAACGCTTAAAAAAGGATTGGGGAGAA

[0043] CAAACAGAAGCTCTCTGCCAATCGTTAAAGCAAGTTGCGCCTTTAACTTTACGGGTGAA

[0044] CCAGCGTCATATTGGTCGAGATGCTTATTTAGCAAAACTGCAAAGTTTAGACATTCAGGC

[0045] ACGTGCGTGTTTGTTTTCCGAAGCTGCTATTGTCCTTGAGCAATCTGTACAAATCACTCA

[0046] GTTACCGGGTTTTGAACAAGGCTGGTTCTCTGTACAAGATGAACATGCACAGCTATGTG

[0047] CCACCTTGTTGCCTGATTTAAACAATAAAACGGTTATTGATGCTTGTGCTGCGCCAGGGG

[0048] GTAAAACGGCTCATTTGCTTGAAAAGTTTAAACCAGCACAGCTTATCGCTATTGATCAGG

[0049] ACCCAAGTCGTTTAGTCCGTGTGACTGAAAACTTAAATCGCTTAGCACTCGATCAAAGC

[0050] CATACGGAAATTTTGGCAGCCGATGCAACCAAGTGGACTCCTGTGCAACCTGTAGATTG

[0051] TATCGTACTTGATGCTCCTTGTTCTGCGACAGGTGTGATTCGACGTCATCCTGACATACGC

[0052] CTATTGCGCCAATCTAGTGATATAGCCCAAACCATTGAGCTACAAAAGCAGATCTTAGAG

[0053] CACATGTGGCAGCAACTCAAAGTTGGCGGTACATTGCTTTATATCACCTGCTCAATTTTA

[0054] AAATCTGAAAACGAACAGCAGATGATTAACTTCTTCACAGAACATACTGATGCAAAAGA

[0055] AGTGAAAATCGAGGCAGATTGGGGAATTGAACAAGTTCATGGCAGACAACTGTTGCCAGAAGCACAATCTGGTGATGGATTTTATTATTGTAAAATTCAAAAGATTGCATAA。

[0056] II. Design RPA amplification primers and crRNA sequences.

[0057] For the above conservative sequences, multiple crRNA sequences and RPA amplification primer sequences were designed, and some exemplary sequences are shown in the following table.

[0058] Table 1 crRNA and amplification primer pairs Note: The above crRNA-1, crRNA-2, and crRNA-3 sequences are RNA sequences, where T is the letter specification in the WIPO Sequence List and represents uracil U.

[0059] III. Screening of sequences.

[0060] 1. Specificity screening of the above 3 crRNAs.

[0061] Specific operation of specificity screening: Synthesize a plasmid containing the target sequence of SEQ ID NO:1 (this plasmid was synthesized by General Biosystems (Anhui) Co., Ltd.), dilute the plasmid to a concentration of 100 pg / ul, and separately take 4 ul (1 uM) of crRNA-1, crRNA-2, crRNA-3 and the negative control ddH20 and add them to the crRNA specificity screening reaction system. The reaction system solution contains the following reagents: 18 ul peg aqueous solution (8%), 2 ul plasmid (100 pg / ul), 2 ul signal reporter probe (10 uM), 4 ul Lbcas12a protein (2 uM).

[0062] The result of the specificity screening is as Figure 1 shown. crRNA-1 has the best specific recognition ability for the target sequence.

[0063] 2. Orthogonal amplification efficiency screening of the above forward amplification primers and reverse amplification primers.

[0064] Specific operation of orthogonal amplification efficiency screening: Dilute the plasmid to a concentration of 10 ag / ul, dilute the concentrations of 4 forward amplification primers and 4 reverse amplification primers to 10 uM, take 1 ul of forward amplification primer and 1 ul of reverse amplification primer and pair them up pairwise, forming a total of 16 primer pairs. Add 2 ul of each primer pair to the amplification detection system. The amplification detection system solution is: 2 ul plasmid (10 ag / ul), 2 ul signal reporter probe (10 uM), 4 ul of crRNA-1 (1 uM) RPA enzyme premix 14.5 ul, 1.5 ul mgAc (280 mM), 4 ul Lbcas12a protein (2 uM).

[0065] The result of the orthogonal amplification efficiency screening is as Figure 2As shown, the results show that the combination of crRNA-1 and amplification primer pair prime-F2 / R2 has the best amplification efficiency.

[0066] That is, in the CRISPR detection primer set for Acinetobacter baumannii in this embodiment, the selected crRNA sequence is:

[0067] crRNA-1: 5’-UAAUUUCUACUAAGUGUAGAUAUGAGAGCUUCUGUUUGUUCUCCC CAAUCCUU-3’ (SEQ ID NO:2);

[0068] The forward amplification primer sequence is:

[0069] Prime-F2: 5’-AGTAGAAACCTGCCTATACGTTGGCCTTTATCAA-3’ (SEQ ID NO:6);

[0070] The reverse amplification primer sequence is:

[0071] Prime-R2: 5’-AGCTTCGGAAAACAAACACGCACGTGCCTGAAT-3’ (SEQ ID NO:10).

[0072] Example 2

[0073] Sensitivity test.

[0074] The plasmid containing the Acinetobacter baumannii specific target fragment in Example 1 was measured for the initial concentration of the plasmid by ultraviolet spectrophotometry, and the plasmid was diluted ten-fold with enzyme-free water. The crRNA-1 sequence (SEQ ID NO:2), Prime-F2 (SEQ ID NO:6) and Prime-R2 (SEQ ID NO:10) in Example 1 were selected for detection.

[0075] The detection results are as Figure 3 shown. The sensitivity of the CRISPR detection primer set in Example 1 for detecting the plasmid is 100 ag / ul, and when converted to the number of copies, it is 200 copies / ml.

[0076] Example 3

[0077] Specificity test.

[0078] Select the crRNA-1 sequence (SEQ ID NO: 2), Prime-F2 (SEQ ID NO: 6), and Prime-R2 (SEQ ID NO: 10) in Example 1, and perform RPA amplification on common pathogenic bacteria such as Acinetobacter baumannii, Mycobacterium tuberculosis, Staphylococcus aureus, Shigella, Salmonella, Mycoplasma pneumoniae, Staphylococcus epidermidis, Streptococcus pyogenes, Candida albicans, Klebsiella pneumoniae, and Streptococcus pneumoniae. Use Streptococcus pneumoniae as a negative control to test the specificity of the CRISPR detection primer set of the present invention.

[0079] The detection results are as Figure 4 shown. It can be seen that the CRISPR detection primer set of the present invention only amplifies the Acinetobacter baumannii sample and does not amplify other non-Acinetobacter baumannii, indicating that the invention has good specificity.

[0080] Example 4

[0081] A kit for rapid detection of Acinetobacter baumannii.

[0082] The kit includes the CRISPR detection primer set (crRNA-1, Prime-F2, and Prime-R2) for Acinetobacter baumannii in Example 1, RPA enzyme premix, signal reporter probe, Lbcas12a protein, magnesium acetate, Tris-HCl, and DTT.

[0083] The technical features of the above embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0084] The above embodiments only represent several implementation manners of the present invention, and the description is relatively specific and detailed. However, it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the invention patent shall be subject to the appended claims.

Claims

1. A CRISPR detection primer set for Acinetobacter baumannii, characterized in that: It includes an amplification primer pair and crRNA; the amplification primer pair is used to amplify the conserved sequence of Acinetobacter baumannii; the crRNA includes an anchor sequence and a guide sequence, the anchor sequence binds to the cas protein, and the guide sequence matches the target DNA fragment in the conserved sequence; The crRNA sequence is shown in SEQ ID NO: 2; The forward amplification primer in the amplification primer pair is shown as SEQ ID NO: 6; the reverse amplification primer in the amplification primer pair is shown as SEQ ID NO:

10.

2. The CRISPR detection primer set for Acinetobacter baumannii according to claim 1, characterized in that The conserved sequence is shown in SEQ ID NO:

1.

3. Use of the CRISPR detection primer set for Acinetobacter baumannii according to any one of claims 1 to 2 in developing and / or preparing a product for diagnosing and / or evaluating the prognosis of a disease caused by infection with Acinetobacter baumannii, wherein the disease caused by infection with Acinetobacter baumannii includes: Bacteremia, pneumonia, meningitis, peritonitis, endocarditis, urinary tract infection, or skin infection.

4. A kit for detecting Acinetobacter baumannii, characterized in that: A CRISPR detection primer set for Acinetobacter baumannii comprising any one of claims 1-2.

5. The kit for detecting Acinetobacter baumannii according to claim 4, characterized in that The kit also includes a signal reporter probe and Cas12a protein.

6. The kit for detecting Acinetobacter baumannii according to claim 5, characterized in that The cas12a protein is Lbcas12a protein.

Images