Primer sets, reagents or kits and methods of strain screening and applications employing the same

Abstract

The application belongs to the field of agricultural microorganism application, and particularly relates to a primer group, a reagent or a kit, and a strain screening method and application adopting the same. The primer group is designed according to a conserved sequence of a structural gene fragment in an iturin A synthesis gene cluster. The structural gene in the iturin A synthesis gene cluster includes: ituA gene, ituB gene, and ituC gene. The primer group includes: primer pair I, primer pair II, and primer pair III. The primer group of the application is designed according to a conserved sequence of a structural gene fragment in an iturin A synthesis gene cluster, so as to specifically amplify a key structural gene ( ituA gene, ituB gene, and ituC gene) in the iturin A synthesis gene cluster. By using the primer group, combining a PCR amplification technology and an electrophoresis detection technology, and then rapidly, accurately and low-costly screening a bacillus positive strain capable of producing iturin A, the application has a wide application prospect.​​​​​​​​​​​​

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbiology applications, specifically involving primer sets, reagents or kits, and methods and applications for strain screening using them. Background Technology

[0002] Iturin A is a compound produced by a strain of Bacillus spp. Bacillus Ituronidin A is a class of lipopeptide antibiotics produced by pathogens. It contains an amino acid ring and a β-fatty acid side chain, exhibiting strong antifungal and broad-spectrum antibacterial activity. Its main mechanism is to disrupt the cell membrane of pathogens, causing leakage of cell contents, thereby inhibiting the growth and reproduction of pathogens. For example, ituronidin A is effective against soil-borne pathogens causing plant diseases, such as Fusarium (Fusarium solani). Fusarium ) and Pythium ( Pythium It has a good inhibitory effect. In addition to its antibacterial effect, ituronidin A can also act as a plant growth promoter, inducing plants to produce a defensive response, enhancing their resistance to stress, and thus promoting healthy plant growth.

[0003] However, iturobrine A is a secondary metabolite of microorganisms, and its fermentation level is currently low. Furthermore, the downstream separation and extraction are complex and costly, which greatly limits its industrial production and application. Therefore, it is of great significance to screen for engineered bacteria that can produce high yields of iturobrine A for industrial application.

[0004] To screen for Bacillus strains that produce iturobrinein A, traditional methods typically rely on the isolation and purification of the strains, fermentation culture, and subsequent chromatographic detection. Specifically, a large number of Bacillus strains need to be isolated and purified from the natural environment, each strain is then fermented, and finally, chromatographic detection is used to determine whether the strain can produce iturobrinein A. Although this method can screen for the target strain, it has many shortcomings, mainly including low screening efficiency, high screening and detection costs, and insufficient accuracy.

[0005] Therefore, there is an urgent need to develop a screening method for Bacillus that produces Irucidine A, which has high screening efficiency, low detection cost, and high accuracy. Summary of the Invention

[0006] This invention aims to at least partially address one of the technical problems existing in the prior art. To this end, this invention provides primer sets, reagents or kits, and methods and applications for strain screening using the same. The primer sets of this invention are designed based on conserved sequences of structural gene fragments in the iturobrine A synthesis gene cluster, thereby enabling specific amplification of key structural genes in the iturobrine A synthesis gene cluster (…). sideA Gene, sideB Genes and sideCBy using this primer set, combined with PCR amplification and electrophoresis detection techniques, it is possible to rapidly, accurately, and cost-effectively screen for Bacillus strains that can produce iturobrinein A, with broad application prospects.

[0007] In a first aspect, the present invention provides a primer set. According to an embodiment of the invention, the primer set is designed based on conserved sequences of structural gene fragments in the iturobrine A synthesis gene cluster; wherein the structural genes in the iturobrine A synthesis gene cluster include: sideA Gene, sideB Genes and sideC The gene, wherein the structural gene fragments in the iturobrine A synthesis gene cluster include: sideA Gene fragments, sideB Gene fragments and side C Gene fragment; the primer set includes: primer pair I, primer pair II, and primer pair III; primer pair I, primer pair II, and primer pair III each include a forward primer and a reverse primer; the nucleotide sequence of the forward primer of primer pair I is shown in SEQ ID NO: 4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 5; the nucleotide sequence of the forward primer of primer pair II is shown in SEQ ID NO: 6, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 7; the nucleotide sequence of the forward primer of primer pair III is shown in SEQ ID NO: 8, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 9; primer pair I is used for screening and identification. sideA Gene, primer pair II is used for screening and identification sideB Genes, primer pair III is used for screening and identification. sideC Genes. The primer set according to embodiments of the present invention is based on the structural genes in the iturobrine A synthesis gene cluster (…). sideA Gene, sideB Genes and side C The primer set is designed and synthesized from conserved sequences of gene fragments, possessing high specificity and sensitivity. It can specifically identify and amplify target gene fragments. By using this primer set to screen for Irquacin A-producing Bacillus, it is possible to quickly, accurately, and cost-effectively screen for positive strains of Bacillus that can produce Irquacin A, with broad application prospects.

[0008] In a second aspect, the present invention provides a reagent or kit. According to embodiments of the invention, it includes: the primer set described in the first aspect; the reagent or kit is used for screening Bacillus species producing iturobacterium A (…). BacillusThe reagents or kits according to embodiments of the present invention provide a simple, efficient, low-cost, and standardized screening platform that, while ensuring the reproducibility and reliability of screening experimental results, reduces operational difficulty and human error, shortens screening time, and improves screening efficiency, enabling researchers to quickly and accurately screen Bacillus positive strains that produce iturobrine A.

[0009] In a third aspect, the present invention provides a method for screening Bacillus species that produce iturobacterium A. According to an embodiment of the present invention, the method includes the following steps: S1: performing genomic extraction on the Bacillus species to be tested to obtain a genomic sample; S2: using the primer set described in the first aspect or the reagents or kits described in the second aspect, performing PCR amplification on the genomic sample to obtain PCR amplification products, and determining the species produced by iturobacterium A in the genomic sample through the PCR amplification products. sideA Gene fragments, the aforementioned sideB Gene fragments and the aforementioned side C The presence or absence of gene fragments is used to determine whether the tested Bacillus is a positive strain producing iturobrine A; wherein, the criterion for determination is: if the tested Bacillus contains the gene fragment... sideA The band size obtained by electrophoresis detection of the amplified gene fragment is 750-780 bp. For the gene fragment containing... sideB The band size obtained by electrophoresis detection of the amplified gene fragment is 450-480 bp. (This refers to the band containing the gene fragment.) side C If the band size obtained by electrophoresis detection of the gene fragment amplification product is 620-680 bp, then the Bacillus to be tested is a positive strain producing iturobrine A.

[0010] According to the method of the present invention, a rapid, efficient, low-cost, and accurate strain screening process is provided. This method first extracts a genomic sample of the Bacillus spp. to be tested, then performs PCR amplification using the aforementioned primer set, reagents, or kits to specifically amplify the target gene and ensure screening accuracy. Finally, the results of electrophoresis or sequencing are used to visually determine whether the Bacillus spp. to be tested is a positive strain. The entire screening process is simple to operate, requiring no complex fermentation culture or chromatographic detection. Furthermore, the high sensitivity and specificity of this method effectively avoid misjudgments, improving the reliability and accuracy of the screening results, and providing a new approach for screening and identifying industrial strains capable of producing iturobrine A.

[0011] According to embodiments of the present invention, the above method may further have the following additional technical features: According to an embodiment of the present invention, the genome extraction process includes: culturing the Bacillus to be tested, centrifuging to collect bacterial cells, lysing the bacterial cells with a buffer containing lysozyme, heating to inactivate the lysozyme, centrifuging, and collecting the supernatant extract, wherein the supernatant extract is the genome sample.

[0012] In a fourth aspect, the present invention provides a method for evaluating the detection effect of the method described in the third aspect. According to an embodiment of the present invention, the method includes the following steps: fermenting a positive strain identified by the aforementioned method as producing iturobrine A to obtain a fermentation broth; detecting the iturobrine A concentration in the fermentation broth; and, based on the concentration detection result, further determining whether the positive strain is a producing strain of iturobrine A.

[0013] According to embodiments of the present invention, the above method may further have the following additional technical features: According to an embodiment of the present invention, the criteria for the second determination are as follows: if the concentration of iturobrine A in the fermentation broth is ≥0.2 mg / L in the concentration detection, then the positive strain is confirmed as a production strain of iturobrine A; otherwise, if the concentration of iturobrine A in the fermentation broth is <0.2 mg / L, then the positive strain is not a production strain of iturobrine A.

[0014] According to an embodiment of the present invention, the fermentation culture medium formula in the fermentation culture is as follows: soybean peptone 20-35 g / L, yeast powder 10-30 g / L, sucrose 30-50 g / L, potassium dihydrogen phosphate 0.5-1.0 g / L, magnesium sulfate heptahydrate 0.3-0.8 g / L, zinc sulfate 0.05-0.15 g / L, pH=6.6-7.5.

[0015] According to an embodiment of the present invention, the fermentation temperature of the fermentation culture is 33-37°C.

[0016] In a fifth aspect of the invention, the invention proposes the application of the primer set described in the first aspect, the reagent or kit described in the second aspect, and the method described in the third aspect in screening and identifying strains capable of producing iturobrine A.

[0017] Those skilled in the art will understand that the features and advantages described above for the methods of screening Bacillus spp. that produce itucrin A are equally applicable to this application and will not be repeated here.

[0018] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0019] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which: Figure 1 This refers to some strains of Bacillus B1-B40 in Example 2 of the present invention. sideA Electrophoretic pattern of gene fragment amplification products; Figure 2 This refers to some strains of Bacillus B1-B40 in Example 2 of the present invention. sideB Electrophoretic pattern of gene fragment amplification products; Figure 3 This refers to some strains of Bacillus B1-B40 in Example 2 of the present invention. side C Electrophoretic pattern of gene fragment amplification products. Detailed Implementation

[0020] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0021] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0022] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0023] In this document, the terms “comprising” or “including” are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0024] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0025] Primer set This invention proposes a primer set. According to an embodiment of the invention, the primer set is designed based on the conserved sequence of a structural gene fragment in the iturobrine A synthesis gene cluster; wherein, the structural gene in the iturobrine A synthesis gene cluster includes: sideA Gene, sideB Genes and side C The gene, wherein the structural gene fragments in the iturobrine A synthesis gene cluster include: sideA Gene fragments, sideB Gene fragments and side C Gene fragment; the primer set includes: primer pair I, primer pair II, and primer pair III; primer pair I, primer pair II, and primer pair III each include a forward primer and a reverse primer; the nucleotide sequence of the forward primer of primer pair I is shown in SEQ ID NO: 4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 5; the nucleotide sequence of the forward primer of primer pair II is shown in SEQ ID NO: 6, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 7; the nucleotide sequence of the forward primer of primer pair III is shown in SEQ ID NO: 8, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 9; primer pair I is used for screening and identification. sideA Gene fragments, primer pair II is used for screening and identification. sideB Gene fragments, wherein primer pair III is used for screening and identification. side C Gene fragments. The primer set according to embodiments of the present invention is based on the structural genes in the iturobrine A synthesis gene cluster (…). sideA Gene, sideB Genes and side C Designed from conserved sequences of gene fragments, these primer sets possess high specificity and sensitivity, enabling them to specifically identify and amplify target gene fragments. By utilizing these primer sets for screening Irquacin A-producing Bacillus, it is possible to rapidly, accurately, and cost-effectively screen for positive strains of Bacillus that can produce Irquacin A, with broad application prospects.

[0026] It should be noted that primer pair I is for... sideA The primer pair II is designed based on the conserved sequence of the gene fragment (see SEQ ID NO: 1 for the specific sequence). sideB The primer pair III was designed based on the conserved sequence of the gene fragment (see SEQ ID NO: 2 for the specific sequence). sideC The conserved sequence of the gene fragment was designed (see SEQ ID NO: 3 for the specific sequence).

[0027] In this paper, the term "structural genes in the iturobrine A synthesis gene cluster" refers to the core genes in the gene set related to iturobrine A synthesis. These genes play a crucial role in the biosynthesis of iturobrine A, including those encoding enzymes and regulatory proteins involved in the synthesis pathway. sideA Gene, sideB Gene, sideC Genes and pageD Genes, wherein the primers of the present invention detect key structural genes therein ( sideA Gene, sideB Genes and side C The presence or absence of genes, such as the presence of gene bands of the same size, can be used to determine whether the tested Bacillus has the ability to synthesize ituronic acid A.

[0028] reagents or kits This invention provides a reagent or kit. According to embodiments of the invention, it includes: the aforementioned primer set; the reagent or kit is used to screen Bacillus species producing iturobacterium A (…). Bacillus The reagents or kits according to embodiments of the present invention provide a simple, efficient, low-cost, and standardized screening platform that, while ensuring the reproducibility and reliability of screening experimental results, reduces operational difficulty and human error, shortens screening time, and improves screening efficiency, enabling researchers to quickly and accurately screen Bacillus positive strains that produce iturobrine A.

[0029] Methods for screening Bacillus strains that produce ituronic acid A This invention proposes a method for screening Bacillus species that produce iturobacterium A. According to an embodiment of the invention, the method includes the following steps: S1: performing genome extraction on the Bacillus species to be tested to obtain a genome sample; S2: using the aforementioned primer set or the aforementioned reagents or kits, performing PCR amplification on the genome sample to obtain PCR amplification products, and determining the presence of iturobacterium A in the genome sample using the PCR amplification products. sideA Gene fragments, the aforementioned sideB Gene fragments and the aforementioned sideC The presence or absence of gene fragments is used to determine whether the tested Bacillus is a positive strain producing iturobrine A; wherein, the criterion for determination is: if the tested Bacillus contains the gene fragment... sideA The band size obtained by electrophoresis detection of the amplified gene fragment is 750-780 bp. For the gene fragment containing... sideB The band size obtained by electrophoresis detection of the amplified gene fragment is 450-480 bp. (This refers to the band containing the gene fragment.) sideCIf the band size obtained by electrophoresis detection of the amplified gene fragment is 620-680 bp, then the Bacillus to be tested is a positive strain producing iturobrinein A. According to the method of this embodiment, a rapid, efficient, low-cost, and accurate strain screening process is provided. This method first extracts a genomic sample of the Bacillus to be tested, then performs PCR amplification using the aforementioned primer set, reagents, or kits to specifically amplify the target gene fragment to ensure the accuracy of screening. Finally, the results of electrophoresis or sequencing are used to intuitively determine whether the Bacillus to be tested is a positive strain. The entire screening process is simple to operate, requiring no complex fermentation culture or chromatographic detection. Furthermore, the high sensitivity and specificity of this method effectively avoid false positives, improving the reliability and accuracy of the screening results, and providing a new approach for screening and identifying industrial strains capable of producing iturobrinein A.

[0030] It should be noted that in step S1, when performing genome extraction on the Bacillus to be tested, obtaining a crude genome extract of the Bacillus to be tested is sufficient; extracting a high-purity genome of the Bacillus to be tested is not necessary. Thus, the method of the present invention can greatly simplify the experimental operation process, reduce screening costs, and enhance the applicability of the method while ensuring screening accuracy.

[0031] According to an embodiment of the present invention, the genome extraction process includes: culturing the Bacillus to be tested, centrifuging to collect bacterial cells, lysing the bacterial cells with a buffer containing lysozyme, heating to inactivate the lysozyme, centrifuging, and collecting the supernatant extract, wherein the supernatant extract is the genome sample.

[0032] For example, in the specific practice of screening Bacillus that produces iturobrinein A, in step S1, a single colony of the isolated and purified Bacillus to be tested can be inoculated into LB liquid medium for culture. 1.5 mL of bacterial culture is taken, centrifuged to remove the supernatant, and resuspended with lysozyme at a final concentration of 10-20 mg / mL. The culture is then heated to 37°C for 15-30 min, rapidly heated to above 80°C for 5-10 min, centrifuged, and the supernatant is collected to prepare the crude genomic extract of the Bacillus to be tested (i.e., the genomic sample).

[0033] According to an embodiment of the present invention, the PCR amplification system may include: 0.5-1.0 μL of the genomic sample, 0.5-1.0 μL of the forward primer, 0.5-1.0 μL of the reverse primer, 10 μL of DNA polymerase (2×Taq Master Mix), and deionized water to make up the total volume of the system to 20 μL.

[0034] For example, in the specific practice of screening Bacillus that produces ituronic acid A, in step S2, the PCR amplification system (total 20 μL) can be prepared as follows: template 1.0 μL, forward primer 0.5 μL, reverse primer 0.5 μL, 2×DNA mix polymerase 10 μL, deionized water 8.0 μL; the PCR amplification program parameters can be set as follows: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 10 s, 52℃ annealing for 15 s, 72℃ extension for 30 s, 32 cycles, 72℃ full extension for 5 min, and storage at 4℃. It should be noted that the PCR annealing temperature is generally controlled between 50℃ and 55℃.

[0035] It should be noted that in the specific practice of screening Bacillus strains producing iturobrinein A, if electrophoresis is used to detect PCR amplification products, due to the specificity of the primer set of this invention, if the corresponding band can be detected, it can be determined that the Bacillus strain to be tested is a positive strain producing iturobrinein A. sideA The target length of the amplified gene fragment is 750–780 bp, targeting the gene fragment containing the specified gene fragment. sideB The target length of the amplified gene fragment is 450–480 bp, targeting the gene fragment containing the specified gene fragment. sideC The target length of the gene fragment amplification product is 620–680 bp; conversely, if the amplification product band is not detected in the electrophoresis detection, the Bacillus to be tested is determined to be a negative strain.

[0036] It should be noted that the detection methods for PCR amplification products include electrophoresis detection, sequencing of PCR amplification products, etc. When performing electrophoresis detection on PCR amplification products, it is not limited to the specific electrophoresis method (agarose gel electrophoresis) used in the embodiments of the present invention, but also includes polyacrylamide gel electrophoresis, capillary electrophoresis, microarray electrophoresis and other electrophoresis techniques. As long as these electrophoresis techniques can be applied to the method of the present invention and can realize the detection of the length and characteristic bands of PCR amplification products, they are all within the protection scope of the present invention.

[0037] Methods for evaluating the detection effectiveness of the aforementioned methods According to an embodiment of the present invention, the method includes the following steps: fermenting a positive strain identified by the aforementioned method as producing iturobrine A to obtain a fermentation broth; detecting the iturobrine A concentration in the fermentation broth; and, based on the concentration detection result, further determining whether the positive strain is a production strain producing iturobrine A. Thus, through fermentation and concentration detection, the actual production capacity of the aforementioned positive strain screened by PCR is further verified, thereby screening for a production strain with high-efficiency iturobrine A production capacity.

[0038] According to an embodiment of the present invention, the fermentation medium formulation for the fermentation culture is as follows: soybean peptone 20-35 g / L, yeast extract 10-30 g / L, sucrose 30-50 g / L, potassium dihydrogen phosphate 0.5-1.0 g / L, magnesium sulfate heptahydrate 0.3-0.8 g / L, zinc sulfate 0.05-0.15 g / L, pH 6.6-7.5. This provides a suitable fermentation environment for the strain, enabling it to efficiently produce ituronidin A.

[0039] According to an embodiment of the present invention, the fermentation temperature of the fermentation culture is 33–37°C. This provides a suitable fermentation temperature for the strain, enabling it to efficiently produce ituronic acid A. Exemplarily, the fermentation temperature of the fermentation culture is 33°C, 34°C, 35°C, 36°C, or 37°C, preferably 35°C.

[0040] For example, in the specific practice of fermenting a positive strain identified as producing iturobrine A, the fermentation medium formula can be set as follows: 20.5 g / L soybean peptone, 18.8 g / L yeast extract, 32.6 g / L sucrose, 0.60 g / L potassium dihydrogen phosphate, 0.45 g / L magnesium sulfate heptahydrate, and 0.09 g / L zinc sulfate, with the pH adjusted to 7.0.

[0041] It should be noted that the method used to detect the concentration of iturobrine A in the fermentation broth is not limited to the specific method (liquid chromatography) used in the embodiments of the present invention. It also includes high performance liquid chromatography (HPLC), gas chromatography (GC), mass spectrometry (MS), ultraviolet-visible spectroscopy (UV-Vis), fluorescence spectroscopy, enzyme-linked immunosorbent assay (ELISA), and other methods. As long as these concentration detection methods can be applied to the method of the present invention and can realize the detection of the concentration of iturobrine A in the fermentation broth, they all fall within the protection scope of the present invention.

[0042] According to an embodiment of the present invention, the criterion for the secondary judgment is as follows: if the concentration of iturobrine A in the fermentation broth is ≥0.2 mg / L during the concentration detection, then the positive strain is confirmed as a production strain of iturobrine A; conversely, if the concentration of iturobrine A in the fermentation broth is <0.2 mg / L, then the positive strain is not a production strain of iturobrine A. Thus, by setting a specific concentration threshold, the iturobrine A production capacity level of the test strain can be accurately determined, thereby rapidly screening out Bacillus strains with high iturobrine A production capacity.

[0043] application This invention proposes the application of the aforementioned primer set, the aforementioned reagents or kits, and the aforementioned methods in screening and identifying strains capable of producing iturobrine A.

[0044] Those skilled in the art will understand that the features and advantages described above for the methods of screening Bacillus spp. that produce itucrin A are equally applicable to this application and will not be repeated here.

[0045] The nucleotide sequences involved in this invention are detailed in Table 1.

[0046] Table 1

[0047] It should be noted that the primer set (forward primer and reverse primer) described in this invention is designed based on the conserved sequence of the structural gene fragment in the iturobrine A synthesis gene cluster, where the conserved sequence refers to... sideA Gene fragment (SEQ ID NO: 1) sideB Gene fragment (SEQ ID NO: 2) sideC The conserved sequences of the nucleotides “A”, “T”, “G”, and “C” in the gene fragment (SEQ ID NO: 3) are as follows: sideA Gene fragment (SEQ ID NO: 1) sideB Gene fragment (SEQ ID NO: 2) sideC The gene fragment (SEQ ID NO: 3) has conserved regions at both ends (the primer sequences correspond to the conserved regions at both ends). This strategy aims to ensure that the primers are widely applicable to different microbial templates containing this gene cluster. It should be noted that the amplification products obtained by PCR amplification using this primer set have conserved regions at both ends (corresponding to the primer sequences), while the target region in the middle contains a portion of variable regions (represented by N in the specific sequence, which indicates that this portion of the sequence is a non-homologous sequence fragment between different microorganisms).

[0048] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0049] Example 1: Targeting sideA , sideB , sideC Primer design for gene fragments Search in the KEGG database (https: / / www.kegg.jp / ) sideA Genes, from which 20 are randomly selected sideA Gene sequence, gene entry The sequence numbers are: AJ82_10330, B9C48_09280, B938_09405, BACAU_1775, BAM5036_1755, BANAU_1943, BAPNAU_1926, BATR1942_07355, BAXH7_01618, BSUW23_09450, CWD84_11905, GYO_2202, KSO_010275, LL3_02002, MUS_2170, NG74_01894, RBAU_1793, U471_18710, U722_09615, and V529_17880. Then, DNAMAN software was used for gene sequence alignment. Based on the alignment results, all homologous regions (i.e., conserved regions) were identified, and a design was developed based on these homologous regions. sideA The principle for PCR amplification primers for gene fragments is that the amplification product length should be 100 bp to 1000 bp, and the primer length should be 15 bp to 50 bp. Primer synthesis was commissioned to Shanghai Bioengineering Co., Ltd. sideA Forward primer ituA-F (SEQ ID NO: 4) and reverse primer ituA-R (SEQ ID NO: 5) for gene fragments: ituA-F: ATGGCATGCGATTGAAGATGC (SEQ ID NO: 4) ituA-R:GATGCCTGCCGCTTCAAAC (SEQ ID NO: 5) according to sideA The principles of primer design for gene fragments, and the design of primers for each fragment. sideB Gene fragments and sideC PCR amplification primers for gene fragments were developed, and primer sequences were synthesized by Shanghai Bioengineering Co., Ltd., thereby obtaining... sideB The forward primer ituB-F (SEQ ID NO: 6) and the reverse primer ituB-R (SEQ ID NO: 7) for the gene fragment. sideC Forward primer ituC-F (SEQ ID NO: 8) and reverse primer ituC-R (SEQ ID NO: 9) for gene fragments: ituB-F:AGGGGTGGATATCATTAAATTGAC (SEQ ID NO: 6) ituB-R: AGCCACTTCGCCAAATC (SEQ ID NO: 7) ituC-F: TTCACTTTTGATCTGGCGAT (SEQ ID NO: 8) ituC-R:CGTCCGGTACATTTTCAC (SEQ ID NO: 9) Of these, the 20 used sideB The gene sequences, with their respective gene entry numbers, are: BSUW23_09445, GYO_2201, BIS30_20045, RBAM_018170, BACAU_1773, BANAU_1942, MUS_2169, B938_09400, BAM5036_1754, RBAU_1792, BASU_1772, BAPNAU_1927, AJ82_10325, V529_17870, NG74_01893, BAMF_1912, BAMTA208_07945, LL3_02001, BAXH7_01619, and KSO_010280; the 20 sequences used... sideC The gene sequences, with their respective gene entry numbers, are: BSUW23_09440, GYO_2200, BIS30_20040, RBAM_018160, BACAU_1772, BANAU_1941, MUS_2168, B938_09395, BAM5036_1752, RBAU_1791, BASU_1771, BAPNAU_1928, AJ82_10320, V529_17860, NG74_01892, BAMF_1911, BAMTA208_07950, LL3_02000, BAXH7_01621, and KSO_010285.

[0050] Example 2: PCR screening for Bacillus strains producing iturobrine A 1. Cultivating bacterial strains The isolated and purified candidate single spore-forming bacteria B1-B40 were inoculated into LB liquid medium and cultured overnight at 37°C.

[0051] The formulation of LB liquid culture medium is as follows: Yeast extract 5 g / L, tryptone 10 g / L, sodium chloride 10 g / L, pH=7.0, autoclaved at 121℃ for 20 min.

[0052] 2. Preparation of PCR template Both of the following methods can be used to prepare PCR templates: (1) Method 1: Rapid extraction method Take 1.5 mL of Bacillus B1~B40 bacterial culture, heat in a boiling water bath for 5 min, centrifuge at 10000 rpm for 1 min, and transfer the supernatant to another sterile centrifuge tube to obtain crude genomic extract I, which can be used as a PCR template for later use.

[0053] (2) Method 2: Lysozyme treatment 1.5 mL of Bacillus B1-B40 bacterial suspension was centrifuged at 8000 rpm for 10 min, the supernatant was removed, and the bacteria were resuspended with lysozyme at a final concentration of 20 mg / mL. The suspension was then incubated at 37°C for 20 min, followed by rapid warming to above 80°C and incubation at 8000 rpm for 5 min. The suspension was then centrifuged at 8000 rpm for 10 min, and the supernatant was transferred to another sterile centrifuge tube to obtain crude genomic extract II, which was used as a PCR template for later use.

[0054] 3. Preparation of PCR amplification reaction system Using the crude genomic extract obtained in step 2 as a template, the sample obtained in Example 1... sideA , sideB , sideC Three primer pairs for the gene fragment were used as primers. 2×Taq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number P111-03) was selected as the DNA polymerase for the preparation of the PCR amplification reaction system and the PCR reaction. The preparation of the PCR amplification reaction system is shown in Table 2, and the PCR reaction conditions are shown in Table 3.

[0055] Table 2. Preparation of PCR amplification reaction system

[0056] Table 3 PCR reaction conditions settings

[0057] 4. Detection of amplification products After the PCR reaction was completed, 3 μL of the amplification product was subjected to agarose gel electrophoresis. The electrophoresis results were observed under a gel imaging system to determine the length and size of the amplified positive bands for each gene. The amplified bands obtained in Example 1 were selected as the optimal bands. sideA The amplification product obtained by using the gene fragment primer pair as primers should have a band length in the range of 750–780 bp. The one obtained in Example 1 was selected. sideBThe amplification product obtained by using the gene fragment primer pair as primers should have a band length in the range of 450–480 bp. The one obtained in Example 1 is preferred. sideC If the amplification product obtained by using the gene fragment primer pair as primers has a band length in the range of 620-680 bp, then it can be preliminarily determined that the Bacillus is a positive strain that produces ituronic acid A.

[0058] Some strains of Bacillus B1-B40 sideA See gene fragment electrophoresis pattern Figure 1 Some strains of Bacillus B1-B40 sideB See gene fragment electrophoresis pattern Figure 2 Some strains of Bacillus B1-B40 sideC See gene fragment electrophoresis pattern Figure 3 .

[0059] 5. Sequencing verification Bacillus B2 was preliminarily identified as one of the positive strains producing itukobacterium A through step 4. The PCR products obtained from this strain were sent to Shanghai Bioengineering Co., Ltd. for sequencing, yielding the sequencing sequences ItuA SEQ1 (SEQ ID NO: 10), ItuB SEQ2 (SEQ ID NO: 11), and ItuC SEQ3 (SEQ ID NO: 12), as shown below: (1) ItuA SEQ1: ATGGCATGCGATTGAAGATGCAGGCTATGCCGGCGACACCATTAGCGGGAGTCAGCTCGGGGTATATGTAGGGTACTCGAAGGTGGGATACGATTACGAACGTCTCCTTTCTGCGAATTATCCGGAGGAGCTTCATCATTATATTGTGGGCAATCTTCCCTCGGTGTTGGCGAGTCGAATTGCTTACTTTCTAAATTTGAAAGGACCAGCGGTTACCGTGGATACAGCTTGCTCTTCGTCACTTGTTGCTGTTCATATGGCATGTAAAGCTTTGCTTACAGGCGATTGTGAAATGGCTCTTGCCGGGGGTATTCGAACTTCGCTATTACCGATGCGTATCGGTCTCGATATGGAATCTTCTGACGGGCTCACGAAAACGTTCAGCAAGGATTCGGACGGAACAGGCTCTGGCGAAGGCGTGGCAGCAGTCCTGTTGAAACCTTTGCAGGCTGCGATTCGCGATGGAGATCATATTTATGGTGTGATCAAGGGAAGCGCGATAAACCAAGACGGGACAACCGTTGGAATCACCGCACCGAGCCCGGCAGCTCAGACCGAGGTGATTGAGATGGCCTGGAAAGACGCTGGCATTGCTCCTGAAACATTGTCTTTCATTGAAGCACACGGCACCGGAACCAAGCTCGGGGATCCTGTTGAATTTAACGGTCTTTGTAAAGCGTTTGAGAAGGTTACGGAAAAGAAACAGTTTTGTGCGATCGGCTCTGTTAAAGCAAACATCGGTCATTTGTTTGAAGCGGCAGGCATC(SEQ ID NO:10) (2)ItuB SEQ2: AGGGTGGATATCATTAAATTGACCCCGGCTCATTTGCATGTATTGAAAGCAATGAACATTGCCAATAAGATAGCGATTCGAAAAATGATCGTAGGAGGAGAGAATCTCAGCACTCAGTTAGCCCAAAGCATTCATGAGCAATTCGACGGCCAAATTGAAATATGTAATGAGTACGGGCCGACGGAAACTGTTGTCGGATGCATGCTTTATCGTTACGATGCAGTCAAAGACAGGCGGGAATCGGTGCCAATCGGTACAGCTGCGGCAAACACGAGCATTTATGTGTTAGACGAGGACATGAAACCGGTGCCGATCGGCGTACCTGGAGAAATGTATATAAGCGGAGCCGGCGTTGCCAGAGGATATTTGAACCGGCCGGAATTAACAGCTGAGAAATTTGTTGAAAACCCGTTTGTAACCGGAGAAAGGATGTATAAGACCGGGGATTTGGCGAAGTGGCT(SEQ ID NO:11) (3)ItuC SEQ3 (SEQ ID NO: 12) The results showed that the ItuA SEQ1 (SEQ ID NO: 10) sequence of Bacillus B2 was 766 bp in length, within the range of 750–780 bp, and the cloning result was positive; the ItuB SEQ2 (SEQ ID NO: 11) sequence was 461 bp in length, within the range of 450–480 bp, and the cloning result was positive; the ItuC SEQ3 (SEQ ID NO: 12) sequence was 658 bp in length, within the range of 620–680 bp, and the cloning result was positive. Therefore, Bacillus B2 was determined to be a positive strain producing iturobrinein A.

[0060] Example 3: Fermentation culture verification of candidate Bacillus strains B1-B40 1. Primary fermentation culture Candidate Bacillus strains B1-B40, preserved on fresh slant culture medium, were inoculated into primary fermentation medium and cultured at 33°C under shaking conditions for 16-18 h.

[0061] The formula for the primary fermentation medium is as follows: The mixture consisted of 30 g / L soybean peptone, 18 g / L yeast extract, 30 g / L sucrose, 0.75 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate, and 0.1 g / L zinc sulfate. The pH was adjusted to 7.0 using 25% sodium hydroxide and 1 mol / L sulfuric acid.

[0062] 2. Secondary fermentation culture Inoculate the bacterial culture from step 1 into the secondary fermentation medium at an inoculation rate of 10%, and incubate at 37°C and 220 rpm for 72 h to end fermentation.

[0063] The formula for the secondary fermentation medium is the same as that for the primary fermentation medium.

[0064] 3. Determination of iturobrine A concentration by liquid chromatography 1.0 mL of the secondary fermentation broth of Bacillus B2 was transferred to a 1.5 mL centrifuge tube and centrifuged at 12000 r / min for 8 min. 0.4 mL of the supernatant was transferred to 1.2 mL of methanol, vortexed, and allowed to stand at room temperature for 20 min. Then, it was centrifuged at 12000 r / min for 5 min. After filtration through a 0.44 μm filter membrane, the sample was used for HPLC detection. The HPLC system was an Agilent 1260 series, the column was an XDB-C18 (250 × 4.6 mm, 5 μm), the mobile phase was 10 mmol / L ammonium acetate / acetonitrile = 65:35 (V / V), the detection wavelength was 210 nm, and the flow rate was 1.0 mL / min.

[0065] The PCR amplification and fermentation culture detection results of the candidate Bacillus B1~B40 structural gene fragments are shown in Table 4.

[0066] Table 4. PCR amplification and fermentation culture detection results of candidate Bacillus strains B1-B40

[0067] In Table 3, “-” indicates negative, “+” indicates positive, and “ / ” indicates that this part of the experiment was not performed.

[0068] The results show: sideA , sideB , sideCCandidate spore strains that show positive results for gene fragment screening (such as Bacillus B2, Bacillus B5, Bacillus B10, Bacillus B13, etc.) can all ferment to produce itursin A.

[0069] The above results demonstrate that the PCR screening method of this invention can accurately identify the target strain (which can metabolize and produce iturobrine A). This method is simple and rapid to operate, without the need for cumbersome culture processes and chromatographic detection procedures, providing strong technical support for the development and application of high-efficiency iturobrine A-producing strains.

[0070] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0071] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A primer set for screening Bacillus species producing iturobrinein A, characterized in that, The primer set was designed based on the conserved sequence of the structural gene fragment in the iturobrine A synthesis gene cluster; The structural genes in the iturobrine A synthesis gene cluster are: ituA Gene, ituB Genes and ituC Gene; the structural gene fragment in the iturobrine A synthesis gene cluster is: ituA Gene fragments, ituB Gene fragments and ituC Gene fragments; The primer set consists of primer pair I, primer pair II, and primer pair III; Primer pair I, primer pair II, and primer pair III each include a forward primer and a reverse primer; The nucleotide sequence of the forward primer of primer pair I is shown in SEQ ID NO: 4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 5; The nucleotide sequence of the forward primer of primer pair II is shown in SEQ ID NO: 6, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 7; The nucleotide sequence of the forward primer of primer pair III is shown in SEQ ID NO: 8, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 9; Primer pair I is used for screening and identification. ituA Gene fragments, primer pair II is used for screening and identification. ituB Gene fragments, wherein primer pair III is used for screening and identification. ituC Gene fragments.

2. A reagent or kit, characterized in that, include: The primer set as described in claim 1; The reagent or kit is used to screen Bacillus species that produce iturobrinein A.

3. A method for screening Bacillus species that produce iturobrinein A, characterized in that, The method includes the following steps: S1: Perform genome extraction on the Bacillus to be tested to obtain a genome sample; S2: Using the primer set described in claim 1 or the reagent or kit described in claim 2, perform PCR amplification on the genomic sample to obtain PCR amplification products, and determine the specific genome sample containing the genome product through the PCR amplification products. ituA Gene fragments, the aforementioned ituB Gene fragments and the aforementioned ituC The presence or absence of gene fragments is used to determine whether the Bacillus spp. to be tested is a positive strain that produces ituronic acid A. The criteria for judgment are as follows: If it refers to the above ituA The band size obtained by electrophoresis detection of the amplified gene fragment is 750-780 bp. (This refers to the band containing the gene fragment.) ituB The band size obtained by electrophoresis detection of the amplified gene fragment was 450–480 bp, and the band size for the gene fragment containing the amplified gene fragment was 450–480 bp. ituC If the band size obtained by electrophoresis detection of the gene fragment amplification product is 620-680 bp, then the Bacillus to be tested is a positive strain producing iturobrine A.

4. The method according to claim 3, characterized in that, The genome extraction process includes: The Bacillus spp. to be tested was cultured, and the bacterial cells were collected by centrifugation. The bacterial cells were then lysed using a buffer containing lysozyme, followed by heating to inactivate the lysozyme, and centrifugation was performed. The supernatant was collected, and the supernatant was the genomic sample.

5. The method according to claim 3, characterized in that, The method further includes: The positive strain producing iturobrine A was fermented to obtain a fermentation broth, and the concentration of iturobrine A in the fermentation broth was detected. Based on the concentration detection results, it was determined whether the positive strain was a production strain producing iturobrine A.

6. The method according to claim 5, characterized in that, The criteria for the second judgment are as follows: In the concentration detection, if the concentration of iturobrine A in the fermentation broth is ≥0.2 mg / L, then the positive strain is confirmed as a production strain of iturobrine A; otherwise, if the concentration of iturobrine A in the fermentation broth is <0.2 mg / L, then the positive strain is not a production strain of iturobrine A.

7. The method according to claim 5, characterized in that, The fermentation medium formula used in the fermentation culture is as follows: Soybean peptone 20–35 g / L, yeast powder 10–30 g / L, sucrose 30–50 g / L, potassium dihydrogen phosphate 0.5–1.0 g / L, magnesium sulfate heptahydrate 0.3–0.8 g / L, zinc sulfate 0.05–0.15 g / L, pH=6.6–7.

5.

8. The method according to claim 5, characterized in that, The fermentation temperature for the fermentation culture is 33–37°C.

9. The use of the primer set of claim 1, the reagent or kit of claim 2, and the method of any one of claims 3 to 8 in screening and identifying spore strains capable of producing iturobrine A.

Images