Endogenous signal peptide element fused with MF-alpha pro region and its use

By fusing the MF-αpro region or deleting specific amino acids in the endogenous signal peptide of Pichia pastoris, SP23-pro and FLO10-pro fusion signal peptide elements were constructed, solving the problem of insufficient secretion capacity of endogenous signal peptides and realizing the efficient secretion of exogenous proteins, which is suitable for the production of industrial enzymes and pharmaceutical proteins.

CN122277754APending Publication Date: 2026-06-26HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610355352.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-23
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

The existing Pichia pastoris has insufficient endogenous signal peptide secretion capacity, which limits its industrial application in recombinant protein production, and there is a lack of systematic screening methods.

Method used

By fusing the C-terminus of the endogenous signal peptide of Pichia pastoris with the MF-αpro region or deleting amino acids 38 to 51, SP23-pro and FLO10-pro fusion signal peptide elements were constructed, and an upgraded AOX1 promoter was applied in the recombinant expression vector to achieve efficient secretion of exogenous proteins.

Benefits of technology

It significantly improves the secretion efficiency of endogenous signal peptides and increases the secretion efficiency of exogenous proteins such as GFP, ChiA, and OPH by 6.0 times. It has good versatility and applicability and is suitable for the production of industrial enzymes, pharmaceutical proteins, and diagnostic reagents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122277754A_ABST
    Figure CN122277754A_ABST
Patent Text Reader

Abstract

This invention relates to the field of bioengineering technology, specifically to an endogenous signal peptide element fused with the MF-αpro region and its applications. The endogenous signal peptide element is composed of an endogenous signal peptide from Pichia pastoris with the C-terminus fused with MF-αpro or with amino acids 38 to 51 of the MF-αpro region detached; the amino acid sequence of the MF-αpro region is shown in SEQ ID NO:8; the amino acid sequence of the MF-αpro region with detached amino acids 38 to 51 is shown in SEQ ID NO:10. This invention provides a complete solution from rational screening to functional verification to element optimization. The resulting highly efficient, patent-free signal peptide element is suitable for the production of industrial enzymes, pharmaceutical proteins, and diagnostic reagents.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to an endogenous signal peptide element fused with the MF-αpro region and its applications. Background Technology

[0002] Pichia pastoris has become an important platform for recombinant protein production due to its ease of genetic manipulation, high-density fermentation, and eukaryotic modification capabilities. Traditional secretory expression commonly uses the α-mating factor signal peptide (MF-αsignal), but its secretion efficiency for some proteins is limited. In recent years, researchers have attempted to use Pichia pastoris' own signal peptides (such as FlO10 and SP23) to replace the α-signal peptide; however, when using endogenous signal peptides alone, the secretion level is often lower than that of the α-signal peptide, limiting its industrial application. The pro region (MF-αpro), located after the MF-α signal peptide cleavage site, is rich in charged and flexible amino acids. It can delay precursor protein folding within the ER lumen and promote the secondary opening of the translocation channel Sec61, thereby enhancing secretion. In existing technologies, the selection of endogenous signal peptides largely relies on literature reports or experience, lacking systematic screening. Therefore, this invention provides an endogenous signal peptide element fused with the MF-αpro region and its applications. Summary of the Invention

[0003] The technical problem to be solved by this invention is to provide an endogenous signal peptide element fused with the MF-αpro region and its application. The aim is to overcome the bottleneck of weak secretion capacity of existing endogenous signal peptides, propose a universal endogenous signal peptide + pro-pro strategy, and verify its applicability in various industrial enzymes.

[0004] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, an endogenous signal peptide element fused with the MF-αpro region, wherein the endogenous signal peptide element is composed of an endogenous signal peptide of Pichia pastoris fused with the MF-αpro region or having amino acids 38 to 51 of the MF-αpro region deleted from the C-terminus of the MF-αpro region. The Pichia pastoris endogenous signal peptide includes either SP23 signal peptide or FLO10 signal peptide. The amino acid sequence of the SP23 signal peptide is shown in SEQ ID NO:2; The amino acid sequence of the FLO10 signal peptide is shown in SEQ ID NO:4; The amino acid sequence of the MF-αpro region (the pro region of the MF-α signal peptide in Saccharomyces cerevisiae) is shown in SEQ ID NO:8. The amino acid sequence of the region missing amino acids 38 to 51 of the MF-αpro region is shown in SEQ ID NO:10.

[0005] Based on the above technical solution, the present invention can be further improved as follows.

[0006] Furthermore, the nucleotide sequence of the SP23 signal peptide is shown in SEQ ID NO:1; The nucleotide sequence of the FLO10 signal peptide is shown in SEQ ID NO:3; The nucleotide sequence of the MF-αpro region is shown in SEQ ID NO:7; The nucleotide sequence of the MF-αpro region missing amino acids 38 to 51 is shown in SEQ ID NO:9.

[0007] In a second aspect, a recombinant expression vector comprises a coding sequence for an endogenous signal peptide element encoding the fusion pro region and a coding sequence for an exogenous protein operatively linked to a nucleic acid molecule encoding the endogenous signal peptide element of the fusion pro region.

[0008] Furthermore, the framework of the recombinant expression vector includes an upgraded AOX1 promoter, the nucleotide sequence of which is shown in SEQ ID NO: 11; The framework of the recombinant expression vector includes pHBM905M or pPIC9K vectors.

[0009] Furthermore, the exogenous protein includes any one of green fluorescent protein (GFP), chitinase (ChiA), and organophosphorus hydrolase (OPH).

[0010] Furthermore, the nucleotide sequence of the green fluorescent protein is shown in SEQ ID NO:12; The nucleotide sequence of the chitinase is shown in SEQ ID NO:13; The nucleotide sequence of the organophosphorus hydrolase is shown in SEQ ID NO:14.

[0011] Thirdly, a recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium comprises the recombinant expression vector.

[0012] Furthermore, the host cell of the recombinant genetically engineered bacteria is Pichia pastoris (Pichia pastoris). Pichia pastoris The preferred strain is Pichia pastoris GS115.

[0013] Fourthly, a method for constructing recombinant genetically engineered bacteria includes the following steps: (1) The C-terminus of the nucleotide sequence of the endogenous signal peptide of Pichia pastoris is fused with the nucleotide sequence of the MF-αpro region or the amino acid 38 to 51 of the MF-αpro region to construct an expression fusion signal peptide element. (2) The expression fusion signal peptide element is cloned into an expression vector, and a nucleotide sequence of a foreign protein is inserted downstream of the expression fusion signal peptide element in the expression vector to construct a recombinant expression vector; (3) The recombinant expression vector was transformed into Pichia pastoris host cells to obtain recombinant genetically engineered bacteria.

[0014] Fifthly, the application of the endogenous signal peptide element fused to the pro region, the recombinant expression vector, or the recombinant genetically engineered bacteria in expressing exogenous proteins in Pichia pastoris host cells.

[0015] This invention first uses the SignalP 4.1 server (http: / / www.cbs.dtu.dk / services / SignalP / ) to predict endogenous signal peptides in Pichia pastoris, selecting three high-confidence signal peptides, Msb2, SP23, and FLO10, with D-scores > 0.8, as the modification targets. Based on this, a modification strategy of "directly fusing the C-terminus of the endogenous signal peptide with the MF-αpro region" was invented, and green fluorescent protein (GFP) was used as a reporter system for initial screening. The results showed that SP23-pro and FLO10-pro mediated GFP secretion levels increased to 6.0-fold and 1.6-fold compared to the wild type, respectively, while Msb2-pro had no significant effect (approximately 1.0-fold compared to the wild type). Subsequently, the effective elements SP23-pro and FLO10-pro were further validated using chitinase (ChiA) and organophosphorus hydrolase (OPH), confirming their universal secretion-enhancing effect on proteins of different properties (1.3-2.7-fold increase). Further deletion of amino acids 38 to 51 in the MF-αpro region could further increase secretion efficiency by 20-30%.

[0016] The beneficial effects of this invention are: (1) High secretion efficiency: The SP23-pro and FLO10-pro fusion signal peptide element constructed in this invention improves the secretion efficiency of proteins with different properties such as GFP, ChiA, and OPH, which is significantly improved compared with their corresponding wild-type endogenous signal peptides (up to 6.0 times), and is superior to or comparable to the traditional MF-α signal peptide; furthermore, by performing specific deletion mutations (Δ38-51) on the MF-αpro region, the secretion efficiency can be further improved by 20-30% on the original basis, providing a direction for the continuous optimization of the element.

[0017] (2) High versatility: The SP23-pro and FLO10-pro fusion signal peptide elements constructed in this invention have been verified to be effective on a variety of proteins with molecular weights ranging from 27 kDa (GFP) to 63 kDa (ChiA), demonstrating their good versatility.

[0018] (3) Good industrialization prospects: This invention provides a complete solution from rational screening to functional verification and then to element optimization. The obtained high-efficiency signal peptide elements without patent barriers have broad application potential in the fields of industrial enzyme, pharmaceutical protein and diagnostic reagent production. Moreover, all the elements used are derived from the Pichia pastoris sequence itself, compatible with the upgraded AOX1 promoter and the existing Pichia pastoris high-density fermentation process, easy to scale up production, and have low industrialization threshold. Attached Figure Description

[0019] Figure 1 The relative fluorescence intensity of green fluorescent protein (GFP) expressed by different endogenous signal peptides and their fused MF-αpro region elements; Figure 2 A comparison of the relative enzyme activities of chitinase (ChiA) expressed by SP23-pro and FLO10-pro elements; Figure 3 A comparison of the relative enzyme activities of organophosphorus hydrolases (OPH) expressed by SP23-pro and FLO10-pro elements; Figure 4 This is a graph showing the relative fluorescence intensity of GFP expression after a deletion mutation at amino acid positions 38-51 in the MF-αpro region. Detailed Implementation

[0020] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0021] Description of the source of materials and reagents: The PCR reagents, plasmid extraction and purification DNA gel recovery kits, and seamless cloning kits used in this invention were all purchased from Yisheng Company. All gene synthesis, primer synthesis, and sequencing involved in the experiments were performed by Sangon Biotech Co., Ltd., and restriction endonucleases were purchased from Takara. Detailed usage instructions for the reagents are provided in the user manual. The microplate reader used for fluorescence detection was an MD SpectraMax M2e. The host strain used was Pichia pastoris GS115 (… Pichia pastorisThe GS115 was purchased from Thermo Fisher Scientific. The expression vector was pHBM905M, which was optimized and constructed based on the Pichia pastoris expression vector pPIC9K. The relevant construction methods and sequence information can be obtained from publicly available literature. The plasmid backbone used in this experiment was pHBM905M-GFP, which was obtained by double digestion with restriction endonucleases EcoRI and CpoI, followed by purification and recovery to obtain the linearized pHBM905M backbone.

[0022] This invention provides a method for modifying endogenous signal peptides. Based on the pHBM905M series vector backbone, an MF-αpro region is added to the endogenous signal peptide to construct an "endogenous signal peptide + pro" fusion element, which is then integrated into an upgraded AOX1 promoter-driven secretory expression vector to achieve efficient secretory expression of exogenous proteins in Pichia pastoris GS115. The steps involved are as follows: Selecting the Pichia pastoris endogenous signal peptide SP23 or FLO10, and directly fusing the MF-αpro region sequence to its C-terminus to form an SP23-pro or FLO10-pro fusion signal peptide; cloning the fusion signal peptide into the pHBM905M series vector backbone to construct a recombinant secretory expression vector; inserting the coding sequence of the target exogenous protein (such as GFP, ChiA, OPH, etc.) downstream of the fusion signal peptide to form a complete expression cassette; linearizing the constructed vector and electroporating it into Pichia pastoris GS115 competent cells; after methanol-induced expression, collecting the culture supernatant, and detecting the secretion level and activity of the target protein. This method significantly improves the efficiency of protein secretion mediated by endogenous signal peptides, and can replace traditional α-factor signal peptides, making it suitable for the efficient production of industrial enzymes, pharmaceutical proteins, and diagnostic reagents. This invention relates to the following embodiments.

[0023] This embodiment relates to an endogenous signal peptide element fused with the MF-αpro region, wherein the endogenous signal peptide element is composed of an endogenous signal peptide of Pichia pastoris with the MF-αpro region fused to the C-terminus or with amino acids 38 to 51 of the MF-αpro region fused to the C-terminus. The Pichia pastoris endogenous signal peptide includes either SP23 signal peptide or FLO10 signal peptide. The amino acid sequence of the SP23 signal peptide is shown in SEQ ID NO:2; The amino acid sequence of the FLO10 signal peptide is shown in SEQ ID NO:4; The amino acid sequence of the MF-αpro region (the pro region of the MF-α signal peptide in Saccharomyces cerevisiae) is shown in SEQ ID NO:8. The amino acid sequence of the region missing amino acids 38 to 51 of the MF-αpro region is shown in SEQ ID NO:10.

[0024] Preferably, the nucleotide sequence of the SP23 signal peptide described in this embodiment is shown in SEQ ID NO:1; The nucleotide sequence of the FLO10 signal peptide is shown in SEQ ID NO:3; The nucleotide sequence of the MF-αpro region is shown in SEQ ID NO:7; The nucleotide sequence of the MF-αpro region missing amino acids 38 to 51 is shown in SEQ ID NO:9.

[0025] This embodiment also relates to a recombinant expression vector, which comprises a coding sequence for an endogenous signal peptide element encoding the fusion pro region and a coding sequence for an exogenous protein operatively linked to the nucleic acid molecule encoding the endogenous signal peptide element of the fusion pro region. Preferably, the framework of the recombinant expression vector described in this embodiment includes an upgraded AOX1 promoter, the nucleotide sequence of which is shown in SEQ ID NO: 11; The framework of the recombinant expression vector includes pHBM905M or pPIC9K vectors.

[0026] In this embodiment, the preferred exogenous protein includes any one of green fluorescent protein (GFP), chitinase (ChiA), and organophosphorus hydrolase (OPH). Specifically, the nucleotide sequence of the green fluorescent protein is shown in SEQ ID NO:12; the nucleotide sequence of the chitinase is shown in SEQ ID NO:13; and the nucleotide sequence of the organophosphorus hydrolase is shown in SEQ ID NO:14.

[0027] This embodiment also relates to a recombinant genetically engineered bacterium, which contains the recombinant expression vector described above.

[0028] In this embodiment, the preferred host cell for the recombinant genetically engineered bacteria is Pichia pastoris (Pichia pastoris). Pichia pastoris (More preferably, Pichia pastoris strain GS115).

[0029] This embodiment also relates to a method for constructing recombinant genetically engineered bacteria, including the following steps: (1) The C-terminus of the nucleotide sequence of the endogenous signal peptide of Pichia pastoris is fused with the nucleotide sequence of the MF-αpro region or the amino acid 38 to 51 of the MF-αpro region to construct an expression fusion signal peptide element. (2) The expression fusion signal peptide element is cloned into an expression vector, and a nucleotide sequence of a foreign protein is inserted downstream of the expression fusion signal peptide element in the expression vector to construct a recombinant expression vector; (3) The recombinant expression vector was transformed into Pichia pastoris host cells to obtain recombinant genetically engineered bacteria.

[0030] This embodiment also relates to the endogenous signal peptide element of the fusion pro region, or the recombinant expression vector, or the application of the recombinant genetically engineered bacteria in expressing exogenous proteins in Pichia pastoris host cells.

[0031] The construction of recombinant plasmids and recombinant strains includes the following specific steps: The primers for amplifying the upgraded AOX1 promoter + SP23 signal peptide from the laboratory-preserved pHBM905BDM vector are as follows: AOX-F: ctcaGAATTCTCTAGAagatctaacatccaaagacgaaagg (SEQ ID NO: 15); AOX-R1-SP23: GCAACAAAGCAGACAAGATCTTCATcgtttcgaataattagttgttttttgatcttctc (SEQ ID NO: 16); AOX-R2-SP23:GCGAATGCCAAAGTAAACAGCAGCAACAAAGCAGACAAGATCTTCATc (SEQ IDNO:17); The primers for amplifying the upgraded AOX1 promoter + FLO10 signal peptide from the laboratory-preserved pHBM905BDM vector are as follows: AOX-F: ctcaGAATTCTCTAGAagatctaacatccaaagacgaaagg (SEQ ID NO: 18); AOX-R1-FLO10: CAACGAACTTACTCTTTTCGAACATcgtttcgaataattagttgttttttgatcttctc (SEQ ID NO: 19); AOX-R2-FLO10: CAGAAAAGTTGCAAAAGCAACAGGAATGAGACAACGAACTTACTCTTTTCGAACATcg (SEQ ID NO: 20); AOX-R3-FLO10: cggaccgaatacACCATGCACACCTAGCACACAGAAAAGTTGCAAAAG (SEQ IDNO: 21); The primer sequences for amplifying MF-αpro from the laboratory-preserved pHBM905BDM vector are as follows: SP23-F-pro: CTTTGGCATTCGCAgctccagtcaacactacaacagaag (SEQ ID NO: 22); FLO10-F-pro: GCTAGGTGTGCATGGTgctccagtcaacactacaacagaag (SEQ ID NO: 23); pro-R-GFP: CTTTAGAGACACGAGACATcggaccgaatacagcttcagcctctcttttctcg (SEQID NO: 24); Recombinant plasmids were obtained by multi-fragment cloning of 905-AOX1-SP23-GFP, 905-AOX1-SP23pro-GFP, 905-AOX1-FLO10-GFP, and 905-AOX1-FLO10pro-GFP, and transformed into *E. coli* DH5α. The four recombinant plasmid backbones were then subjected to double digestion with Cpo I and Not I to obtain linearized backbones. The primers for amplifying the ChiA sequence from the laboratory-preserved pHBM905M-ChiA vector are as follows: SP23-ChiA-F: GGCATTCGCAgtattcggtccggattccggaaaaaactataaaatcatcggc (SEQ ID NO: 25); FLO10-ChiA-F: CTAGGTGTGCATGGTgtattcggtccggattccggaaaaaactataaaatcatcggc (SEQ ID NO: 26); pro-ChiA-F: gagaggctgaagctgtattcggtccggattccggaaaaaactataaaatcatcggc (SEQ ID NO: 27); ChiA-R: ggcgaattaattcgcggccgcTCAttcgcagcctccgatc (SEQ ID NO: 28); The above fragment and backbone were transformed into Escherichia coli DH5α to obtain a recombinant plasmid.

[0032] The primers for amplifying the OPH sequence from the laboratory-preserved pHBM905BDM-OPH vector are as follows: SP23-F-OPH:CATTCCGCAgtattcggtccgGCTGCTCCAGCTCAACAAAGAC (SEQ ID NO: 29); FLO10-F-OPH: GCATGGTgtattcggtccgGCTGCTCCAGCTCAACAAAGAC (SEQ ID NO: 30); pro-F-OPH: ctgaagctgtattcggtccgGCTGCTCCAGCTCAACAAAGAC (SEQ ID NO: 31); OPH-R: gcgaattaattcgcggccgcTCATCTATCAGATCTAATTGGAGAAAATTCAACTGGAAC (SEQ ID NO: 32).

[0033] The above fragment and backbone were transformed into E. coli DH5α to obtain a recombinant plasmid. The recombinant plasmid was then used... Sal Linearized Pichia pastoris GS115 was electroporated, plated on MD plates, and incubated at 28°C for 2–3 days. Eight clones were randomly selected for colony PCR. After verifying positive transformants, the protein expression strain was obtained by preservation. Specific examples are provided below for further explanation.

[0034] Example 1: Initial screening and construction of fusion signal peptide elements based on the GFP reporter system (1) Screening of endogenous signal peptides based on bioinformatics prediction: We used the well-known bioinformatics tool SignalP 4.1 to predict and score potential signal peptide sequences in the Pichia pastoris genome, screening out high-quality candidates with clear secretion potential from the source. Among them, the D-score of SignalP is a key indicator for measuring the reliability of signal peptide prediction, and a D-score > 0.8 usually indicates high reliability. Based on this, we selected three endogenous signal peptides, Msb2, SP23 and FLO10, with D-scores all greater than 0.8, as the starting point for modification in this study to ensure that subsequent functional verification is based on reliable bioinformatics predictions.

[0035] (2) Construction of fusion signal peptide elements: The coding sequences of SP23 (nucleotide sequence as shown in SEQ ID NO:1), FLO10 (nucleotide sequence as shown in SEQ ID NO:3), and Msb2 (nucleotide sequence as shown in SEQ ID NO:5) were synthesized by Sangon Biotech Co., Ltd. The MF-αpro region (nucleotide sequence as shown in SEQ ID NO:7) was directly spliced ​​to the 3' end of these sequences, yielding SP23-pro and FLO10-pro fusion fragments, respectively. These fragments were then digested with EcoRI / NotI and inserted into a pHBM905M linearized backbone to obtain recombinant plasmids pHBM905M-SP23-pro-GFP, pHBM905M-FLO10-pro-GFP, and pHBM905M-Msb2-pro-GFP. The plasmids were linearized with SalI, electrotransformed into Pichia pastoris GS115, plated on MD plates, and cultured at 28°C for 2–3 days. Positive transformants, verified by colony PCR, were inoculated into BMGY medium and cultured until OD600. 600 Cells were cultured at approximately 1.5 μL and transferred to BMMY medium, where they were induced with methanol for 4 days. The BMMY medium was prepared in-house, and all reagents used were purchased from OXOID, and are commercially available. 1% (v / v) methanol was added every 24 hours during induction. The supernatant was collected and the GFP fluorescence value was detected using a multi-functional microplate reader, and the cell density was measured using a spectrophotometer.

[0036] The results are as follows Figure 1 The results show that SP23-pro and FLO10-pro have been identified as effective candidate elements with significant secretion-enhancing effects and will proceed to the next validation stage. Since Msb2-pro did not show any effect in this system, future research will focus on SP23-pro and FLO10-pro.

[0037] Example 2: Verification of the universality of the effective element for chitinase (ChiA) secretion The GFP fragment in Example 1 was replaced with the chitinase ChiA coding sequence (SEQ ID NO: 13), while the rest of the backbone and construction process remained unchanged, yielding pHBM905M-SP23-pro-ChiA and pHBM905M-FLO10-pro-ChiA. GS115 was transformed under the conditions of Example 1 and induced for 4 days. Samples were taken for enzyme activity assay: ChiA activity was measured using the DNS method, with enzyme activity units being the amount of enzyme required to hydrolyze the substrate to produce 1 μmol of acetylated glucosamine under suitable conditions.

[0038] Result image Figure 2 The results showed that the enzyme activity in the SP23-pro supernatant was 2.7 times that of wild-type SP23; the enzyme activity in the FLO10-pro supernatant was 1.3 times that of wild-type FLO10. These results were consistent with the trend observed in GFP. Figure 1 This indicates that the "endogenous signal peptide + pro" strategy is also effective for ChiA.

[0039] Example 3: Verification of the universality of the effective element for the secretion of organophosphorus hydrolases (OPH) The reporter gene was replaced with the encoding sequence for organophosphorus hydrolase OPH (SEQ ID NO:14) to construct pHBM905M-SP23-pro-OPH and pHBM905M-FLO10-pro-OPH. GS115 cells were transformed under the conditions of Example 1 and induced for 4 days. Samples were taken for enzyme activity assays: OPH activity was measured using the methyl parathion method, and the specific absorption peak of p-nitrophenol at 410 nm was measured using a microplate reader. Enzyme activity was calculated based on absorbance: one enzyme activity unit (U) was defined as the amount of enzyme required to generate 1 μmol of p-nitrophenol per minute.

[0040] The results are as follows Figure 3 The results showed that the enzyme activity in the supernatant of SP23-pro was 1.6 times that of wild-type SP23; and the enzyme activity in the supernatant of FLO10-pro was 1.3 times that of wild-type FLO10, indicating that the "endogenous signal peptide + pro" strategy is also effective for OPH.

[0041] Example 4: Optimization of effective elements (Δ38-51 deletion mutation in the MF-αpro region) Mutant construction: Using SP23-pro and FLO10-pro as templates, amino acids 38-51 of MF-αpro were deleted by overlap PCR to obtain the SP23-pro-Δ38-51 and FLO10-pro-Δ38-51 fragments. The mutant fragments were inserted into pHBM905M-GFP according to the procedure in Example 1. After transformation into GS115 to verify positive transformants, expression was induced for 4 days, and the relative fluorescence value was measured.

[0042] The results are as follows Figure 4 The results showed that GFP fluorescence increased by 1.22-fold under the SP23-pro background and by 1.27-fold under the FLO10-pro background, indicating that the deletion can further enhance secretion efficiency.

[0043] In summary, this invention successfully developed a universal modification method based on "direct fusion of the C-terminus of an endogenous signal peptide with the MF-αpro region," obtaining novel secretory signal peptide elements such as SP23-pro and FLO10-pro with high efficiency and no patent barriers. Its high efficiency and universality were verified on various exogenous proteins. Further MF-αpro region deletion mutations can be used for iterative optimization of the elements. This method provides an important new tool for Pichia pastoris expression systems and has broad prospects for industrial application.

[0044] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. An endogenous signal peptide element fused with the MF-αpro region, characterized in that, The endogenous signal peptide element is composed of the C-terminus of the Pichia pastoris endogenous signal peptide fused with the MF-αpro region or the deletion of amino acids 38 to 51 of the MF-αpro region. The Pichia pastoris endogenous signal peptide includes either SP23 signal peptide or FLO10 signal peptide. The amino acid sequence of the SP23 signal peptide is shown in SEQ ID NO:2; The amino acid sequence of the FLO10 signal peptide is shown in SEQ ID NO:4; The amino acid sequence of the MF-αpro region is shown in SEQ ID NO:8; The amino acid sequence of the region missing amino acids 38 to 51 of the MF-αpro region is shown in SEQ ID NO:

10.

2. The endogenous signal peptide element fused with the MF-αpro region according to claim 1, characterized in that, The nucleotide sequence of the SP23 signal peptide is shown in SEQ ID NO:1; The nucleotide sequence of the FLO10 signal peptide is shown in SEQ ID NO:3; The nucleotide sequence of the MF-αpro region is shown in SEQ ID NO:7; The nucleotide sequence of the MF-αpro region missing amino acids 38 to 51 is shown in SEQ ID NO:

9.

3. A recombinant expression vector, characterized in that, The recombinant expression vector comprises a coding sequence for an endogenous signal peptide element encoding the fusion pro region of claim 1 and a coding sequence for an exogenous protein operatively linked to the nucleic acid molecule encoding the endogenous signal peptide element of the fusion pro region.

4. The recombinant expression vector according to claim 3, characterized in that, The framework of the recombinant expression vector includes an upgraded AOX1 promoter, the nucleotide sequence of which is shown in SEQ ID NO: 11; The framework of the recombinant expression vector includes pHBM905M or pPIC9K vectors.

5. The recombinant expression vector according to claim 3, characterized in that, The exogenous protein includes any one of green fluorescent protein, chitinase, and organophosphorus hydrolase.

6. The recombinant expression vector according to claim 5, characterized in that, The nucleotide sequence of the green fluorescent protein is shown in SEQ ID NO:12; The nucleotide sequence of the chitinase is shown in SEQ ID NO:13; The nucleotide sequence of the organophosphorus hydrolase is shown in SEQ ID NO:

14.

7. A recombinant genetically engineered bacterium, characterized in that, The recombinant genetically engineered bacteria comprises the recombinant expression vector according to any one of claims 3 to 6.

8. The recombinant genetically engineered bacterium according to claim 7, characterized in that, The host cell of the recombinant genetically engineered bacteria is Pichia pastoris.

9. A method for constructing a recombinant genetically engineered bacterium according to any one of claims 7 to 8, characterized in that, Includes the following steps: (1) The C-terminus of the nucleotide sequence of the endogenous signal peptide of Pichia pastoris is fused with the nucleotide sequence of the MF-αpro region or the amino acid 38 to 51 of the MF-αpro region to construct an expression fusion signal peptide element. (2) The expression fusion signal peptide element is cloned into an expression vector, and a nucleotide sequence of a foreign protein is inserted downstream of the expression fusion signal peptide element in the expression vector to construct a recombinant expression vector; (3) The recombinant expression vector is transformed into Pichia pastoris host cells to obtain recombinant genetically engineered bacteria.

10. The use of the endogenous signal peptide element fused to the pro region as described in any one of claims 1 to 2, or the recombinant expression vector as described in any one of claims 3 to 6, or the recombinant genetically engineered bacteria as described in any one of claims 7 to 8 in expressing exogenous proteins in Pichia pastoris host cells.