Application of novel-miR16 and target gene ZjTCP4 of jujube tree

Abstract

The application provides application of novel-miR16 and target gene ZjTCP4 of jujube trees. RT-qPCR analysis shows that the expression amount of novel-miR16 in transgenic plants with overexpression of amiRNA-miR16 is 1.3-5.25 times higher than that of a control, and overexpression of novel-miR16 can improve the drought stress resistance of transgenic tobacco. The amiRNA technology can efficiently express jujube tree novel-miR16 in tobacco, and novel-miR16 positively regulates drought resistance of jujube trees.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology of jujube trees, specifically involving the application of jujube tree novel-miR16 and target gene ZjTCP4. Background Technology

[0002] Jujube (Ziziphus jujuba Mill.) is a plant belonging to the genus Ziziphus Mill. of the family Rhamnaceae. Native to my country, it is one of China's important and distinctive fruit tree species. Jujube trees grow throughout China except for Heilongjiang Province. Jujube cultivation in my country has a long history, dating back to the Neolithic Age more than 7,000 years ago. It boasts abundant resources, with over 900 varieties currently identified, of which 210 have been officially recognized. Jujube trees are at the forefront of windbreak and sand fixation, playing a vital role in improving wasteland, soil and water conservation, and enhancing the ecological environment. However, with the continuous shifts and migrations of jujube cultivation areas, especially the westward migration of jujube trees to deserts and Gobi regions, their living environment has changed significantly due to high light and heat resources and low rainfall. Some jujube orchards in deserts and Gobi regions still rely on traditional furrow or pipe irrigation. This results in unreasonable water resource utilization patterns, low water resource efficiency, and underutilization of limited water resources, thus failing to fully realize the potential of jujube trees. Severe fruit cracking is a common problem in jujube production, causing significant economic losses. Drastic fluctuations in humidity during rainfall and irrigation can lead to cracking. If jujubes experience drought in their early growth stages, and are then subjected to heavy rain or excessive irrigation near maturity, the rapid growth of the fruit pulp exacerbates cracking. Currently, the differentiation and degeneration of major jujube varieties are severe, far from meeting the needs of farmers. Therefore, it is imperative to conduct in-depth breeding of drought-resistant jujube varieties. Due to the small size of jujube flowers, the difficulty of artificial emasculation, low fruit set rate, and severe embryo abortion, jujube hybridization breeding is extremely challenging. Therefore, biotechnology breeding is the main approach for future jujube breeding.

[0003] miRNAs are a class of non-coding small regulatory RNAs that typically regulate the expression of target genes at the post-transcriptional level. Increasing research indicates that miRNAs play a crucial regulatory role in controlling plant drought stress responses. Based on previous jujube introduction experiments in the Yellow River irrigation area of ​​Gansu, this invention selected the drought-sensitive jujube variety 'Dongzao' and the drought-resistant jujube variety 'Zanhuang Dazao' as experimental materials. Using small RNA-seq and degradome sequencing technologies, drought-related miRNAs and their regulated target genes were mined at the whole-genome level in jujube. By screening key miRNAs and constructing super-strong expression vectors, transgenic plants were obtained by transforming tobacco. The drought resistance of the transgenic plants was analyzed to elucidate the molecular mechanism by which miRNAs regulate the jujube's response to drought stress. This provides candidate resources for the targeted use of miRNAs in jujube molecular breeding and also provides a theoretical basis for drought resistance breeding in other crops. Currently, there are no reports on the application of jujube novel-miR16 and its target gene ZjTCP4. Summary of the Invention

[0004] The key technical problem this invention aims to solve is to provide the application of jujube tree novel-miR16 and its target gene ZjTCP4. To solve this problem, this invention adopts the following technical solution:

[0005] 1. The precursor sequence of jujube tree novel-miR16 is shown in SEQ No. 1 of the sequence listing; the mature sequence of jujube tree novel-miR16 is shown in SEQ No. 2 of the sequence listing; and the transcript sequence of ZjTCP4 is shown in SEQ No. 3 of the sequence listing.

[0006] 2. Identification methods for drought-related miRNAs in jujube trees, including: (1) selection of plant materials, database software, and main instruments; (2) material processing; (3) extraction and detection of total RNA; (4) construction and sequencing of small RNA libraries; (5) bioinformatics analysis of sequencing data; (6) identification of conserved miRNAs; (7) bioinformatics identification of novel miRNAs in jujube trees; (8) differential expression analysis of miRNAs in jujube trees; (9) target gene prediction and annotation; and (10) RT-qPCR verification of drought-related miRNAs.

[0007] 3. Drought-related miRNAs in jujube trees include: novel-miR113 and novel-miR250, which are downregulated under drought stress, and novel-miR3, novel-miR16, novel-miR209, novel-miR288, novel-miR340, and novel-miR345, which are upregulated under drought stress.

[0008] 4. Identification methods for drought-related miRNA target genes in jujube trees, including: (1) material processing and RNA extraction and detection, (2) software and database selection, (3) synthesis of cDNA first strand, (4) nested PCR amplification, and (5) qRT-PCR analysis of drought-related miRNA target genes.

[0009] 5. Drought-related miRNA target genes of jujube trees, including: Chaperonin60subunit beta 4 (CCG005225) of novel_miR_3, transcription factor TCP4-like (CCG006181) of novel_miR_16, serine / threonine-protein kinase (CCG006997) of novel_miR_209, Heat shock factor 4 (CCG017151) of novel_miR_209, transcription factor MYB86 (CCG020355) of novel_miR_288, and Mybdomain protein 113 (CCG022003) of novel_miR_340, were downregulated under drought stress. The target genes of novel_miR-113, namely Squamosa promoter-binding-like (CCG003796), novel_miR_209, namely Cytochrome P450 (CCG019037), novel_miR_250, namely NAC domain protein (CCG007197), novel_miR_325, namely cytochrome P450-like (CCG028127), and novel_miR_345, namely cytochrome P450 71A1-like (CCG028129), were upregulated under drought stress.

[0010] 6. Verification methods for the application of ZjTCP4 transcription factor, including: (1) plant materials, (2) vectors and reagents, (3) databases and analysis software, (4) sequence and structure analysis of jujube novel-miR16, (5) prediction of target genes of jujube novel-miR16, (6) verification of jujube novel-miR16 target gene ZjTCP4, (7) cloning of jujube TCP4 gene, (8) subcellular localization of jujube novel-miR16 target gene ZjTCP4, and (9) expression analysis of jujube novel-miR16 and target gene ZjTCP4 under drought stress.

[0011] 7. Application of ZjTCP4 transcription factor, specifically the application of ZjTCP4 localization in the nucleus of tobacco cells.

[0012] 8. Application of ZjTCP4 transcription factor, specifically its application in regulating drought stress in jujube trees.

[0013] 9. Functional identification method of jujube tree novel-miR16 response to drought stress, including: (1) construction of artificial miRNA vector of jujube tree novel-miR16, (2) genetic transformation of tobacco, (3) drought resistance analysis of transgenic tobacco, (4) double enzyme digestion verification results of cloning vector, (5) genetic transformation results of tobacco, (6) expression analysis of novel-miR16 in transgenic tobacco, (7) drought stress phenotype and growth index analysis of transgenic SR1 tobacco and WT, (8) chlorophyll content analysis of WT and transgenic SR1 tobacco, (9) osmotic regulation substance content analysis of WT and transgenic SR1 tobacco, (10) antioxidant enzyme activity analysis of WT and transgenic SR1 tobacco, (11) H2O2 and superoxide anion content analysis of WT and transgenic SR1 tobacco, (12) endogenous hormone content analysis of WT and transgenic SR1 tobacco, (13) paraffin section results analysis of WT and transgenic SR1 tobacco under drought stress.

[0014] 10. Application of jujube tree novel-miR16 in increasing the length and width of tobacco leaves, wherein the precursor sequence of jujube tree novel-miR16 is shown in sequence listing SEQ No.1; and the mature sequence of jujube tree novel-miR16 is shown in sequence listing SEQ No.2.

[0015] 11. Application of jujube tree novel-miR16 in mitigating the decrease of chlorophyll a and chlorophyll b under drought stress, wherein the precursor sequence of jujube tree novel-miR16 is shown in SEQ No. 1 of the sequence listing; and the mature sequence of jujube tree novel-miR16 is shown in SEQ No. 2 of the sequence listing.

[0016] 12. Application of jujube tree novel-miR16 in increasing proline and soluble sugar content during drought treatment, wherein the precursor sequence of jujube tree novel-miR16 is shown in SEQ No. 1 of the sequence listing; and the mature sequence of jujube tree novel-miR16 is shown in SEQ No. 2 of the sequence listing.

[0017] 13. Application of jujube tree novel-miR16 in increasing SOD, POD and CAT activities during drought treatment, wherein the precursor sequence of jujube tree novel-miR16 is shown in SEQ No. 1 of the sequence listing; and the mature sequence of jujube tree novel-miR16 is shown in SEQ No. 2 of the sequence listing.

[0018] 14. Application of jujube tree novel-miR16 in reducing H2O2 and superoxide anion content during drought treatment, wherein the precursor sequence of jujube tree novel-miR16 is shown in SEQ No. 1 of the sequence listing; and the mature sequence of jujube tree novel-miR16 is shown in SEQ No. 2 of the sequence listing.

[0019] 15. Application of jujube tree novel-miR16 in reducing the IAA / ABA ratio during drought treatment, wherein the precursor sequence of jujube tree novel-miR16 is shown in sequence listing SEQ No. 1; and the mature sequence of jujube tree novel-miR16 is shown in sequence listing SEQ No. 2.

[0020] 16. Application of jujube tree novel-miR16 in reducing water conveyance efficiency and increasing drought resistance during drought treatment, wherein the precursor sequence of jujube tree novel-miR16 is shown in SEQ No. 1 of the sequence listing; and the mature sequence of jujube tree novel-miR16 is shown in SEQ No. 2 of the sequence listing.

[0021] Beneficial effects: This invention isolates and discovers miRNAs from jujube leaves; screens and predicts target genes of differentially expressed miRNAs under drought stress and between two jujube varieties; identifies miRNAs related to drought stress in jujube trees; selects jujube novel-miR16, constructs an overexpression vector of jujube novel-miR16 using artificial miRNA technology (amiRNAs), transforms it into tobacco, and identifies drought resistance and measures drought-related indicators in transgenic and wild-type plants, studying the mechanism of novel-miR16 response to drought stress in jujube trees; providing a theoretical basis for accurately studying the role of miRNAs in drought stress.

[0022] This invention identified a novel member of the miR319 family (novel-miR16) in jujube trees and, through bioinformatics analysis and experimental verification, identified the jujube ZjTCP4 gene as a target gene of novel-miR16. Subcellular localization analysis showed that the protein encoded by the jujube ZjTCP4 gene is located in the cell nucleus. qRT-PCR analysis showed that the expression patterns of novel-miR16 and the target gene ZjTCP4 were negatively correlated during drought stress. To clarify the function of novel-miR16 in the jujube tree's response to drought stress, we used amiRNA technology to obtain transgenic tobacco plants overexpressing jujube novel-miR16. The expression level of novel-miR16 in the transgenic lines was significantly increased compared to the control. Compared with the control plants, transgenic tobacco plants overexpressing jujube novel-miR16 under drought stress showed significantly enhanced drought resistance. Leaf chlorophyll, proline, and soluble sugar contents were significantly increased; leaf SOD, POD, and CAT activities were significantly improved; relative conductivity was significantly decreased; and MDA, H2O2, and superoxide anion contents were significantly reduced. Leaf palisade and spongy tissue thicknesses were significantly altered, and the palisade-to-sea ratio was significantly increased. Root cortex thickness was significantly increased, and root stele diameter and average xylem area were significantly reduced, resulting in significantly enhanced drought resistance. This may be because overexpression of novel-miR16 leads to a decrease in the expression of target gene TCP transcription factors. These TCP transcription factors activate or inhibit the expression of a series of downstream genes, further regulating plant morphology and physiological and biochemical indicators to improve drought resistance. In summary, RT-qPCR analysis showed that the expression level of novel-miR16 in transgenic plants overexpressing amiRNA-miR16 was 1.3-5.25 times higher than that in the control, and that overexpression of novel-miR16 improved the drought resistance of transgenic tobacco. amiRNA technology can efficiently express jujube novel-miR16 in tobacco, and novel-miR16 positively regulates the drought resistance of jujube trees. Attached Figure Description

[0023] Figure 1 A novel miRNA identified in jujube trees.

[0024] Figure 2 Differential miRNAs were expressed in both drought-affected and control jujube trees.

[0025] Figure 3 To analyze the expression levels of potential drought-responsive miRNAs using RT-qPCR.

[0026] Figure 4 To validate the target genes of drought-related miRNAs in jujube trees for 5'RLM-RACE.

[0027] Figure 5The results of expression analysis of target genes of drought-related miRNAs in jujube trees.

[0028] Figure 6 It is a two-stage hairpin structure made of jujube tree novel-miR16.

[0029] Figure 7 To validate the target gene of jujube tree novel-miR16.

[0030] Figure 8 Electrophoretic detection of PCR products of the novel-miR16 target gene.

[0031] Figure 9 This is a subcellular localization map of the ZjTCP4 gene.

[0032] Figure 10 The expression levels of jujube tree novel-miR16 and its gene target ZjTCP4 under drought stress.

[0033] Figure 11 This was verified by double digestion of pMD-miR16.

[0034] Figure 12 This is a flowchart of the AmiR-miR16 to SR1 conversion process.

[0035] Figure 13 The expression of novel-miR16 in transgenic tobacco was analyzed.

[0036] Figure 14 Phenotypic diagrams of transgenic SR1 tobacco and WT under drought stress.

[0037] Figure 15 The effect of drought stress on chlorophyll content in WT and transgenic SR1 tobacco.

[0038] Figure 16 The effects of drought stress on the content of osmotic regulators in WT and transgenic SR1 tobacco.

[0039] Figure 17 The effects of drought stress on the antioxidant enzyme activity of WT and transgenic SR1 tobacco.

[0040] Figure 18 The effects of drought stress on H2O2 and superoxide anion content in WT and transgenic SR1 tobacco.

[0041] Figure 19 The effects of drought stress on the endogenous hormone content of WT and transgenic SR1 tobacco.

[0042] Figure 20 The effects of drought stress on the leaf and root anatomy of WT and transgenic SR1 tobacco.

[0043] Figure 21 The CDS sequence for jujube tree ZjTCP4 is shown, where the bold and uppercase sequences are regions paired with novel-miR16. Specific implementation methods

[0044] Unless otherwise specified, the methods and apparatus used in the following embodiments of this invention are conventional methods and apparatus; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies. To make the objectives, technical solutions, and advantages of this invention clearer, the specific implementation methods of this invention are described in detail below with reference to specific embodiments. Examples of these preferred embodiments are illustrated in the specific embodiments. It should also be noted that, in order to avoid obscuring the technical solution of this invention due to unnecessary details, only technical solutions and / or processing steps closely related to the solution according to this invention are shown in the embodiments, while other details that are not closely related are omitted.

[0045] Example 1

[0046] This embodiment provides the potato novel-miR16 precursor sequence as shown in SEQ No. 1; the jujube novel-miR16 mature sequence as shown in SEQ No. 2; and the ZjTCP4 transcript sequence as shown in SEQ No. 3.

[0047] Example 2

[0048] This embodiment provides a method for identifying drought-related miRNAs in jujube trees, including:

[0049] 1. Plant materials, database software, and main instrument selection: The drought-sensitive jujube variety 'Dongzao' and the drought-resistant jujube variety 'Zanhuang Dazao' used in this experiment were both provided by Hebei Agricultural University. miRNAbase was used for the comparison and identification of known miRNAs in jujube trees, and databases such as GenBank and Rfam(10.1) were used for coding sequence annotation. Base calling software was used to convert the raw image information obtained from sequencing into sequence data; DESeq2 was used for differential expression analysis of jujube miRNAs among different samples; overlap was used for the comparison and analysis of sequencing data with introns and exons; Bowtie was used for small RNA classification annotation; and Phred was used to evaluate the quality value of bases. The main instruments and equipment used in this experiment included an Illumina HiSeq 2500 sequencer, Nanodrop, Qubit, SiGMA 3K30 high-speed refrigerated centrifuge, Cintra 6 UV spectrophotometer, and electrophoresis apparatus.

[0050] 2. Material Treatment: Three-year-old grafted seedlings of the 'Zanhuang Jujube' and 'Winter Jujube' varieties, provided by Hebei Agricultural University, were used as experimental materials. The rootstock was the long-branched sour jujube, and both varieties were pruned to 80cm. In the autumn of 2020, the seedlings were planted in pots, which were then buried in the ground for overwintering. From March to July 2021, a drought experiment was conducted in pots at the standard greenhouse of Gansu Agricultural University, with two treatments: drought (T) and normal watering (CK). Watering was consistent before bud break. During the growing season after all buds had sprouted, a drought treatment was applied (soil moisture content 25% ± 5% of field capacity). Control plants were kept in well-drained soil (soil moisture content 65% ± 5% of field capacity). Soil moisture was monitored regularly using a soil moisture meter, and measurements were taken using a weighing method before watering. Each treatment was designed as a randomized complete block design, with three replicates per treatment. Five pots of uniformly growing jujube seedlings were selected for each replicate, with one seedling planted in each pot, for a total of 15 seedlings. The plastic pots had a diameter of 50 cm and a height of 37 cm. The cultivation substrate consisted of 45% garden soil, 40% peat moss, 10% coarse sand, and 5% well-rotted organic fertilizer. Treatment began on April 27, 2021. Leaf phenotype was observed; most leaves wilted by day 21 of treatment. On May 17, 2021, the following indicators were measured and leaves were sampled. Each replicate consisted of five seedlings, resulting in three replicates. The sampled leaves were the 3rd to 6th functional leaves counted from the base to the tip of the jujube branch. The collected leaves were stored at -80°C for subsequent indicator measurements. Leaves from drought-treated and control jujube trees were collected, rapidly frozen in liquid nitrogen, and then stored at -80°C for further sequencing.

[0051] 3. Total RNA Extraction and Detection: In this experiment, total RNA was extracted from 12 jujube leaf samples (D-CK1, D-CK2, D-CK3, D-T1, D-T2, D-T3, Z-CK1, Z-CK2, Z-CK3, Z-T1, Z-T2, and Z-T3) using Invitrogen's Trizol reagent. The specific procedures were strictly followed according to the manufacturer's instructions. The purity of the extracted total RNA was analyzed using Nanodrop, and the integrity of the total RNA was analyzed using agarose gel electrophoresis. The concentration and integrity of the extracted total RNA were accurately quantified using Qubit and Agilent 2100, respectively.

[0052] 4. Construction and Sequencing of Small RNA Libraries: This experiment used the Small RNA Sample Pre Kit to isolate small RNA molecules and construct libraries. Small RNA molecules were isolated from qualified total RNA, and adapter 1 was added to the 3' end of the small RNA molecules using RNA ligase, followed by adapter 2 to the 5' end. The ligation products were reverse transcribed to synthesize cDNA, which was then used as a template for PCR amplification. The PCR products were then separated by electrophoresis, and the target bands were recovered by gel extraction to construct a cDNA library. This cDNA library was then used as a template for sequencing in an Illumina HiSeq 2500 sequencer. Library construction and high-throughput sequencing were performed by Beijing Biomarker Biosciences Co., Ltd.

[0053] 5. Bioinformatics Analysis of Sequencing Data: Image data obtained from high-throughput sequencing was converted into raw sequence files through base identification, named Raw Reads. The raw sequences were then cleaned by removing excessively long or short sequences (nt>30 or nt<18), adapter sequences, and sequences with an unknown base N ratio greater than 10%, resulting in high-quality sequences named Clean Reads. The Clean Reads were then aligned with the Silva, GtRNAdb, Rfam, and Repbase databases using Bowtie software. Annotated Reads were then removed to obtain Unannotated Reads. Finally, the Unannotated Reads were aligned with the Ziziphus jujuba reference genome database (Ziziphus_jujuba.version2_13chr) using Bowtie software to obtain their positional information on the reference genome, which are known as Mapped Reads.

[0054] 6. Identification of conserved miRNAs: The sequenced reads mapped to the jujube genome were compared with the latest version of the miRNA database miRBase (v22). If the sequenced miRNA matched both the mature and precursor sequences of the miRNA in miRBase (v22), it was considered a known miRNA in jujube.

[0055] 7. Bioinformatics Identification of New Jujube MiRNAs: This experiment used miRDeep2 software to predict new jujube miRNAs. Sequences surrounding the alignment site were considered potential pre-miRNA sequences for miRNA secondary structure analysis. The minimum free energy of the hairpin structure, the binding site of the cleavage enzyme, and the length of the mature sequence were also considered as other criteria for evaluating miRNAs. If the sequenced jujube miRNA precursor sequence could form the characteristic hairpin structure of miRNAs, and the minimum free energy, free energy coefficient, and length of the mature sequence all met the requirements for miRNAs, it was considered a newly identified jujube miRNA.

[0056] 8. Differential Expression Analysis of Jujube Tree miRNAs: To obtain differentially expressed miRNAs, this invention used DESeq2 software to analyze the differentially expressed miRNAs between drought-treated and control samples. First, the miRNA expression in both samples was normalized to obtain the expression level per million transcripts (TPM). Then, the expression levels of miRNAs were calculated using Fold-change and p-value. This invention uses Fold-change ≥ 1.5 and p-value ≤ 0.01 to identify the significance of miRNA expression differences. Through multiple tests and analyses, the false discovery rate (FDR) was used to determine the threshold for the p-value. The results are as follows: Figure 2 As shown.

[0057] 9. Target Gene Prediction and Annotation: This invention uses TargetFinder software to predict target genes for known and novel miRNAs identified in jujube trees. The predicted target genes are then compared and annotated with the NR, Swiss-Prot, GO, COG, KEGG, KOG, and Pfam databases. Drought-related miRNAs in jujube trees are identified through target gene annotation.

[0058] 10. RT-qPCR Validation of Drought-Related miRNAs: This experiment used RT-qPCR to validate the expression levels of differentially expressed miRNAs. Total RNA was extracted from jujube leaves using TRIzol (Invitrogen, Carlsbad, CA, USA), and miRNA cDNA was synthesized using the miRcutemiRNA First-Strand cDNA Synthesis Kit (Tiangen). Real-time quantitative PCR (qRT-PCR) analysis was performed using the Super RealPreMix Plus Kit (SYBR Green, Tiangen) on a Biosystems 3000 Real-Time PCR system. The reaction program was: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 15 s, 57℃ annealing for 33 s, 72℃ extension for 35 s, and a final reaction at 72℃ for 4 min, for a total of 38 cycles. Jujube 5.8S rRNA was used as an internal reference gene. All reactions were repeated in triplicate, and the relative expression levels of miRNAs were calculated using the 2-ΔΔCt method. The standard deviation of the three biological replicates was calculated.

[0059] Example 3

[0060] This embodiment provides the drought-related miRNAs of jujube trees identified in the above embodiments, including:

[0061] 1. New miRNAs in jujube: New miRNAs in jujube were predicted using the miRDeep2 software. A total of 431 new miRNAs were identified in two jujube varieties, with lengths ranging from 18 to 24 nt. Detailed statistical results can be found in [link to data]. Figure 1 .

[0062] 2. Differential Expression Analysis of miRNAs under Drought Stress: To identify miRNAs related to drought stress in jujube trees, we performed statistical analysis on the expression levels of miRNAs in each sample and normalized the expression levels using the TPM algorithm. Then, we used DESeq2 software to calculate the expression levels of miRNAs in drought-treated and control samples. In the differential miRNA screening, we selected FDR < 0.01 and Fold change ≥ 0.58 as screening criteria. Finally, 27 differentially expressed miRNAs under drought treatment were identified in 'Winter Jujube', of which 20 were upregulated and 7 were downregulated; in 'Zanhuang Jujube', 60 differentially expressed miRNAs responded to drought treatment, of which 23 were upregulated and 37 were downregulated. Nine miRNAs were differentially expressed in both jujube varieties. Among them, mes-miR156c and mes-miR156g showed opposite expression patterns in the two varieties, being upregulated in winter jujube and downregulated in Zanhuang jujube. Seven miRNAs showed consistent expression patterns in the two varieties: novel_miR_266 and novel_miR_284 were downregulated, while novel_miR_115, novel_miR_16, novel_miR_189, novel_miR_288, and novel_miR_358 were upregulated, but the magnitude of upregulation or downregulation differed, which may determine the drought resistance of different jujube varieties.

[0063] 3. RT-qPCR Validation Results of Differentially Expressed miRNAs: To verify the reliability of differentially expressed miRNAs obtained from high-throughput sequencing, we used RT-qPCR to validate the expression patterns of nine drought-responsive miRNAs (novel-miR113, novel-miR250, novel-miR3, novel-miR16, novel-miR209, novel-miR288, novel-miR325, novel-miR340, and novel-miR345) under drought stress. As shown in Table 1, the results showed that, compared with high-throughput sequencing of small RNAs, eight of the nine miRNAs exhibited the same expression patterns. Specifically, novel-miR113 and novel-miR250 were downregulated, while novel-miR3, novel-miR16, novel-miR209, novel-miR288, novel-miR340, and novel-miR345 were upregulated. The results showed that only novel-miR325 exhibited different expression trends in both RT-qPCR and small RNA-seq results. Figure 3 As shown, this indicates that the data on differential miRNA expression obtained by high-throughput sequencing are reliable.

[0064] Table 1. Analysis of expression patterns of differentially expressed miRNAs in different jujube trees.

[0065]

[0066] Example 4

[0067] This embodiment provides a method for identifying drought-related miRNA target genes in jujube trees, including:

[0068] 1. Material processing and RNA extraction and detection: Same as in Example 2.

[0069] 2. Software and Database Selection: FastQC (https: / / github.com / s-andrews / FastQC) software is used for quality monitoring of sequencing data; CleaveLand4 (https: / / github.com / MikeAxtell / CleaveLand4) software is used for detecting degradation sites of miRNAs on target genes; GSTAr (https: / / github.com / MikeAxtell / GSTAr) software is used for alignment of universal small RNAs; Samtools (https: / / github.com / samtools / samtools) software is used for processing alignment results; bowtie (https: / / github.com / BenLangmead / bowtie) software is used for data alignment; pheatmap (https: / / cran.r-project.org / web / packages / pheatmap / index.html) software is used for generating heatmaps; blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) software is used for gene function annotation.

[0070] 3. Construction and sequencing of transcriptome libraries: Total RNA from jujube trees was used to capture mRNA using magnetic beads, and adapters were ligated to the 3' and 5' ends of the sequence, respectively. The mixture of biotinylated random primes and mRNA was reverse transcribed into cDNA. A library was constructed using this cDNA and sequenced using the Illumina GAIIx platform.

[0071] 4. Degradome Sequencing Data Analysis: The raw tag data obtained from sequencing was filtered to obtain clean tags after removing low-quality and adapter sequences. Cluster tag sequences were aligned with the jujube reference genome to determine their distribution. Non-coding RNA sequences within the cluster tags were annotated by aligning them with the Rfam database. Degradation site analysis was performed on unannotated sequences based on miRNA target gene prediction results. Simultaneously, target gene degradation fragment sequence information was identified, and degradation site information was statistically analyzed.

[0072] 5. Degradation Site Analysis: CleaveLand software was used to predict and identify target genes of jujube miRNAs, and Oligomap software was used to analyze mRNAs that matched the degradationome sequencing data to identify miRNA target genes. The specific analysis process was as follows: (1) Obtain comparable sequencing sequence data by processing the raw data; (2) Align the comparable sequencing sequences with the jujube cDNA database to obtain a degradationome density file; (3) Use GSTAr software to predict the mRNA sequences of target genes that are complementary to jujube miRNAs; (4) Align the predicted miRNA target genes with the mRNAs in the degradationome density file to obtain the common mRNA sequences, which are the target genes of the miRNAs. In addition, the peak classification and score of the degradationome were calculated, and t-plots were used to plot the generated prediction results.

[0073] 6. Functional annotation of target genes and screening of drought-related miRNA target genes: GO and KEGG functional annotations were performed on the target genes verified by degradome sequencing to screen drought-related miRNAs and their target genes in jujube trees.

[0074] 7. 5' RLM-RACE Validation of Drought-Related miRNA Target Genes

[0075] (1) Synthesis of cDNA first strand: To verify the target genes of miRNAs obtained by degradome sequencing, this experiment used a 5' RLM-RACE assay to verify the target genes of some miRNAs obtained by degradome sequencing. The 5' RLM-RACE assay used the GeneRaeer kit from Invitrogen. First, the RNA adapter sequence (GCUGAUGGCGA UGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA) was ligated to the 5' end of the RNA. Then, the RNA with the adapter ligated to the 5' end was reverse transcribed to obtain cDNA. The reaction was carried out according to the kit instructions.

[0076] (2) Nested PCR amplification: Using cDNA obtained from reverse transcription as a template, specific external and internal primers for the adapter were designed based on the degradation sites on the target gene. The first step of nested PCR was performed. The reaction system was: 94°C pre-denaturation for 3 minutes, 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 30 seconds, for a total of 36 cycles, with a final extension at 72°C for 7 minutes. (3) Ligation of the target fragment with the T vector and sequencing: The product of the second step of nested PCR was detected by electrophoresis, and the target size band was recovered by gel excision. The recovered product and The 18-T Vector was ligated. The recombinant vector was then transformed into DH5α competent cells, followed by blue-white screening. Ten positive clones for each target gene were selected for sequencing. Degradation site analysis was performed to verify the miRNA target genes obtained from the degradation sequence. Nested PCR primers for target gene splicing sites are shown in Table 2.

[0077] Table 2 Nested PCR primers for 5'RLM-RACE verification of miRNA target gene splicing sites

[0078]

[0079] (4) qRT-PCR analysis of drought-related miRNA target genes: In this experiment, the expression of drought-related miRNAs and target genes under drought stress and control was analyzed using the Super Real PreMix Plus quantitative reagent kit from Tiangen Biotech Co., Ltd. Zjef1a gene was used as an internal reference gene. The PCR conditions were: 94℃ pre-denaturation for 10 min; 94℃ for 20 s, 58℃ for 30 s, for 35 cycles. The relative expression level was calculated using the 2–ΔΔCt method. The experiment was repeated three times, and the average value was calculated. Primers are shown in Table 3.

[0080] Table 3 Primers used for quantitative PCR detection of miRNA

[0081]

[0082]

[0083] Example 5

[0084] This embodiment provides the drought-related miRNA target genes of jujube trees identified in the above embodiments, including:

[0085] 1. 5' RACE Validation of Drought-Related miRNA Target Genes in Jujube Trees: Functional annotations of target genes were obtained through degradome sequencing. A total of 13 target genes from 9 miRNAs were screened as drought-related (Table 4), including genes related to transcription factors, signal transduction pathways, antioxidant stress response pathways, detoxification, and ubiquitin pathways. Studies have shown that these genes are closely related to plant stress. To further validate the target genes of miRNAs obtained from degradome sequencing, we used 5' RLM-RACE technology to verify the cleavage sites of 10 miRNA target genes (primers for the remaining three target genes could not be designed for RACE amplification). Ultimately, only 7 target genes from 6 miRNAs were validated using 5' RLM-RACE. Figure 4 The target genes are: Chaperonin 60 subunit beta 4 (CCG005225) for novel_miR_3; transcription factor TCP4-like (CCG006181) for novel_miR_16; Squamosa promoter-binding-like (CCG003796) for novel_miR-113; Heat shock factor 4 (CCG017151) and Cytochrome P450 (CCG019037) for novel_miR_209; NAC domain protein (CCG007197) for novel_miR_250; and Myb domain protein 113 (CCG022003) for novel_miR_340. Most of these cleavage sites are located at the 10th and 11th nucleotides of the miRNA binding site. Figure 4 This is consistent with previous research findings.

[0086] Table 4. Target genes of drought-related miRNAs in jujube trees and their functional annotations.

[0087]

[0088]

[0089] 2. Drought-related miRNA target genes respond to drought stress: In order to detect whether drought-related miRNA target genes in jujube trees respond to drought stress, this invention uses RT-qPCR to detect their relative expression levels at different stages of drought stress. The results showed that the target genes of novel_miR_3 (Chaperonin 60subunit beta 4, CCG005225), novel_miR_16 (transcription factor TCP4-like, CCG006181), novel_miR_209 (serine / threonine-protein kinase, CCG006997), novel_miR_209 (Heat shock factor 4, CCG017151), novel_miR_288 (transcription factor MYB86, CCG020355), and novel_miR_340 (Myb domain protein 113, CCG022003) were downregulated under drought stress; while the target genes of novel_miR-113 (Squamosa promoter-binding-like, CCG003796) and novel_miR_209 (Cytochrome) were downregulated. The target genes of P450 (CCG019037), novel_miR_250 (CCG007197), novel_miR_325 (CCG028127), and novel_miR_345 (CCG028129) were upregulated under drought stress. Figure 5 ).

[0090] Example 6

[0091] This embodiment provides a method for verifying the application of the jujube tree novel-miR16 target gene ZjTCP4 transcription factor, including:

[0092] 1. Plant material: Aseptic seedlings of Nicotiana benthamiana were provided by Shaanxi Boruide Biotechnology Co., Ltd. The culture room temperature was 26℃, light intensity was 1500 lux, with a 12-hour light-12-hour dark cycle.

[0093] 2. Vectors and reagents: DH5α competent cells were purchased from Beijing TransGen Biotech Co., Ltd. Vector was purchased from TaKaRa, pART-CAM-EGFP was provided by Shaanxi Borui Biotechnology Co., Ltd., plant total RNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd., and DNA gel recovery kit, DL2000 Marker, DNA polymerase and various restriction endonucleases were purchased from Shanghai Bioengineering Co., Ltd.

[0094] 3. Databases and Analysis Software: The known mature sequence of plant miR319 was obtained from the miRNA database (http: / / www.mirbase.org); the target gene of jujube novel-miR16 was predicted using the online prediction software psRNATarget (http: / / plantgrn.noble.org / psRNATarget / ), and the target gene sequence of novel-miR16 was downloaded from the jujube genome database (Ziziphus_jujuba.version2_13chr); Expasy (http: / / www.expasy.org / tools) was used for basic property analysis of the protein encoded by the jujube novel-miR16 target gene ZjTCP4; the software UNAFold (http: / / www.bioinfo.rpi.edu / applications / mfold / old / rna / ) was used to predict the secondary structure of the novel-miR16 precursor sequence; and a phylogenetic tree was constructed using DNAMAN.

[0095] 4. Sequence and structural analysis of jujube novel-miR16: The mature sequence of jujube novel-miR16 obtained by high-throughput sequencing was compared with known mature plant miRNA sequences in the miRBase miRNA database to analyze its conservation. The secondary structure of the novel-miR16 precursor sequence was predicted using the online analysis software UNAFold (http: / / www.bioinfo.rpi.edu / applications / mfold / old / rna / ).

[0096] 5. Prediction of target genes of jujube tree novel-miR16: The mature sequence of jujube tree novel-miR16 was obtained by high-throughput sequencing; the target genes of jujube tree novel-miR16 were predicted by the online plant miRNA target gene prediction software psRNATarget, and their functions were identified by functional annotation of the target genes.

[0097] 6. Validation of the jujube novel-miR16 target gene ZjTCP4: To validate the predicted target gene of jujube miR-miR16, we used RNA ligase-mediated RLM-5 RACE (Invitrogen's GeneRaeer kit) to verify the degradation sites of the predicted target gene of jujube miR-miR16. Jujube leaves were collected and total RNA was extracted. RNA adapters were ligated and reverse transcribed to obtain cDNA. Overlap PCR amplification was performed using the GeneRaeer kit's 5-adaptor primers and the target gene ZjTCP4-specific primers (Outer primer: CAAGCCTCTTGCTTCTGATCC and Inner primer: CTGTGAATTTGTACAATTGCTTTCTTAGCAACCTGTGAATTTGTACAATTGCTTTCTTAG CAAC) to obtain the 5' end sequence of the target gene ZjTCP4. The PCR amplified fragment was purified by gel electrophoresis, cloned into pMD19-T, and sequenced. The degradation sites of the target gene were analyzed to validate the predicted jujube novel-miR16 target gene.

[0098] 7. Cloning of the jujube TCP4 gene: The ZjTCP4 (CCG006181) gene sequence was downloaded from the jujube genome database (Ziziphus_jujuba.version2_13chr). PCR cloning primers for the jujube ZjTCP4 gene were designed using DNAMAN software (F: CGGGATCCTAACATGGACGCCATCAATCTC, R: CGAGCTCCAATCTCACAAACCACTCTCTTCTTC) and sent to a bioengineering company. Using the total RNA extracted from jujube leaves as a template, cDNA was synthesized using the AMV cDNA synthesis kit. PCR amplification was performed using ZjTCP4 gene-specific primers. The reaction system is as follows. The PCR product was then mixed with… The vector was ligated, and the ligation product was transformed into E. coli DH5α competent cells using a heat shock method for sequencing. The procedure was performed according to the kit instructions.

[0099] 8. Subcellular localization of the target gene ZjTCP4 of jujube tree novel-miR16: The target gene ZjTCP4 was ligated with the subcellular localization vector pART-CAM-EGFP to construct an expression vector. Tobacco Benzovia plants were placed under a white fluorescent lamp for a period of time to open the stomata of the leaves. The bacterial solution containing the subcellular localization vector was then injected into the epidermis of the tobacco plant leaves using a syringe until the liquid spread. Other parts of the plant were then infected. After infection, the infected areas were marked with a marker. The leaves were then sprayed with water, covered with a plastic bag, and incubated overnight in the dark. After 48 hours of incubation, the plastic bag was opened, and after 72 hours of incubation, the marked areas were excised, and the tobacco leaf epidermis was peeled off for observation and photography under a fluorescence microscope.

[0100] 9. Expression analysis of jujube novel-miR16 and its target gene ZjTCP4 under drought stress: The expression of miR-miR16 in transgenic and control jujube lines was detected by qRT-PCR. Total RNA was extracted from drought-stressed jujube trees at 5, 10, 15, 20, 25 and control lines, and cDNA was obtained by reverse transcription using the One Step PrimeScript 1 miRNA cDNA synthesis kit (TaKaRa). The expression of miR-miR16 at different stages of drought stress was detected, with ef1a gene as the internal reference gene. PCR conditions were: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 20 s; 58℃ annealing for 30 s, for 35 cycles. Finally, the relative expression level of ZjTCP4 gene among different samples was calculated using the 2–ΔΔCt formula.

[0101] Example 7

[0102] This embodiment provides the application of the jujube tree novel-miR16 target gene ZjTCP4 transcription factor, including:

[0103] 1. Secondary structure of jujube novel-miR16: UNAFold prediction of the secondary structure of the novel-miR16 precursor sequence shows that its secondary structure has a typical miRNA hairpin structure. Figure 6 The 20bp mature novel-miR16 sequence (UUGGACUGAAGGGAGCUCCC) is located at the 5-end of the secondary structure.

[0104] 2. Prediction of the jujube tree novel-miR16 target gene: The jujube tree novel-miR16 target gene was predicted using psRNATarget software. Sequence alignment and domain analysis of the predicted target gene showed that the jujube tree novel-miR16 target gene is highly homologous to TCP transcription factors and possesses the characteristic domains of TCP transcription factors, belonging to the TCP transcription factor family. The target gene was named ZjTCP4 (CCG006181).

[0105] 3. Validation of the jujube tree novel-miR16 target gene ZjTCP4: To further validate the predicted target gene ZjTCP4 of novel-miR16, we used RLM-5'RACE technology to verify the cleavage site of novel-miR16 on the target gene ZjTCP4. Most of the degradation sites of the target gene ZjTCP4 are located at the 10th and 11th nucleotides of the novel-miR16 binding site. Figure 7 and Figure 21 The results indicate that ZjTCP4 is a target gene of jujube tree novel-miR16.

[0106] 4. Cloning of the ZjTCP4 gene in jujube trees: Using ZjTCP4-F and ZjTCP4-R as primers, the ZjTCP4 gene was amplified in jujube trees, obtaining a target band of 1386 bp. Figure 8 Preliminary determination indicates that the target gene ZjTCP4(CCG006181) was successfully amplified. The PCR product was ligated with the cloning vector and sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequencing results showed that the amplified sequence differed from the ZjTCP4(CCG006181) sequence by only 3 bases, indicating that the gene was successfully amplified.

[0107] 5. Subcellular localization verification of jujube novel-miR16 and its target gene ZjTCP4: The constructed pCAM-GFP-ZjTCP4 vector and the empty pCAM-GFP vector (negative control) were injected into tobacco leaves. After culturing in the dark for 48 hours, the samples were observed and photographed at 488 nm using a laser confocal microscope. The results showed that the empty vector pCAM-GFP was localized in the cytoplasm, nucleus, and cell membrane, while the pCAM-GFP-ZjTCP4 fusion protein was mainly localized in the nucleus. Figure 9 ).

[0108] 6. Response of Jujube Tree Novel-miR16 and Target Gene ZjTCP4 to Drought Stress: To investigate whether jujube tree novel-miR16 and its target gene ZjTCP4 (CCG006181) respond to drought stress, this invention used qRT-PCR to analyze the expression patterns of jujube tree novel-miR16 and its target gene ZjTCP4 (CCG006181) at different stages of drought stress. The results showed that jujube tree novel-miR16 and its target gene ZjTCP4 (CCG006181) exhibited opposite expression patterns in response to drought stress. Jujube tree novel-miR16 was upregulated during drought stress, while its target gene ZjTCP4 (CCG006181) was downregulated under drought stress. Figure 10 ).

[0109] Example 8

[0110] This embodiment provides a method for functional identification of the jujube tree novel-miR16 response to drought stress, including:

[0111] 1. Construction of the jujube tree novel-miR16 artificial miRNA vector

[0112] (1) Design of artificial miRNA primers: Based on the mature sequence of jujube novel-miR16, primers for the jujube novel-miR16 artificial miRNA vector were constructed using the online website WMD3. amiR16-I: gaTAGACCCTTTATAGGCTTCGCtctctcttttgtattcc. amiR16-II: gaGCGAAGCCTATAAAGGGTCTAtcaaagagaatcaatga. amiR16-III: gaGCAAAGCCTATAA TGGGTCTTtcacaggtcgtgatatg. amiR16-IV: gaAAGACCCATTATAGGCTTTGCtctacatatatattcct.

[0113] (2) Construction of the cloning vector: Using overlap PCR technology, with pRS300 vector as template, nested PCR was performed in the first round of amplification using primers A and amiR16-IV, primers amiR16-II and amiR16-III, and primers amiR16-I and B, respectively, to obtain precursor fragments a, b, and c. Then, using a mixture of fragments a, b, and c in equal proportions as template, a second round of nested PCR was performed using universal primers A and B to obtain fragment d. Finally, fragment d was ligated to the cloning vector pMT19-T, and then double-digested and sequenced for verification to obtain the cloning vector pT-amiR16.

[0114] (3) Construction of artificial miRNA expression vector: The expression vector pCAMBIA3301 and the constructed cloning vector pT-amiR16 were double-digested with restriction endonucleases BamHI and SacI, respectively. After electrophoresis, the large fragment of pCAMBIA3301 and the 512bp small fragment of pT-amiR16 vector were recovered by gel extraction and ligated to construct the jujube tree novel-miR16 artificial miRNA expression vector pCAMBIA3301-amiR16.

[0115] 2. Genetic transformation of tobacco

[0116] (1) Obtaining sterile tobacco seedlings: Rinse SR1 tobacco seeds with running water for half an hour, then surface disinfect with alcohol (75%) for 90 seconds, continue disinfection with 2% sodium hypochlorite solution for 15 minutes, and finally rinse with sterile water 3 times before inoculating on 1 / 2 MS medium (pH 5.8).

[0117] (2) Agrobacterium expansion culture: Agrobacterium stored at -80℃ was streaked on LB solid medium containing 50 mg / L gentamicin and 50 mg / L kanamycin. Single colonies were picked and inoculated into fresh LB medium containing 50 mg / L gentamicin and 50 mg / L kanamycin. The culture was continued at 220 rpm and 28℃ until the OD600 was about 0.5. The cells were collected by low-speed centrifugation and resuspended in fresh MS medium for transformation.

[0118] (3) Agrobacterium-mediated genetic transformation of tobacco leaves: Take leaves of SR1 tobacco sterile seedlings cultured for 45 days, cut them into small pieces of about 0.5cm×0.5cm, place them in a resuspended Agrobacterium solution for about 5 minutes, then use sterilized filter paper to dry the bacterial solution on the surface of the leaf pieces, and then place them on a co-culture medium for dark culture for 2-3 days. Finally, transfer the explants to the differentiation medium until they differentiate into shoots.

[0119] (4) Identification of transgenic plants: When the resistant buds grow to 2 cm, the resistant buds are cut off and placed in the rooting medium to continue to grow into complete small plants. Genomic DNA of candidate transgenic plants is extracted from some leaves. Detection primers (AmiR-miR16-F:TGAATGAAT GATGCGGTAGACA, AmiR-miR16-R:AACTCAGTAGGATTCTGGTGTG) are designed according to the pCAMBIA3301-amiR16 sequence for PCR detection. Positive lines are those that can amplify the target size band.

[0120] (5) Expression analysis of jujube novel-miR16 in transgenic tobacco: The expression of jujube novel-miR16 in transgenic and control lines was detected by qRT-PCR. Total RNA was extracted from transgenic and control lines, and cDNA was obtained by reverse transcription using the One Step PrimeScript 1 miRNA cDNA synthesis kit (TaKaRa). The jujube 5.8S RNA gene was used as an internal control. The PCR program was: 94℃ pre-denaturation for 10 minutes; 94℃ denaturation for 20 seconds; 57℃ annealing for 30 seconds, for 35 cycles. The relative expression level of jujube novel-miR16 among different tobacco samples was calculated using 2–ΔΔCt.

[0121] 3. Analysis of drought resistance in genetically modified tobacco

[0122] (1) Drought stress treatment of transformed plants: Transgenic SR1 and WT tissue culture seedlings grown in rooting medium for 18 days were transplanted into nutrient pots and placed in a greenhouse for hardening off, using a 50% substrate + 50% vermiculite mixture. After 12 days of hardening off, the transgenic SR1 and WT seedlings were transplanted into plastic flower pots with a diameter of 25 cm and a height of 17 cm. The cultivation substrate ratio was 30% peat moss + 35% substrate + 35% vermiculite; a small amount of imidacloprid was added to the substrate before potting. 20 days after transplanting, the following treatments were applied: WT seedlings were placed in 3 pots for drought treatment (soil moisture content controlled at 30% ± 5%); AmiR-miR16 transgenic SR1 T0 generation tobacco lines 5, 8, and 13, selected based on expression level analysis, were also subjected to drought treatment (soil moisture content at 30% ± 5% of field capacity). Phenotypic observation was conducted, and growth indicators of tobacco were measured on day 18 of treatment. Leaf samples were collected on days 0 and 18 of treatment and stored in an ultra-low temperature freezer at -80°C for subsequent measurement of physiological indicators of tobacco.

[0123] (2) Determination of tobacco growth indicators: Use a ruler to measure the height of tobacco plants, the distance between internodes, the length of leaves and the width of leaves; use a vernier caliper to measure the thickness of the stem 2 cm from the base of the tobacco plant.

[0124] (3) Determination of physiological indicators in transgenic SR1 tobacco: Malondialdehyde (MDA), superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), hydrogen peroxide (H2O2), and superoxide anion (ORF) were determined according to the instructions of their respective kits. The methods for determining relative conductivity, proline, and soluble sugar content were the same as in Chapter 2. The chlorophyll a and chlorophyll b contents of tobacco leaves were determined using a 1:1 ethanol-acetone mixture extraction colorimetric method. The contents of endogenous hormones such as ZR, ABA, GA3, and IAA were determined using an ACCHROM S3000 high-performance liquid chromatograph.

[0125] (4) Observation of tissue structure in transgenic SR1 tobacco: On day 18 of drought treatment, leaf sections 0.5 cm long and 1 cm wide were cut along both sides of the veins and rinsed in ultrapure water. Root segments 0.5 cm long from the middle section of the lateral roots were also cut and rinsed in ultrapure water. All sections were then immediately placed in FAA fixative. Paraffin sections were stained with safranin-fast green and observed and photographed using an OLYMPUS BH-2 microscope.

[0126] 4. Verification results of double enzyme digestion of the cloning vector: The plasmid pMD-miR16, which was correctly sequenced, was double-digested with restriction endonucleases BamHI and SacI. Agarose gel electrophoresis detected the target band at the expected size of 512 bp. Figure 11 This indicates that the artificial miRNA cloning vector pMD-miR16 of jujube tree novel-miR16 has been successfully constructed.

[0127] 5. Genetic transformation results in tobacco: The recombinant vector pCAMBIA3301-amiR16 was transformed into Agrobacterium LBA4404, and the tobacco variety SR1 was transformed using the leaf immersion method. Through co-culture, callus induction, bud differentiation induction, and rooting culture, 21 candidate transgenic lines were finally obtained. Figure 12 ).

[0128] 6. Expression analysis of novel-miR16 in transgenic tobacco: qRT-PCR was used to detect the expression level of novel-miR16 in transgenic tobacco plants. The results showed that the expression level of novel-miR16 in 18 out of 19 transgenic tobacco plants was significantly higher than that in the control plants. However, the increase in novel-miR16 expression varied among different transgenic lines. The most significant increase was observed in transgenic lines T5, T8, and T13, which were 5.25, 5.02, and 4.87 times higher than the control, respectively. Figure 13 Therefore, three transgenic lines, T5, T8, and T13, were selected for subsequent physiological and biochemical index determination and resistance identification.

[0129] 7. Analysis of drought stress phenotypes and growth indicators of transgenic SR1 tobacco and WT: Through observation and analysis of novel-amiR16 overexpressing transgenic tobacco and control plants under drought stress, the results showed that the transgenic tobacco overexpressing novel-amiR16 had significantly increased drought resistance compared with the control. (See details...) Figure 14This photo was taken on day 18 of the drought treatment. As shown in Table 5, under drought treatment, compared with WT, amiR-miR16 significantly increased the average leaf length and width of tobacco leaves, with amiR-miR16 increasing the average leaf length and width by 19.96% and 23.99%, respectively; however, under drought stress, there were no significant differences in plant height, ground diameter, and average internode distance between WT and amiR-miR16.

[0130] 8. Chlorophyll content analysis of WT and transgenic SR1 tobacco: such as Figure 15 As shown: Before drought, there was no significant difference in chlorophyll a and chlorophyll b content between WT and transgenic tobacco; after drought stress, the chlorophyll a content in WT and transgenic tobacco increased significantly. Figure 15 (Left image) and chlorophyll b ( Figure 15 The content (right figure) was significantly reduced, but the degree of reduction in genetically modified tobacco was less than that in WT.

[0131] Table 5 Comparison of growth indicators between transgenic SR1 tobacco and WT tobacco under drought stress

[0132]

[0133] 9. Analysis of osmotic regulator content in WT and transgenic SR1 tobacco: such as Figure 16 As shown: Before drought, there were no significant differences in relative conductivity, malondialdehyde (MDA), proline, and soluble sugar content between WT and transgenic tobacco; after drought stress, the relative conductivity, MDA, proline, and soluble sugar content in both WT and transgenic tobacco increased significantly. The relative electrical conductivity of leaves in WT and amiR-miR16 increased by 229.23% and 175.02%, respectively; the MDA content of leaves in WT and amiR-miR16 increased by 64.29% and 41.83%, respectively, after drought treatment; the proline content of leaves in WT and amiR-miR16 increased by 105.48% and 169.35%, respectively, after drought treatment; the soluble sugar content of leaves in WT and amiR-miR16 increased by 33.57% and 103.45%, respectively, after drought stress; that is, the relative electrical conductivity and MDA content of leaves in amiR-miR16 were significantly lower than those in WT after drought stress; and the proline and soluble sugar content of amiR-miR16 were significantly higher than those in WT after drought stress.

[0134] 10. Analysis of antioxidant enzyme activity in WT and transgenic SR1 tobacco: such as Figure 17As shown: Before drought, there were no significant differences in the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) between WT and transgenic tobacco. Drought stress significantly increased the activities of SOD and CAT in both WT and transgenic tobacco, but significantly decreased the activity of POD. After drought treatment, the leaf SOD activities of WT and amiR-miR16 increased by 51.08% and 65.11%, respectively; the leaf CAT activities of WT and amiR-miR16 increased by 30.23% and 62.40%, respectively; and the leaf POD activities of WT and amiR-miR16 decreased by 46.14% and 24.94%, respectively. In other words, after drought stress, the leaf SOD, POD, and CAT activities of amiR-miR16 were significantly higher than those of WT.

[0135] 11. Analysis of H2O2 and superoxide anion content in WT and transgenic SR1 tobacco: (e.g.) Figure 18 As shown: Before drought, there was no significant difference in H2O2 and superoxide anion content between WT and transgenic tobacco; drought stress significantly increased the H2O2 and superoxide anion content of tobacco; after drought treatment, the leaf H2O2 content of WT and amiR-miR16 increased by 77.83% and 67.23%, respectively; after drought treatment, the superoxide anion content of WT and amiR-miR16 increased by 75.56% and 58.72%, respectively; that is, after drought stress, the H2O2 and superoxide anion content of amiR-miR16 was significantly lower than that of WT.

[0136] 12. Analysis of endogenous hormone content in WT and transgenic SR1 tobacco: such as Figure 19 As shown: Before drought, there were no significant differences in abscisic acid (ABA) and indoleacetic acid (IAA) content between WT and transgenic tobacco; however, the zeatin (ZR) and gibberellin (GA3) content of amiR-miR16 was significantly higher than that of WT. Drought stress significantly increased the ZR and ABA content of tobacco, but significantly decreased the GA3 and IAA content. Under drought stress, the ZR, ABA, and GA3 content of amiR-miR16 was significantly higher than that of WT; the IAA content of amiR-miR16 was significantly lower than that of WT. After drought treatment, the IAA / ABA ratio of WT and amiR-miR16 decreased by 78.24% and 89.41%, respectively, meaning that the decrease in the IAA / ABA ratio of amiR-miR16 after drought stress was greater than that of WT.

[0137] 13. Analysis of paraffin section results of WT and transgenic SR1 tobacco under drought stress: (e.g.) Figure 20As shown: the palisade tissue of amiR-miR16 leaves is thicker than that of WT leaves, and the cells within the palisade tissue are arranged more neatly and densely, indicating that amiR-miR16 can more effectively slow down water loss and has a higher water retention capacity. The diameter of the lateral roots of amiR-miR16 is larger than that of WT leaves, indicating that the water absorption capacity of the lateral roots of amiR-miR16 is enhanced. The cortical thickness of the lateral roots of amiR-miR16 is greater than that of WT leaves, which may be due to amiR-miR16 increasing the resistance to lateral water transport in tobacco lateral roots, thus conserving water more efficiently; the number of large vessels in the lateral roots of amiR-miR16 is less than that of WT leaves, and the average vessel area of ​​amiR-miR16 is smaller than that of WT leaves, indicating that the water transport efficiency of tobacco roots under drought stress is lower in amiR-miR16, making it more drought-resistant.

[0138] The above description is only a specific embodiment of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of this application, and these improvements and modifications should also be considered within the scope of protection of this application.

[0139]

Claims

1. The application of overexpression of jujube tree novel-miR16 to increase the length and width of tobacco leaves, characterized by... The precursor sequence of jujube tree novel-miR16 is shown in SEQ No. 1 of the sequence listing; the mature sequence of jujube tree novel-miR16 is shown in SEQ No. 2 of the sequence listing.

2. The application of overexpression of jujube tree novel-miR16 to improve drought resistance in tobacco, characterized by... The drought resistance is manifested in slowing down the decrease of chlorophyll a and chlorophyll b, increasing the content of proline and soluble sugars, increasing the activity of SOD, POD and CAT, decreasing the content of H2O2 and superoxide anion, and decreasing the IAA / ABA ratio under drought stress; the jujube tree novel-miR16 precursor sequence is shown in SEQ No. 1 of the sequence listing; the jujube tree novel-miR16 mature sequence is shown in SEQ No. 2 of the sequence listing.

Images