A diagnostic biomarker for endometrial cancer and its application

Abstract

The application discloses an endometrial carcinoma diagnosis marker and application thereof, and belongs to the field of molecular biology. The application discloses, for the first time, application of G3BP1 protein as a brand-new endometrial carcinoma diagnosis marker. The protein is composed of 466 amino acids, and the protein size is about 68kDa. The application relates to application of the protein G3BP1 in preparation of an endometrial carcinoma diagnosis kit and related drugs. The expression of the G3BP1 protein in endometrial carcinoma patient samples and normal samples is compared through immunohistochemical technology, so as to assist in diagnosis of endometrial carcinoma. The application has the characteristics of high sensitivity, strong specificity, short cycle and the like, is beneficial to early diagnosis and treatment of endometrial carcinoma, and the G3BP1 has the potential to become a new biomarker and an effective treatment target in endometrial carcinoma.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a diagnostic biomarker for endometrial cancer and its application, and more specifically to a G3BP1 protein and its application in the preparation of endometrial cancer kits and drugs for treating endometrial cancer. Background Technology

[0002] Endometrial cancer is one of the most common gynecological malignancies, ranking sixth most common malignant disease globally. Statistics show that the incidence of endometrial cancer is higher in developed countries than in developing countries; however, due to differences in healthcare levels, the mortality rate of endometrial cancer in developing countries is significantly higher than in developed countries. In recent years, the incidence of endometrial cancer has been on the rise in many developing countries. According to the latest global cancer burden data released by the International Agency for Research on Cancer (IARC) of the World Health Organization in 2020, there were 6,575,324 new cancer cases among women in my country, of which endometrial cancer accounted for 7%, ranking fourth.

[0003] Currently, surgical resection is the preferred treatment for endometrial cancer, followed by radiotherapy and chemotherapy based on the pathological stage and histological grade of the surgery. In addition, endocrine therapy can be considered for patients who are estrogen receptor and progesterone receptor positive. Studies have shown that the anti-estrogen drug tamoxifen (TAM) is significantly effective in treating estrogen receptor-positive breast cancer patients, but its effect on endometrial cancer is minimal, and it may even increase the incidence of endometrial cancer. While these treatments are effective in improving the survival rate of endometrial cancer patients, traditional surgical treatment and adjuvant radiotherapy and chemotherapy do not improve the survival rate of patients with stage III and IV endometrial adenocarcinoma, and may even lead to poor prognosis. As research into the pathogenesis of endometrial cancer deepens, more and more molecular markers have been found to be related to the diagnosis, treatment, and prognosis of endometrial cancer. Researching the molecular mechanisms and biomarkers related to endometrial cancer is of great significance for early diagnosis, early treatment, prognostic assessment, and treatment of endometrial cancer. Summary of the Invention

[0004] The first problem to be solved by the present invention is to provide a new biomarker for the detection of endometrial cancer, wherein the biomarker is G3BP1 protein.

[0005] Furthermore, the G3BP1 protein consists of 466 amino acids, and its amino acid sequence is shown in SEQ ID No. 1.

[0006] Ras-GTPase-activating protein-binding protein 1 (G3BP1) is a 466-amino acid protein whose primary function is to promote the assembly of stress granules (SGs) in the cytoplasm of eukaryotic cells to cope with certain environmental stresses. In cancer, G3BP1 mainly functions as an oncoprotein, exerting its tumor-promoting function. We primarily used immunohistochemistry to investigate the expression level of G3BP1 in endometrial cancer, exploring its potential as a biomarker for endometrial cancer. We also used clonogenic and Transwell migration assays to determine the impact of G3BP1 on the proliferation and migration of endometrial cancer cells. This research will contribute to the early diagnosis of endometrial cancer, the development of targeted anti-tumor drugs, and prognostic assessment, ultimately leading to precision medicine and personalized treatment. Currently, there are no published studies, either domestically or internationally, on the use of G3BP1 as a diagnostic biomarker in endometrial cancer.

[0007] A second aspect of the present invention provides the use of a reagent for detecting endometrial cancer biomarkers in the preparation of kits and / or reagents for detecting, diagnosing, classifying or predicting the outcome of endometrial cancer or related conditions, wherein the biomarker is G3BP1 protein.

[0008] Furthermore, the kit and / or reagents are used in the following methods:

[0009] (1) Bioinformatics and immunohistochemistry were used to analyze the expression of G3BP1 protein in endometrial cancer specimens and adjacent tissues;

[0010] (2) Prepare Negative Control, siG3BP1, and FLAG-G3BP1 plasmids, and introduce the three plasmids into endometrial cancer cells respectively;

[0011] (3) Cells successfully transfected in (2) were selected by qRT-PCR experiment and Western Blot screening technique;

[0012] (4) Verify the effect of G3BP1 expression level on endometrial cancer through clonogenic assay;

[0013] (5) The effect of G3BP1 expression level on the migration of endometrial cancer cells was verified by transwell migration assay.

[0014] (6) The effect of G3BP1 expression level on the growth of endometrial cancer cells was verified by CCK-8 assay.

[0015] Furthermore, the siG3BP1 is designed with four oligonucleotide sequences, as shown in SEQ ID No. 2 to SEQ ID No. 5, respectively:

[0016] si-G3BP1-1:5'-GAAAGAACUCUUCUUAUGU-3';

[0017] si-G3BP1-2:5'-CAAGAUUCGCCAUGUUGAU-3';

[0018] si-G3BP1-3: 5'-GUAAUGACAUGGAAGAACA-3';

[0019] si-G3BP1-4: 5'-CAAAUCAGAGCUUAAAGAU-3'.

[0020] Furthermore, the vector for the siG3BP1 plasmid is the pCMV-myc vector;

[0021] The vector for the FLAG-G3BP1 plasmid is the pCMV-FLAG vector.

[0022] The sequence inserted into the siG3BP1 plasmid is shown in SEQ ID No. 6.

[0023] The sequence inserted into the FLAG-G3BP1 plasmid is shown in SEQ ID No. 6.

[0024] Furthermore, in qRT-PCR, a total of two pairs of primers were used. One pair was a G3BP1 detection primer, the sequence of which is shown in SEQ ID No. 7 to SEQ ID No. 8. The other pair was a GAPDH internal control primer, the sequence of which is shown in SEQ ID No. 9 to SEQ ID No. 10. Specifically:

[0025] G3BP1-RTF:AAGAGTGCGAGAACAACGAA;

[0026] G3BP1-RTR: TGGTGACTGTCAGGGTGTCT;

[0027] GAPDH-RTF:CATGGCCTTCCGTGTTCCTA;

[0028] GAPDH-RTR:CCCTCAGATGCCTGCTTCA.

[0029] Furthermore, in the qRT-PCR, the PCR reaction procedure is as follows:

[0030] Pre-denaturation: Cycle count: 1; 95°C: 30 sec;

[0031] Cyclic reaction: Number of cycles: 40; 95℃: 3-10 sec; 60℃: 10-30 sec;

[0032] Melting curves: Cycle count: 1: 95℃: 15sec; 60℃: 60sec; 95℃: 15sec.

[0033] The third aspect of this invention provides the application of G3BP1 protein in the preparation of a drug for treating endometrial cancer, wherein the application is the application of G3BP1 protein in the preparation of a molecularly targeted drug for treating endometrial cancer.

[0034] Preferably, the application includes the use of G3BP1 gene fragments, gene splice expression products, and gene-encoded protein antibodies in the preparation of molecularly targeted drugs for the treatment of endometrial cancer.

[0035] The beneficial effects of this invention are as follows: This invention discloses for the first time the application of G3BP1 protein as a novel diagnostic biomarker for endometrial cancer. This protein consists of 466 amino acids and has a size of approximately 68 kDa. Its key feature is the application of G3BP1 protein in the preparation of endometrial cancer diagnostic kits. Analysis is primarily performed using immunohistochemistry, comparing the expression of G3BP1 protein in endometrial cancer patient samples and normal samples to aid in the diagnosis of endometrial cancer. This method features high sensitivity, strong specificity, and a short treatment cycle, which is beneficial for the early diagnosis and treatment of endometrial cancer. Furthermore, G3BP1 has the potential to become a novel biomarker and effective therapeutic target in endometrial cancer. Attached Figure Description

[0036] Figure 1 Three representative images of G3BP1 immunohistochemical staining in 120 pairs of human endometrial cancer tissues;

[0037] Figure 2 Stacked bar chart showing the immunohistochemical staining results of 120 pairs of human endometrial cancer tissues and paired adjacent normal tissues;

[0038] Figure 3 Figure showing the experimental results of colony-forming ability tests for AN3CA and HEC-1-A in a colony-forming assay.

[0039] Figure 4 A graph showing the quantitative experimental results of the clone formation experiment;

[0040] Figure 5 Figure 1 shows the experimental results of the CCK8 assay to detect the effect of G3BP1 expression level on the growth of AN3CA cells.

[0041] Figure 6 Figure showing the experimental results of CCK8 assay to detect the effect of G3BP1 expression level on the growth of HEC-1-A cells;

[0042] Figure 7 Figure showing the migration results of AN3CA and HEC-1-A cells after G3BP1 overexpression or knockout.

[0043] Figure 8 A graph quantifying the results of cell migration experiments;

[0044] Figure 9 Figure showing the experimental results of screening G3BP1 knockout AN3CA using qRT-PCR and Western blotting techniques.

[0045] Figure 10 Figure showing the results of screening G3BP1 knockout HEC-1-A using qRT-PCR and Western blotting techniques. Detailed Implementation

[0046] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation methods and typical parameters of the present invention, and are not intended to limit the parameter range described in the present invention. Reasonable variations derived therefrom are still within the protection scope of the claims of the present invention.

[0047] It should be noted that the endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0048] As described in the background section, research on molecular mechanisms and biomarkers related to endometrial cancer is of great significance for the early diagnosis, early treatment, prognostic assessment, and treatment of endometrial cancer.

[0049] The present invention provides for the first time a diagnostic biomarker for endometrial cancer, namely the G3BP1 protein, which consists of 466 amino acids and has a protein size of approximately 68 kDa. Its NCBI accession number is NP_005745.1, and its amino acid sequence is shown in SEQ ID No. 1.

[0050] The following specific examples illustrate the application of G3BP1 protein in the preparation of endometrial cancer detection kits and drugs for treating endometrial cancer.

[0051] Example 1

[0052] Immunohistochemistry

[0053] Tissue samples were collected, and the 120 pairs of human endometrial cancer tissue samples included in the study were derived from endometrial cancer diagnosed by the Ningbo Clinical Pathology Diagnostic Center and the People's Hospital Affiliated to Ningbo University between January 1, 2019 and December 31, 2022. Among them, 70 pairs of human endometrial cancer tissue samples came from the Ningbo Clinical Pathology Diagnostic Center, and 50 pairs of human endometrial cancer tissue samples came from the People's Hospital Affiliated to Ningbo University.

[0054] (1) Immunohistochemical staining

[0055] a. Baking: Place the slides with tissue attached on a preheated slide baking machine at 65°C for at least 2 hours, or place them in a 37°C oven overnight.

[0056] b. Dewaxing and rehydration: The slide holders fully loaded with slides were sequentially immersed in xylene for 20 min; immersed in anhydrous ethanol solution for 5 min twice; immersed in 95% ethanol solution for 5 min once; immersed in 75% ethanol solution for 5 min once; and finally, the slide holders were washed in deionized water for 5 min.

[0057] c. Antigen Retrieval: Dilute 50× pH 9.0 EDTA antigen retrieval solution with deionized water to 1× and shake well. Pour the 1× EDTA antigen retrieval solution into a pressure cooker, close the lid, and wait for the liquid in the cooker to boil. Place the slide holder containing the sections into the pressure cooker, ensuring the sections are completely submerged in the sodium citrate antigen retrieval solution. Tighten the lid and start timing once the pressure cooker valve begins to release steam evenly. After 9 minutes, turn off the induction cooker power to stop heating. Place the pressure cooker under running tap water to cool it down, and open the lid to allow the paraffin sections to cool to room temperature.

[0058] d. Washing: First, wash the slides thoroughly with deionized water for 5 minutes, then wash the slides with PBST buffer for 3 minutes. Repeat the washing process 3 times.

[0059] e. Blocking endogenous peroxidase: Dilute 30% hydrogen peroxide aqueous solution with deionized water to a concentration of 3%, prepare fresh each time, place paraffin sections in a humidified chamber, add an appropriate amount of 3% hydrogen peroxide aqueous solution to the tissue location on the slide, close the lid of the humidified chamber, and block at 37°C for 10-20 minutes.

[0060] f. Washing: Wash the slides with PBST buffer for 3 min × 3 times, and shake off the liquid on the slides.

[0061] g. Serum blocking: After washing, place the slides in a humidified chamber, add an appropriate amount of 10% donkey serum blocking solution to each slide, block at room temperature for 15 minutes, and then remove the blocking solution from the slides.

[0062] h. Primary antibody incubation: Wipe away the blocking solution around the tissue, draw a circle around the tissue with a special hydrophobic pen for immunohistochemical staining, place the slide in a humidified chamber, add an appropriate concentration of G3BP1 antibody diluent to submerge the tissue, close the lid of the humidified chamber, and place it in a refrigerator at 4°C overnight.

[0063] i. Washing: Wash the slides with PBST buffer for 3 min × 3 times.

[0064] j. Secondary antibody incubation: Wipe the liquid around the tissue dry, add an appropriate concentration of HRP-labeled donkey secondary antibody to the tissue to completely cover the tissue, close the humidifier lid, and incubate at 37°C for 1 hour.

[0065] k. Washing: Wash the sections with PBST buffer for 3 min × 3 times.

[0066] 1. DAB staining: Add DAB staining solution to the tissue location on the slide, place the slide on an inverted microscope to observe the tissue staining, and discard the staining solution when the staining intensity reaches the optimal level. Wash with deionized water for 3 minutes × 3 times.

[0067] m. Hematoxylin counterstaining: Add an appropriate amount of modified Lillie-Mayer hematoxylin staining solution to the tissue location on the slide, stain for 10 seconds, discard the staining solution, and place the slide holder containing the slide under running tap water for 1 minute to restore the blue color.

[0068] n. Dehydration: The slide holder containing the slides was immersed in 75% ethanol solution for 5 min × 1 time; 95% ethanol solution for 5 min × 1 time; and anhydrous ethanol solution for 5 min × 3 times in sequence.

[0069] o. Transparency: Immerse the slices in xylene solution for 5 minutes twice.

[0070] p. Mounting: Apply an appropriate amount of neutral resin to the tissue location on the slide, use tweezers to gently cover the slide with a coverslip, and place it in a fume hood to dry.

[0071] q. Scoring: All samples were reviewed by two independent pathologists experienced in IHC assessment who were unaware of the patients' clinical outcomes. The percentage and intensity of positively stained cells were assessed to semi-quantitatively determine G3BP1 expression. The percentage of positively stained cells was scored as follows: 0, <10%; 1, 10%–50%; 2, >50%. Intensity was graded as follows: 0 (no or weak staining = pale yellow), 1 (moderate staining = yellowish-brown), and 2 (strong staining = brown). The total score for G3BP1 expression was the sum of the percentage of positively stained cells and the intensity score, ranging from 0 to 4. For statistical analysis, the final score was a combination of independent scores assigned by the two pathologists reported in this study. Any discrepancies in scores were resolved through discussion between the two pathologists.

[0072] Relevant experimental results are as follows Figures 1-2 As shown, Figures 1-2 To verify the expression of G3BP1 in human endometrial cancer tissues using immunohistochemistry. Figure 1 Three representative images of G3BP1 immunohistochemical staining in 120 pairs of human endometrial cancer tissues (n=120, scale bar: 10μm); Figure 2 Stacked bar chart of immunohistochemical staining results of 120 pairs of human endometrial cancer tissues and paired adjacent normal tissues (n=120, ****P<0.0001).

[0073] Example 2

[0074] Cloning

[0075] (1) Take AN3CA and HEC-1-A endometrial cancer cells that have grown well after transiently transfecting Negative Control, siG3BP1 and FLAG-G3BP1 plasmids for 24 hours respectively, and digest the adherent cells into a uniform cell suspension.

[0076] siG3BP1 is a G3BP1 knockout plasmid, and FLAG-G3BP1 (G3BP1-OE) is a G3BP1 overexpression plasmid. NegativeControl, siG3BP1, and FLAG-G3BP1 were all synthesized by Qingke Company. siG3BP1 contains four oligonucleotide sequences, as shown in SEQ ID No. 2 to SEQ ID No. 5. The vector for FLAG-G3BP1 is pCMV-Flag, and the vector for siG3BP1 is pCMV-Myc. The inserted sequences in siG3BP1 and FLAG-G3BP1 are shown in SEQ ID No. 6.

[0077] (2) Take 20 μL of the above uniform cell suspension and add it to a cell counting chamber. Measure its concentration using a cell counter. Dilute the cell suspension according to the corresponding ratio and pipette to mix it evenly.

[0078] (3) Take several 6-well cell plates, add 2×103 cells to each well, quantify 2mL, set 3 replicates for each treatment group, shake well using the figure-eight method, place in a constant temperature incubator, change the medium every 5 days, and culture for a total of 10-15 days.

[0079] (4) When cell colonies are visible to the naked eye in the six-well plate, discard the culture medium in the well, rinse twice with PBS buffer, add an appropriate amount of 4% paraformaldehyde to each well to fix the cells, and let stand for 30 min.

[0080] (5) Discard the fixative, rinse twice with PBS buffer, add 800 μL of 0.1% crystal violet dye to each well, stain on a shaker for 10 min, recover the dye, rinse three times with PBS buffer, place in an oven at 37℃ overnight, and take pictures and collect data after the six-well plate has dried.

[0081] Relevant experimental results are as follows Figures 3-4 As shown, Figures 3-4 To verify the effect of G3BP1 expression level on the growth of endometrial cancer cells in order to establish clones. Figure 3 To test the colony-forming ability of AN3CA and HEC-1-A in a colony-forming experiment; Figure 4 For quantification of clonogenic assay results (ns represent no statistically significant difference, ***P<0.001). (NC: Negative control, G3BP1-OE: G3BP1 overexpression, si-G3BP1: G3BP1 knockout).

[0082] Example 3

[0083] CCK-8 Value-Added Experiment

[0084] (1) Take AN3CA and HEC-1-A endometrial cancer cells that have grown well after transient transfection with Negative Control, siG3BP1, and FLAG-G3BP1 for 24 hours respectively, and digest the adherent cells into a homogeneous cell suspension.

[0085] (2) Take 20 μL of the above uniform cell suspension and add it to a cell counting chamber. Measure its concentration using a cell counter. Dilute the cell suspension according to the corresponding ratio and pipette to mix it evenly.

[0086] (3) Take 6 96-well cell plates, add 2×103 cells to each well, quantify 0.1 mL, set 5 replicates for each treatment group, shake well using the figure-eight method, and place in a constant temperature incubator.

[0087] (4) Six 96-well cell culture plates were cultured for 0, 1, 2, 3, 4, and 5 days, respectively. 10 μL of LCK8 reagent was added to each well under dark conditions, and the plates were incubated in a constant temperature incubator for 2 hours until the plates turned orange-yellow. The absorbance of each well was measured using a microplate reader at a wavelength of 450 nm. The readings were repeated 3 times, and the data were recorded and organized.

[0088] Relevant experimental results are as follows Figures 5-6 As shown, Figures 5-6 To verify the effect of G3BP1 expression level on the growth of endometrial cancer cells in the CCK8 assay. Figure 5 To detect the effect of G3BP1 expression level on AN3CA cell growth using the CCK8 assay; Figure 6 The effect of G3BP1 expression level on HEC-1-A cell growth was detected using the CCK8 assay (ns represent no statistically significant difference, ***P<0.001). (NC: Negative control, G3BP1-OE: G3BP1 high expression, si-G3BP1: G3BP1 knockout).

[0089] Example 4

[0090] Transwell migration experiment

[0091] (1) Take AN3CA and HEC-1-A endometrial cancer cells that have grown well after being transfected with Negative Control, si-G3BP1 and FLAG-G3BP1 plasmids for 24 hours respectively, and digest the adherent cells into a uniform cell suspension.

[0092] (2) Collect the cell suspension into a 1.5 mL centrifuge tube and centrifuge at 1,000 rpm for 4 min.

[0093] (3) Discard the supernatant, resuspend the cell pellet in 1 mL of PBS solution, centrifuge again as described above, resuspend the cells in 1 mL of DMEM, count the cells using a cell counting chamber, and dilute with DMEM as needed.

[0094] (4) Use sterile forceps to pick up 3 Transwell chambers and put them into a new 24-well cell plate. Add 150 μL of the above cell suspension to each chamber, and quantify 5 × 10⁴ cells. Add 500 μL of complete culture medium to the lower chamber. After standing for 30 min, put the well plate into a constant temperature incubator.

[0095] (5) After 48 hours, discard the culture medium inside and outside the chamber, and rinse the chamber and the bottom of the well plate twice with PBS buffer.

[0096] (6) Add 500 μL of paraformaldehyde fixative to the small chamber and let it stand for 30 min.

[0097] (7) Discard the fixative, rinse twice with PBS solution, add 500 μL of 0.1% crystal violet dye, and place the well plate on a shaker for 20 min for staining.

[0098] (8) Recover the staining agent, rinse three times with PBS solution, air dry the chamber naturally, take photos and collect data.

[0099] Relevant experimental results are as follows Figures 7-8 As shown, Figures 7-8 To verify the effect of G3BP1 expression level on the migration of endometrial cancer cells in the Transwell migration assay, Figure 7 Migration experiments of AN3CA and HEC-1-A cells after overexpression or knockout of G3BP1; Figure 8 To quantify the results of cell migration experiments (NC: Negative control, G3BP1-OE: G3BP1 overexpression, si-G3BP1: G3BP1 knockout).

[0100] Example 5

[0101] qRT-PCR experiment

[0102] (1) Aspirate the culture medium, add 1 ml of TRIGene to each well, pipette and blow several times to ensure complete cell lysis, and then transfer to a centrifuge tube;

[0103] (2) The lysate was left at room temperature for 5 min to allow the nucleic acid-protein complex to be completely separated;

[0104] (3) Add 0.2 ml of chloroform to each 1 ml of TRIGene, tighten the cap, shake vigorously for 15 seconds, and let stand at room temperature for 2-3 minutes;

[0105] (4) Centrifuge at 12000×g at 4℃ for 15 min. The sample will be separated into three layers: an orange-yellow lower organic phase, a middle layer, and a colorless upper aqueous phase.

[0106] (5) Transfer the upper aqueous phase containing total RNA to a new centrifuge tube, and transfer the volume of the aqueous phase to 60% of the volume of the TRIGene reagent used.

[0107] (6) Add 0.5 ml of isopropanol according to the initial usage of 1 ml TRIGene, invert several times to mix well, and let stand at room temperature for 10 min;

[0108] (7) Centrifuge at 12000x g for 10 min at 4℃, discard the supernatant, and a gel-like RNA precipitate will be visible;

[0109] (8) Add 1 ml of 75% ethanol to each 1 ml of TRIGene for the initial use, invert several times to mix, and wash the precipitate.

[0110] (9) Centrifuge at 12,000×g for 5 min at 4℃ and discard the supernatant;

[0111] (10) Invert at room temperature for 5-10 minutes to air dry;

[0112] (11) Add 25 μl DEPC-ddH2O and pipette several times to dissolve the RNA;

[0113] (12) The concentration, purity and integrity of RNA were detected by RNA electrophoresis and ultraviolet spectrophotometry;

[0114] (13) The obtained RNA should be used immediately or aliquoted and stored at -80°C to avoid repeated freeze-thaw cycles;

[0115] (14) Reverse transcription reaction system:

[0116] RNase-free ddH2O to 20μL; Enzyme Mix: 1μL; 5×All-in-one qRT SuperMix: 4μL; Template RNA Total RNA: 1pg-1μg.

[0117] Reaction procedure:

[0118] 50℃: 15min; 85℃: 5sec.

[0119] (15) qRT-PCR detection:

[0120] qRT-PCR primers:

[0121] G3BP1-RTF:AAGAGTGCGAGAACAACGAA;

[0122] G3BP1-RTR: TGGTGACTGTCAGGGTGTCT;

[0123] GAPDH-RTF:CATGGCCTTCCGTGTTCCTA;

[0124] GAPDH-RTR:CCCTCAGATGCCTGCTTCA.

[0125] Prepare the following mixture in a qPCR tube:

[0126] 2×Taq Pro Universal SYBR qPCR Master Mix: 10.0μl; Primer1 (10μM): 0.4μl; Primer2 (10μM): 0.4μl; Template DNA / Cdna: xμl; ddH2O To20.0μl.

[0127] Reaction steps:

[0128] Stage 1 pre-denaturation: Reps: 1; 95℃: 30 sec;

[0129] Stage 2 cycle reaction: Reps: 40; 95℃: 3-10 sec; 60℃: 10-30 sec;

[0130] Stage 3 melting curves: Reps:1: 95℃: 15sec; 60℃: 60sec; 95℃: 15sec.

[0131] Relevant experimental results are as follows Figures 9-10 As shown, Figures 9-10 We screened for G3BP1 knockout siRNAs using qRT-PCR and Western blotting techniques, and confirmed that si-G3BP1-3 was a knockout siRNA, which was then used as the si-G3BP1 described in subsequent experiments. Figure 9 Screening for G3BP1 knockout AN3CA using qRT-PCR and Western blotting techniques; Figure 10 qRT-PCR and Western blotting were used to screen for G3BP1 knockout HEC-1-A.

[0132] In this specific implementation method, all embodiments ensured that the experimental data and collected original clinical data underwent comprehensive review, verification, and organization to ensure that the data was as complete, accurate, and error-free as possible. Then, Excel software was used to establish tissue and cell databases separately, and the relevant original clinical data were grouped, summarized, and entered into tables. Finally, SPSS 26.0 statistical software was used to organize and analyze the final experimental data. All statistical tests were performed with two-tailed probabilities at a significance level of α = 0.05. If P < 0.05, the difference between the two groups was considered statistically significant; otherwise, the difference was considered not statistically significant. The creation of bar charts, line graphs, and other experimental result graphs was completed using GraphPad Prism 9.0 and SPSS 26.0 software.

[0133] To examine the expression of G3BP1 in endometrial cancer tissues, we collected 120 pairs of human endometrial cancer tissue slides and used immunohistochemical staining to detect the expression level of G3BP1 in clinical samples. Immunohistochemical staining results showed that G3BP1 stained as varying shades of brownish-yellow and was mainly located in the cytoplasm of endometrial cancer tissues and adjacent normal tissues. Compared with endometrial cancer tissues, G3BP1 expression was weaker or absent in the corresponding adjacent normal tissues. Pathologists analyzed the immunohistochemical staining images, and the results showed that the expression level of G3BP1 in endometrial cancer tissues was concentrated in three grades: Negative (0 points), Low positive (1-2 points), and High positive (3-4 points). Furthermore, the positive expression rate of G3BP1 in endometrial cancer tissues was 88.33% (106 / 120), while it was only 28.33% (34 / 120) in adjacent normal tissues, a statistically significant difference (X2 = 81.52, P < 0.0001). The expression level of G3BP1 in endometrial cancer tissues was significantly higher than that in the corresponding adjacent normal tissues (P<0.0001).

[0134] To further validate the cellular function of G3BP1 protein, we knocked out G3BP1 in endometrial cancer cells using siRNA and then confirmed the results using Western blotting and RT-PCR.

[0135] In further experiments to verify the effects of G3BP1 on the proliferation and migration of endometrial cancer cells, we used the CCK8 assay, colony formation assay, and Transwell migration assay. The CCK8 assay showed that compared with wild-type endometrial cancer cells, cells in the G3BP1 high-expression group had significantly increased proliferation, while cells in the G3BP1 low-expression group had significantly decreased proliferation. The colony formation assay showed that compared with wild-type endometrial cancer cells, the number of cell colonies in the G3BP1 high-expression group was significantly increased, while the number of cell colonies in the G3BP1 low-expression group was significantly decreased. This indicates that G3BP1 has the ability to promote the proliferation of endometrial cancer cells.

[0136] Transwell migration assays showed that in AN3CA cells, the number of cells penetrating the Transwell chambers was significantly increased in the G3BP1 high-expression group compared to the Negative Control group. This indicates that G3BP1 has the ability to promote the migration of endometrial cancer cells.

[0137] These results suggest that detecting G3BP1 protein has relatively high value for the diagnosis of endometrial cancer.

[0138] This invention provides a highly sensitive, specific, short-cycle, and stable detection method by detecting the expression of G3BP1 in endometrial cancer tissue and the effects of high and low G3BP1 expression on the proliferation and migration of endometrial cancer cells. Combining statistical principles and modern biological techniques, it offers a scientific basis for the diagnosis and treatment of endometrial cancer patients and provides possibilities for molecular targeted therapy.

[0139] While the disclosure is as stated above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of this disclosure, and all such changes and modifications will fall within the protection scope of this invention.

Claims

1. Use of siRNA in the manufacture of a medicament for treating endometrial cancer, characterized in that, The siRNA is named siG3BP1, which inhibits tumor cell proliferation by inhibiting G3BP1 expression, and the target sequence of the siG3BP1 is shown as SEQ ID No.

6. The siRNA is named siG3BP1, which inhibits tumor cell proliferation by inhibiting G3BP1 expression, and the target sequence of the siG3BP1 is shown as SEQ ID No. 6.

Images