Specific primers for identifying five phoebe wood species and application thereof
By using DNA barcoding technology, and employing DNA barcodes composed of specific primers PB958, PCHui831, PS827, and PZ805, combined with PCR amplification and sequencing, the problem that traditional wood identification methods cannot identify Phoebe genus wood down to the species level has been solved, achieving rapid and accurate wood identification.
Patent Information
- Application Number
- CN202310346127.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-03
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2043-04-03
AI Technical Summary
Traditional wood identification methods cannot accurately identify Phoebe zhennan wood down to the species level. They are complex, time-consuming, and require a high level of professional knowledge.
Five species of Phoebe wood were identified by using DNA barcoding composed of specific primers PB958, PCHui831, PS827 and PZ805, combined with molecular biology methods, through PCR amplification and sequencing.
It enables rapid and accurate identification of five species of Phoebe wood, simplifies the operation process, reduces the requirement for professional knowledge, can be performed in a general PCR laboratory, and eliminates the adulteration of Phoebe wood products.
Smart Images

Figure CN116144829B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biological detection for wood species identification, specifically involving molecular identification methods for various types of wood in the genus *Machilus* and the primers used therein. Background Technology
[0002] Nanmu (Phoebe zhennan) is a traditional and precious tree species in my country, often referred to as "gold among woods." Its wood is straight and round, with beautiful grain, fine texture, toughness, and a lasting fragrance, making it a superior material for construction, furniture, carving, and precision wood molds. Nanmu is a typical mature forest species, highly valued throughout history, and was even the "imperial wood" used by emperors during the Ming and Qing dynasties. Historically, Nanmu was considered the most valuable of the four famous trees of Jiangnan (Nanmu, Camphor, Catalpa, and Phoebe zhennan), but severe logging has led to many species becoming endangered or vulnerable. According to the *China Plant Red Data Book—List of Rare and Endangered Plants* (Volume 1) and the *National Key Protected Wild Plants List* (Batch 2) approved and published by the State Council in 2021, *Phoebe zhennan*, *Phoebe bournei*, and *Phoebe chekiangensis* are all vulnerable species and are classified as Class II protected plants in China. According to GB / T 16734-1997 "Names of Major Timbers in China", Phoebe refers to tree species of the genus Phoebe in the Lauraceae family. There are about 35 species of Phoebe in China, distributed south of the Yangtze River, especially in the southwest.
[0003] Currently, "golden silk" Phoebe zhennan wood remains one of the most sought-after precious woods by consumers and furniture manufacturers, possessing significant commercial value. With the surge in demand for golden silk Phoebe zhennan wood, disputes between buyers and sellers are also becoming increasingly prominent. In civil and criminal cases involving timber, especially furniture and handicrafts, buyers have a pressing need for the identification of golden silk Phoebe zhennan wood. To protect consumers' legitimate interests, regulate the timber trade market, and protect the ecological environment, the scientific and accurate identification of timber is imperative.
[0004] Traditional wood identification methods are based on wood anatomy, primarily relying on a combination of macroscopic and microscopic characteristics. However, these methods are complex, time-consuming, and require a high level of expertise. Furthermore, they generally only identify the genus or class, which limits the scope of wood identification. Therefore, alternative methods are needed to address the challenge of identifying Phoebe zhennan to the species level. Molecular biology methods represent a breakthrough technology for overcoming this challenge. Summary of the Invention
[0005] The technical problem this invention aims to solve is that traditional wood identification techniques cannot accurately identify five species of *Phoebe* wood. Therefore, the first objective of this invention is to provide specific primers for identifying these five species. The second objective is to provide a method for identifying these five species. The third objective is to provide the application of the specific primers and molecular biology methods in identifying these five species.
[0006] The technical solution adopted in this invention is as follows:
[0007] A specific primer for identifying five species of Phoebe wood is provided, wherein the specific primers are PB958, PCHui831, PS827, and PZ805. The primer sequence information of PB958, PCHui831, PS827, and PZ805 is shown in Table 2.
[0008] Preferably, the five species of Phoebe wood are P. zhennan (PZ), P. hui (PH), P. bournei (PB), P. sheareri (PS), and P. chekiangensis (PC).
[0009] In addition, the present invention provides a method for identifying five species of Phoebe wood. This method utilizes DNA barcoding and molecular biology techniques to identify the five species of Phoebe wood. The specific primers are DNA barcodes formed by the complete combination of PB958+PCHui831+PS827+PZ805.
[0010] Specifically, the method includes the following steps:
[0011] (1) Pretreatment of wood samples;
[0012] (2) Extract DNA from the wood samples treated in (1);
[0013] (3) Using the DNA extracted in step (2) as a template, PCR amplification was performed on the sequences PB958, PCHui831, PS827 and PZ805;
[0014] (4) Sequencing the PCR amplification products obtained in step (3) yielded the amplification sequences of PB958, PCHui831, PS827 and PZ805, and then analyzing them.
[0015] (5) The amplified sequences of PB958, PCHui831, PS827 and PZ805 obtained in step (4) were compared with the database to identify five species of Phoebe wood.
[0016] Based on the above technical solution, the wood powder grinding in step (1) involves cutting wood into wood chips and then grinding them using a ball mill, with the final sample size being approximately 5 micrometers.
[0017] The DNA described in step (2) was extracted using the DNeasy PlantMini Kit (Qiagen, Hilden, Germany) with a final DNA concentration of 1–100 ng / μL.
[0018] The PCR amplification primer sequences for step (3) are shown in Table 2, specifically No. 1-2 for PB958, No. 3-4 for PCHui831, No. 5-6 for PS827, and No. 7-8 for PZ805.
[0019] The PCR amplification reaction system in step (3) consists of 19 μL ddH2O, 25 μL Mix, 2 μL single primer, and 2 μL template DNA. The PCR reaction conditions are: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 57℃ annealing for 15 s, 72℃ extension for 30 s, for 35 cycles; and 72℃ final extension for 5 min.
[0020] The database link mentioned in step (5) is: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi. Log in to the database BLAST (a biomolecular sequence alignment and search tool) for alignment. Use the amplified sequence results of PB958, PCHui831, PS827 and PZ805 obtained in step (4) to identify the five species of Phoebe wood.
[0021] Meanwhile, this invention provides the application of the above-mentioned DNA combination barcode, or the above-mentioned method, in the identification of five species of Phoebe wood.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] 1. This invention does not require the wood to have a complete morphological structure. Only a very small sample of the wood is needed to meet the testing requirements, making the operation simple. It overcomes the technical limitations of traditional identification methods, which mainly rely on morphological identification and must be based on the premise that the wood has a complete and easily identifiable morphological structure.
[0024] 2. Based on the specific primers set in this invention, it can accurately identify five species of Phoebe wood, breaking through the limitation of traditional wood identification technology that cannot identify wood to the "species" level.
[0025] 3. The identification primers screened in this invention have good specificity and high amplification and sequencing success rates;
[0026] 4. The preferred DNA barcode sequences PB958, PCHui831, PS827, and PZ805 of this invention show obvious differential sites in five species of Phoebe wood, and have strong identification ability.
[0027] 5. The experimental conditions required for this invention are minimal and can be met by most PCR laboratories.
[0028] In summary, the specific primers and methods provided by this invention can accurately identify five species of Phoebe wood, solving the problem that traditional wood identification methods cannot identify Phoebe wood to the "species" level. This invention effectively meets the requirements of various relevant departments for rapid screening and identification of Phoebe wood, and can effectively prevent adulteration and counterfeiting of Phoebe wood products. It is of great significance for protecting consumer rights, enhancing brand value, regulating the market, and promoting the protection and utilization of species resources. Attached Figure Description
[0029] Figure 1 A graph showing the OD values of different DNA extraction samples;
[0030] Figure 2 The determination rules (analysis of results of distinguishing five species of Phoebe wood using four pairs of primers PB958, PCHui831, PS827 and PZ805);
[0031] Figure 3 A gel image for identifying unknown samples based on the specific primer PZ805;
[0032] Figure 4 The results of DNA sequence analysis for identifying unknown samples based on the DNA barcode PZ805. Detailed Implementation
[0033] To facilitate understanding of the present invention, the following embodiments are provided. Those skilled in the art should understand that these embodiments are merely illustrative and should not be construed as limiting the scope of the invention.
[0034] Unless otherwise specified, all raw materials used in this invention are commercially available or prepared according to conventional methods in the art. Unless otherwise defined or stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art.
[0035] Example 1: Design of wood-specific primers for Phoebe species
[0036] (1) Downloaded chloroplast genes of the genus *Machilus* from GenBank, namely *Machilus nanmu* (GenBank accession numbers: MH033832.1, MF315089.1, OM022244.1, OM022243.1, OM022242.1, MT621579.1) and *Machilus sieboldii* (GenBank accession numbers: OM022241.1, OM022240.1, OM022239.1, MT621612.1). Minnan (GenBank login numbers: MF315088.1, KY346512.1, MZ433403.1, MT621604.1), Zinan (GenBank login numbers: KX437773.1, MT621646.1, MT621630.1, MT621573.1), Zhejiang Nan (GenBank login numbers: KY346511.1, MZ433405.1, NC_034925.1)
[0037] (2) Using NCBI software to compare sequences, we found and determined the differential sites in the DNA barcode sequences of five species of Phoebe, including Phoebe zhennan, Phoebe bournei, Phoebe simonii, Phoebe zhennan and Phoebe zhennan.
[0038] (3) NCBI software was used to screen and design primers for five species of Phoebe zhennan, including Phoebe bournei, Phoebe simonii, Phoebe zhennan, and Phoebe zhennan. Based on the specific sequences among the five species, four pairs of primers with PCR product lengths of 600-900 bp, Tm of 55-59℃, and lengths of 20-25 bp were designed and named PB958, PCHui831, PS827, and PZ805, respectively. The specific primer sequences are shown in Table 2.
[0039] Table 1. DNA barcode sequences of the genus *Machilus* downloaded from GenBank.
[0040]
[0041]
[0042] Table 2. Specific primer sequence information
[0043]
[0044] Example 2: Selection and determination of specific primers for five species of Phoebe wood standard samples
[0045] (1) Standard sample collection: Five standard samples of the genus Phoebe were collected from Wenjiang District of Chengdu City, Sichuan Province, Jindong Forest Farm of Yongzhou City, Hunan Province, Shoulin Forest Farm of Jiande, Zhejiang Province, and Wenjiang District of Chengdu City, Sichuan Province, respectively.
[0046] (2) Sample preparation: Select wood samples and use a scalpel blade disinfected with 70% alcohol to remove the outer surface of the wood sample to avoid external contamination; cut the wood sample into several wood chips and grind them with a ball mill for 2 minutes at a frequency of 30 cps; after grinding, pass the wood powder through a 200-mesh sieve and dispense the fine wood powder into several 50 mL microcentrifuge tubes, with 500 mg of wood powder in each tube, and store them in a -80℃ low temperature freezer for later use.
[0047] (3) DNA extraction: DNA was extracted from five species of Phoebe wood in a sterilized clean working environment using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany).
[0048] (4) PCR amplification and sequencing: The primer pairs were the four DNA barcode sequence primers in Example 1. PCR amplification was performed using DNA extract as a template. The reaction system was 50 μL: 19 μL ddH2O, 25 μL Mix, 2 μL single primer, and 2 μL template DNA. All PCR reactions were performed on a PCR amplification instrument.
[0049] The reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 57℃ annealing for 15 s, 72℃ extension for 30 s, repeated 35 times; final extension at 72℃ for 5 min. This yielded efficiently amplified DNA fragments. The amplified products were then purified and subjected to bidirectional direct sequencing.
[0050] The sequencing results were evaluated using SeqMan software. Low-quality portions at both ends were removed, and the remaining portions were then evaluated for quality. Only those that met the quality requirements were used for sequence assembly and proofreading. The barcode sequences of five species of Phoebe wood, namely PB958, PCHui831, PS827, and PZ805, are shown in Table 2.
[0051] (5) Selection and determination of specific primers: Sequences were assembled using SeqMan software, and sequence homology analysis was performed by the National Center for Biotechnology Information (NCBI). The results showed that four primer pairs, PB958, PCHui831, PS827, and PZ805, could identify five species of Phoebe zhennan trees: Phoebe bournei, Phoebe simonii, Phoebe bournei, Phoebe zhennan, and Phoebe zhennan. Figure 2 ).
[0052] Example 3: DNA Identification of Unknown Wood Samples
[0053] (1) One wood sample was taken from Dujiangyan City, Chengdu, Sichuan Province. Through anatomical analysis, it was identified as Lauraceae wood, but the species Phoebe zhennan could not be determined. Therefore, the wood was identified based on DNA methods.
[0054] (2) Prepare wood flour and grind it to 200 mesh or higher.
[0055] (3) Extraction of DNA from wood.
[0056] In a sterilized, ultra-clean working environment, DNA was extracted from the wood using the method described in Example 2. The DNA then underwent purification to a final concentration of 1–100 ng / μL.
[0057] (4) PCR amplification reaction and sequencing.
[0058] Wood DNA extract was used as a template for PCR amplification, with primers listed as NO:1–NO:8. The reaction volume was 50 μL: 19 μL ddH2O, 25 μL Mix, 2 μL single primer, and 2 μL template DNA. All PCR reactions were performed on a PCR instrument. The reaction program was: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 57℃ annealing for 15 s, 72℃ extension for 30 s, for 35 cycles; and a final extension at 72℃ for 5 min. This yielded highly efficient amplified DNA fragments. The amplified products were purified and then subjected to bidirectional direct sequencing.
[0059] (5) Sequence alignment analysis and tree species identification.
[0060] The unknown sample was subjected to PCR amplification and sequencing using four pairs of specific primers: PB958, PCHui831, PS827, and PZ805. The gel image after amplification is shown below. Figure 3(P: Positive control; N: Negative control; B: Blank control; Mark: Nucleic acid molecular marker DL5000) The PCR amplification products of four pairs of specific primers were bidirectionally sequenced. The DNA sequence of the unknown sample identified based on the specific primer PZ805 is as follows (SEQ ID NO: 9): AATTTTCGACACAAGAAAAGGAATTTTCCGCCCTTTTCTTGTGTCGAAATAATAATGATTCTTGATCTTGTTCGTCAAAGATTACTGTTTTCTTTTCCAGGTCTATCGGAACCTCTTTCTTTAGATTCATAAGAAGTGGCGGACAAACAAAAAAGGGGGATGGCTTAGTAAACAAATAGAACTTCTTCAACGAACTTATCAAATTTCAAGTAAAAAAAAAAAGAAAATTTTAAGATGAGATAATAAATAAGGATTTGGATATGTGCAAAAATCCAAGATTTTCCCCTTTCAACCGGAACATTAAGAGTCTTTT TTTACTTGATGAAATTTTATTTTTATAGAATAGAGTAGAGTAAGGTTCAATTCAATTAGTATAGAAATGGTTTGCAGGATGTCTCATCTGTAGAAATCCTGTGTCATCCAAAAAATCAATTGATTCCTTCTTTCTTCTTGTTTCGGAAGGGGCCCTCATA CTATGGCGGAACAGATACTATGGCGGAACAGATACTATGAATCAATCAAGGGATTCCATTTTTCAAAAACATCATCAGAAACAAAGCATCCTTTTATCATTTCTATGAATCTAATATTATGATTATGTTGACTGGATGAATTTCCAACTTTTTTTATGTT
[0061] Analysis results as follows Figure 4 As shown. According to Figure 2 The identification rules indicate that the sample is Phoebe zhennan, distinguishing it from other Phoebe species.
[0062] Although the specific embodiments of the present invention have been described and explained in detail above, it should be noted that we can make various equivalent changes and modifications to the above embodiments based on the concept of the present invention. As long as the resulting functions do not exceed the spirit covered by the specification, they should all be within the protection scope of the present invention.
Claims
1. A specific primer for identifying five species of Phoebe wood, characterized in that: The specific primers are PB958, PCHui831, PS827 and PZ805; The sequence information of the specific primers is shown below: The five species of Phoebe wood are Phoebe zhennan. P. zhennan Fine-leaved Phoebe P. hui , Minnan P. bournei Purple Nanmu P. sheareri , Zhejiang Nan P. chekiangensis .
2. A method for identifying five species of Phoebe wood, characterized in that, The method utilizes DNA barcoding and molecular biology techniques to identify five species of Phoebe wood, using DNA barcoding formed by the complete combination of PB958+PCHui831+PS827+PZ805 as described in claim 1. Includes the following steps: (1) Pretreatment of wood samples; (2) Extract DNA from the wood sample treated in (1); (3) Using the DNA extracted in step (2) as a template, PCR amplification was performed on the sequences PB958, PCHui831, PS827 and PZ805; (4) Sequencing the PCR amplification products obtained in step (3) yielded the amplification sequences of PB958, PCHui831, PS827 and PZ805, and the sequences were analyzed. (5) The amplified sequences of PB958, PCHui831, PS827 and PZ805 obtained in step (4) were compared with the database to identify five species of Phoebe wood; The pretreatment described in step (1) involves cutting the wood into wood chips and then grinding them using a ball mill, resulting in a final sample size of 5 micrometers. The DNA described in step (2) was extracted using the DNeasy Plant Mini Kit, with a final DNA concentration of 1–100 ng / μL; The PCR amplification reaction system in step (3) consists of 19 μL ddH2O, 25 μL Mix, 2 μL single primer, and 2 μL template DNA. The PCR reaction conditions are: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 57℃ annealing for 15 s, 72℃ extension for 30 s, for 35 cycles; and 72℃ final extension for 5 min.
3. The method as described in claim 2, characterized in that: The five species of Phoebe wood are Phoebe zhennan. P. zhennan Fine-leaved Phoebe P. hui , Minnan P. bournei Purple Nanmu P. sheareri , Zhejiang Nan P. chekiangensis .