An mlaC knockout mutant strain and its construction method and application

By constructing an mlaC gene knockout mutant strain and secreting MlaC protein, the problem of low coverage of existing vaccines was solved, effective prevention and treatment of hvKP was achieved, the research on pathogenic mechanism was broadened, and a new target was provided for vaccine development.

CN116179451BActive Publication Date: 2025-10-03SHENZHEN PEOPLES HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210526154.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-16
Publication Date
2025-10-03
Estimated Expiration
2042-05-16

AI Technical Summary

Technical Problem

The existing vaccine coverage for Klebsiella pneumoniae (KP) infection is low, especially highly virulent Klebsiella pneumoniae (hvKP), which is difficult to effectively prevent and treat.

Method used

An mlaC gene knockout mutant was constructed by knocking out the mlaC gene in hvKP, and an expression plasmid and vector were constructed to achieve the secretion and expression of the MlaC protein for vaccine preparation.

Benefits of technology

The mlaC gene knockout mutant weakened the growth of hvKP in mouse lungs, reduced the mortality rate, and broadened the research on the pathogenic mechanism of hvKP, providing a theoretical basis for vaccine development. MlaC protein, as a new vaccine target, is conserved and secreted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179451B_ABST
    Figure CN116179451B_ABST
Patent Text Reader

Abstract

This application applies to the field of genetic engineering technology and provides an mlaC knockout mutant strain, its construction method, and application. The mlaC knockout mutant strain is obtained by knocking out the mlaC gene in highly virulent Klebsiella pneumoniae (hvKP). The examples of this application innovatively discovered that hvKP lacking the mlaC gene exhibited reduced lung growth and lung damage in mice, as well as reduced mortality in mice, indicating that the MlaC protein is a key pathogenic factor in hvKP. Furthermore, secretory protein profiling and Western blot results showed that the MlaC protein can be secreted extracellularly and is present in all Klebsiella pneumoniae (KP) strains. Its sequence is conserved, making it a potential new vaccine target for KP. This application broadens research on the pathogenic mechanism of KP and provides a theoretical basis for its prevention and treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the field of genetic engineering technology, and in particular relates to an mlaC knockout mutant strain and a construction method and application thereof. Background Art

[0002] Klebsiella pneumoniae (KP) is a conditionally pathogenic Gram-negative bacterium belonging to the Enterobacteriaceae family. It frequently causes nosocomial infections, including respiratory tract infections, urinary tract infections, abdominal infections, surgical wound infections, and concurrent bacteremia. In recent years, hypervirulent K. pneumoniae (hvKP) has emerged. HvKP is more virulent than classic K. pneumoniae (cKP) and has a higher mortality rate. The main differences between hvKP and cKP are: 1) cKP primarily infects hospitalized patients or immunocompromised individuals, while hvKP can infect healthy individuals without underlying diseases and is invasive; 2) HvKP infection often presents with primary liver abscess as the primary symptom and can metastasize to cause infections in other tissues, including splenic abscess, pneumonia, and endophthalmitis, greatly increasing the mortality rate of the infection and making the diagnosis and treatment of KP infection more difficult.

[0003] It is currently known that KP can use a variety of virulence factors to protect itself from the host immune response, including capsular polysaccharides, lipopolysaccharides, siderophores, flagella, outer membrane proteins and secretory proteins. However, there are still many blind spots in the interaction mechanism between KP and the host, and the relevant key pathogenic factors need to be explored. To date, there is no vaccine against KP infection on the market. Although vaccine approaches based on capsular polysaccharides have been proposed, the high variability of capsular serotypes limits the coverage of vaccines. Recombinant vaccines based on surface-exposed and secreted bacterial antigens are a promising alternative because they are conserved between different serotypes and can enter the immune system. Therefore, the development and popularization of KP vaccines can prevent infection and reduce KP resistance worldwide. Summary of the Invention

[0004] The purpose of the embodiments of the present application is to provide an mlaC gene knockout mutant, aiming to solve the problem of low coverage of existing vaccines against KP infection.

[0005] The embodiment of the present application is achieved by providing an mlaC gene knockout mutant strain, wherein the mlaC gene knockout mutant strain is obtained by knocking out the mlaC gene in hvKP.

[0006] Another object of the present invention is to provide a method for constructing an mlaC gene knockout mutant, comprising:

[0007] A spacer primer is designed inside the mlaC gene, and the spacer primer is phosphorylated and annealed before being ligated to the linearized expression plasmid pSGKP, and then transformed into competent Escherichia coli, and positive strains are selected with kanamycin to obtain the pSGKP-spacer plasmid;

[0008] Amplification primers were designed based on the upstream and downstream sequences of the mlaC gene, and the resulting fragments were amplified by PCR and ligated to obtain an ssDNA repair template.

[0009] The pCas-apr plasmid was electroporated into hvKP competent cells. After induction with L-arabinose, positive clones were screened on LB plates containing apramycin to obtain positive clone competent cells.

[0010] The pSGKP-spacer plasmid and the ssDNA repair template were electroporated into the competent cells of the positive clones, screened using LB double-antibody plates containing apramycin and kanamycin, and cultured overnight to obtain mlaC gene knockout mutants containing the pSGKP-spacer plasmid and the pCas-apr plasmid;

[0011] The pSGKP-spacer plasmid and the pCas-apr plasmid in the mlaC gene knockout mutant containing the pSGKP-spacer plasmid and the pCas-apr plasmid are eliminated to obtain the mlaC gene knockout mutant.

[0012] Another object of the present invention is a method for secreting MlaC protein, comprising:

[0013] Using hvKP genomic DNA as a template, PCR amplify the mlaC gene sequence, add a His tag to the N-terminus of the mlaC gene sequence, and double-digest the amplified PCR product with HindIII and BamHI. Use a PCR product recovery kit to recover the digested DNA fragments for later use.

[0014] The pACYC184 expression vector was double-digested with HindIII and BamHI, and the target band was cut out by agarose gel electrophoresis. The plasmid band was recovered using an agarose gel recovery kit and set aside.

[0015] The DNA fragment and the plasmid band were mixed at a molar ratio of (9-11):1, and T4 ligase was added for ligation to obtain a ligation product;

[0016] The ligation product was transformed into competent E. coli, and positive clones were screened with chloramphenicol to obtain the pACYC184-mlaC plasmid;

[0017] The pACYC184-mlaC plasmid was electroporated into hvKP competent cells, and positive clones of the transformed plasmid were screened with chloramphenicol. Single colonies of the obtained positive clones were placed in LB medium containing chloramphenicol and verified by Western Blot to obtain hvKP overexpressing mlaC.

[0018] The mlaC-overexpressing hvKP and wild-type hvKP were cultured in LB medium with or without chloramphenicol to the logarithmic phase, centrifuged and harvested, and then added to M9 basal medium. After culture for 2 hours, the secreted protein in the culture supernatant was obtained by centrifugation and concentration.

[0019] Another object of the embodiments of the present application is to use the mlaC gene knockout mutant in analyzing the effect of mlaC on hvKP growth and lung inflammation in mice.

[0020] Another object of the embodiments of the present application is to provide an application of the mlaC gene knockout mutant in analyzing the effect of mlaC on the lethality of hvKP.

[0021] Another object of the embodiments of the present application is to use the mlaC gene knockout mutant in preparing a KP vaccine.

[0022] The examples of the present application innovatively discovered that hvKP lacking the mlaC gene had reduced growth in the mouse lungs, reduced lung damage, and reduced hvKP mortality, indicating that mlaC is an important pathogenic factor of hvKP. At the same time, mass spectrometry results and Western blot results showed that the MlaC protein can be secreted extracellularly and is present in all KPs, and its sequence is conserved, so it can serve as a new vaccine target for KP. The present application broadens the research on the pathogenic mechanism of hvKP and provides a theoretical basis for the prevention and treatment of hvKP. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a flowchart of Kp mlaC gene knockout provided in the examples of this application;

[0024] Figure 2 This is a diagram showing the verification results of the mlaC gene knockout mutant provided in the examples of the present application;

[0025] Figure 3 This is a schematic diagram of the effects of mlaC on hvKP growth and lung inflammation in mice provided in the Examples of the present application;

[0026] Figure 4 This is a schematic diagram showing the effect of mlaC on mouse lethality provided in the examples of this application;

[0027] Figure 5 Schematic diagram of the results of Western Blot verification of MlaC protein in the culture supernatant provided in the examples of the present application. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solutions and advantages of this application more clear, the following further describes this application in detail with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not intended to limit this application.

[0029] Kp can produce secretory virulence factors, also known as secretory toxins, especially hvKP. At present, there is little research on secretory toxins. The important role of secretory toxins in the pathogenic process of pathogens makes them an ideal target for vaccine development, and many toxins have been studied in animal models. MlaC is a bacterial phospholipid transport protein that plays an important role in maintaining the asymmetry of phospholipids inside and outside the bacterial cell membrane. The research results of this application show that MlaC protein is a new virulence factor of hvKP. There is currently no literature reporting that it is related to virulence. It can be secreted outside the hvKP cell, and both hvKP and cKP have MlaC protein, and the protein sequence is conserved. Therefore, MlaC is a new vaccine candidate target for KP, providing a theoretical basis for the treatment and prevention of KP.

[0030] The present application embodiment provides an mlaC gene knockout mutant strain, which is obtained by knocking out the mlaC gene in hvKP. The mlaC gene knockout mutant strain ΔmlaC (Klebsiella pneumoniae ATCC 43816ΔmlaC) was deposited on April 2, 2022, at the China Center for Type Culture Collection, Wuhan University, Bayi Road, Hongshan District, Wuhan City, Hubei Province, with a deposit number of CCTCC NO: M2022377.

[0031] The present application also provides a method for constructing an mlaC gene knockout mutant, comprising:

[0032] A spacer primer is designed inside the mlaC gene, and the spacer primer is phosphorylated and annealed before being ligated to the linearized expression plasmid pSGKP, and then transformed into competent Escherichia coli, and positive strains are selected with kanamycin to obtain the pSGKP-spacer plasmid;

[0033] Wherein, the sequence of the spacer primer is shown in SEQ ID NO: 1~2;

[0034] SEQ ID NO: 1: 5'-TAGTTTGCCCCGCTGACCGCCGTCC-3';

[0035] SEQ ID NO: 2: 5'-AAACGGACGGCGGTCAGCGGGCA-3'.

[0036] Amplification primers were designed based on the mlaC gene sequence, and the resulting fragments were amplified by PCR and ligated to obtain an ssDNA repair template.

[0037] Wherein, the sequences of the amplification primers are shown in SEQ ID NOs: 3 to 6:

[0038] SEQ ID NO:3:GCTGATGTTTGGGAATTGAG;

[0039] SEQ ID NO:4: TGATCGGCTGCGCAGAGATCATGGCGACCATGAGTAAGC;

[0040] SEQ ID NO:5: GCTTACTCATGGTCGCCATGATCTCTGCGCAGCCGATCA;

[0041] SEQ ID NO:6: CATCGAACATCTCACCCACA.

[0042] The pCas-apr plasmid was electroporated into hvKP competent cells. After induction with L-arabinose, positive clones were screened on LB plates containing apramycin to obtain positive clone competent cells.

[0043] The pSGKP-spacer plasmid and the ssDNA repair template were electroporated into the competent cells of the positive clones, screened using LB double-antibody plates containing apramycin and kanamycin, and cultured overnight to obtain mlaC gene knockout mutants containing the pSGKP-spacer plasmid and the pCas-apr plasmid;

[0044] The pSGKP-spacer plasmid and the pCas-apr plasmid in the mlaC gene knockout mutant containing the pSGKP-spacer plasmid and the pCas-apr plasmid are eliminated to obtain the mlaC gene knockout mutant.

[0045] In an embodiment of the present application, the step of eliminating the pSGKP-spacer plasmid and the pCas-apr plasmid in the mlaC gene knockout mutant containing the pSGKP-spacer plasmid and the pCas-apr plasmid to obtain the mlaC gene knockout mutant comprises:

[0046] The mlaC gene knockout mutant containing the pSGKP-spacer plasmid and the pCas-apr plasmid was placed in LB liquid medium without antibiotics, cultured to the logarithmic phase, and then streaked on an LB plate containing sucrose and cultured until a single colony was produced;

[0047] Single colonies were selected and streaked on LB plates with or without apramycin and kanamycin. Single colonies that grew only on LB plates without antibiotics were selected and PCR was used to verify whether the knockout was successful, thereby obtaining mlaC gene knockout mutants.

[0048] The present application also provides a method for secreting MlaC protein, comprising:

[0049] Using hvKP genomic DNA as a template, PCR amplify the mlaC gene sequence, add a His tag to the N-terminus of the mlaC gene sequence, and double-digest the amplified PCR product with HindIII and BamHI. Use a PCR product recovery kit to recover the digested DNA fragments for later use.

[0050] The sequences of the amplification primers used are shown in SEQ ID NOs: 7-8;

[0051] SEQ ID NO:7: CCCAAGCTTGCTGGGCGAGCAGTACCT;

[0052] SEQ ID NO: 8: CGCGGATCCTTAATGGTGATGGTGATGATGTTTTTTCTGTTCCAGGGTG.

[0053] The pACYC184 expression vector was double-digested with HindIII and BamHI, and the target band was cut out by agarose gel electrophoresis. The plasmid band was recovered using an agarose gel recovery kit and set aside.

[0054] The DNA fragment and the plasmid band were mixed at a molar ratio of (9-11):1, and T4 ligase was added for ligation to obtain a ligation product;

[0055] The ligation product was transformed into competent E. coli, and positive clones were screened with chloramphenicol to obtain the pACYC184-mlaC plasmid;

[0056] The pACYC184-mlaC plasmid was electroporated into hvKP competent cells, and positive clones of the transformed plasmid were screened with chloramphenicol. Single colonies of the obtained positive clones were placed in LB medium containing chloramphenicol and cultured overnight. The cells were verified by Western Blot to obtain hvKP overexpressing mlaC.

[0057] The mlaC-overexpressing hvKP and wild-type hvKP were cultured in LB medium with or without chloramphenicol to the logarithmic phase, centrifuged and harvested, and then added to M9 basal medium. After culture for 2 hours, the secreted protein in the culture supernatant was obtained by centrifugation and concentration.

[0058] The secretory proteins of the hvKP overexpressing MlaC were detected by Western Blot to determine the presence of MlaC protein. The secretory proteins in the supernatant of wild-type hvKP were sent to Huiye Biotechnology Co., Ltd. for mass spectrometry identification to determine the presence of MlaC protein.

[0059] The present application also provides an application of the above-mentioned mlaC gene knockout mutant in analyzing the effect of mlaC on hvKP growth and lung inflammation in mice.

[0060] The present application also provides an application of the above-mentioned mlaC gene knockout mutant in analyzing the effect of mlaC on the lethality of hvKP.

[0061] The present application also provides an example of a use of the above-mentioned mlaC gene knockout mutant in preparing a Kp vaccine.

[0062] The mlaC knockout mutant strain of the present application, its construction method, and application are further described below in conjunction with specific examples. However, the specific implementation methods mentioned in these examples are merely enumerated explanations of the technical solutions of the present application and are not intended to limit the scope of implementation of the present application. Any improvements or substitutions based on the above principles and on the basis of the present application should fall within the scope of protection of the present application.

[0063] Example 1

[0064] 1. Preparation of hvKP Competent Cultures

[0065] a) Pick a single hvKP colony from the plate and transfer it to 5 mL of LB medium and culture overnight;

[0066] b) The next morning, transfer the culture to 100 mL of LB medium and continue incubating for 3-4 hours. When the OD600 concentration reaches approximately 0.8, remove the culture from the shaker and place on ice until ready to use.

[0067] c) Harvest the cells by centrifugation at 4000 rpm for 10 min at 4°C, discard the supernatant, and wash three times with 10 mL of 10% glycerol.

[0068] d) Finally, resuspend the solution in 1 mL of 10% glycerol, aliquot 200 μL into each tube, and freeze at -80°C until ready to use.

[0069] Construction of mlaC gene knockout mutant (experimental flow chart see Figure 1 )

[0070] a) Design spacer sequences within the mlaC gene: mlaC-SF: 5'-TAGTTGCCCCGCTGACCGCCGTCC-3' (SEQ ID NO: 1); mlaC-SR: 5'-AAACGGACGGCGGTCAGCGGGGCA-3' (SEQ ID NO: 2). Primers were synthesized by Sangon Biotechnology. The primers were phosphorylated, annealed, and ligated into the linearized expression plasmid pSGKP. The plasmid was then transformed into competent E. coli DH5α cells and positive strains were selected with kanamycin. The pSGKP-spacer plasmid was isolated.

[0071] b) Select two sequences on either side of the mlaC gene sequence and design primers:

[0072] mlaC-P1:GCTGATGTTTGGGAATTGAG; (SEQ ID NO:3)

[0073] mlaC-P2: TGATCGGCTGCGCAGAGATCATGGCGACCATGAGTAAGC; (SEQ ID NO: 4)

[0074] mlaC-P3: GCTTACTCATGGTCGCCATGATCTCTGCGCAGCCGATCA; (SEQ ID NO: 5)

[0075] mlaC-P4:CATCGAACATCTCACCCACA; (SEQ ID NO:6)

[0076] By PCR amplification, two target fragments were obtained, an upstream fragment of 642 bp and a downstream fragment of 600 bp. The two sequences were connected to form a 1222 bp ssDNA repair template;

[0077] c) Electroporate the pCas-apr plasmid into KP competent cells. Add 0.2 g L-arabinose per 100 mL of bacterial culture for induction and screen for positive clones using LB plates containing apramycin. Prepare competent cells for positive clones and electroporate them into the constructed pSGKP-spacer plasmid and 300 μM ssDNA repair template. Select using LB plates containing apramycin and kanamycin. Incubate overnight at 30°C. Confirm knockout success by PCR and sequencing.

[0078] d) Select the successfully knocked-out bacteria and transfer them to antibiotic-free LB liquid medium and culture until the logarithmic phase. Streak the bacteria onto LB plates containing 5% sucrose and culture at 37°C until single colonies are formed. Select single colonies and streak them onto LB plates with or without apramycin and kanamycin. Select the single colony that can only grow on the antibiotic-free plate and verify the knockout success using PCR. Finally, the mlaC gene knockout mutant ∆mlaC was obtained. Verification primers: F: GCTGATGTTTGGGAATTGAG, R: CATCGAACATCTCACCCACA; verification results are shown in the table. Figure 2 The results showed that the mlaC gene was successfully knocked out.

[0079] Example 2 Effects of the virulence factor mlaC on hvKP growth and lung inflammation in mice

[0080] a) hvKP wild-type WT and mlaC knockout mutant ΔmlaC were cultured overnight and transferred once the next morning. When the OD600 of the culture solution reached approximately 1.0, 1 mL of the culture solution was taken from each sample and centrifuged at 6000 rpm for 3 min.

[0081] b) Discard the supernatant, add 1 mL of PBS, and centrifuge at 6000 rpm for 3 min. Repeat this step three times.

[0082] c) Finally, resuspend the culture in 2 mL of PBS and adjust the OD600 to 0.5, which results in a bacterial concentration of approximately 5 × 108 CFU / mL. Then, serially dilute the culture to 3 × 106 CFU / mL and set aside.

[0083] d) Prepare 18 6-7 week old C57BL / 6 mice and divide them into WT, ΔmlaC, and PBS infection groups, with 6 mice in each group. After isoflurane anesthesia, inoculate the mice with 30 μL (approximately 1×105 CFU) of the bacterial solution from step c) via intranasal instillation. The control group receives 30 μL of PBS.

[0084] e) 24 hours after infection, the lungs, livers, and spleens of the mice were harvested and the bacterial counts in these organs were determined using a plate count method;

[0085] f) At the same time, the left lung of each mouse was removed, fixed with 4% paraformaldehyde, and sent to Wuhan Sevier Biotechnology Co., Ltd. for HE staining to detect lung inflammation in the mice.

[0086] The experimental results are as follows Figure 3 As shown, Figure 3The figure shows the effect of the virulence factor mlaC on the growth of hvKP in mice and lung inflammation, among which, a. Effect of mlaC on the growth of hvKP in the lungs, liver and spleen of mice, *: p<0.05; b. Effect of mlaC on lung inflammation, arrows indicate neutrophils; the results showed that the absence of mlaC significantly reduced the bacterial load of hvKP in the lungs and spleen of mice, and had no effect on the growth in the liver, indicating that mlaC has an important effect on the growth of hvKP in mice. HE staining results showed that the absence of mlaC reduced the lung inflammation of mice, thereby reducing the damage of hvKP to the lungs, indicating that mlaC is an important virulence factor of hvKP.

[0087] Example 3 Effect of virulence factor mlaC on the lethality of hvKP

[0088] a) hvKP wild-type WT and mlaC knockout mutant ΔmlaC were cultured overnight and transferred once the next morning. When the OD600 of the culture solution reached approximately 1.0, 1 mL of each culture solution was taken and centrifuged at 6000 rpm for 3 min.

[0089] b) Discard the supernatant, add 1 mL of PBS, and centrifuge at 6000 rpm for 3 min. Repeat this step three times.

[0090] c) Finally, resuspend the culture in 2 mL of PBS and adjust the OD600 to 0.5, which results in a bacterial concentration of approximately 5 × 108 CFU / mL. Then, serially dilute the culture to 3 × 106 CFU / mL and set aside.

[0091] d) Prepare 18 6-7 week old C57BL / 6 mice and divide them into WT, ΔmlaC, and PBS infection groups, with 6 mice in each group. After isoflurane anesthesia, inoculate the mice with 30 μL (approximately 1×105 CFU) of the bacterial solution from step c) via intranasal instillation. The control group receives 30 μL of PBS.

[0092] e) Observe and record the health status of mice in each group every day.

[0093] The experimental results are as follows Figure 4 As shown, Figure 4 The effect of mlaC on the lethality of mice is shown (***: p<0.001). The results show that the absence of mlaC significantly reduces the lethality of hvKP in mice, indicating that mlaC is an important virulence factor of hvKP.

[0094] Example 4 Secretion of virulence factor MlaC protein

[0095] a) Using hvKP genomic DNA as a template, PCR amplify the nucleotide sequence of mlaC, and add a His tag to the N-terminus of the mlaC sequence. The amplification primers are F: CCCAAGCTTGCTGGGCGAGCAGTACCT (SEQ ID NO: 7) and R: CGCGGATCCTTAATGGTGATGGTGATGATGTTTTTTCTGTTCCAGGGTG (SEQ ID NO: 8). The amplified PCR product is double-digested with HindIII and BamHI. The digested DNA fragment is recovered using a PCR product recovery kit and set aside.

[0096] b) Double-digest the pACYC184 expression vector with HindIII and BamHI, perform electrophoresis on a 1% agarose gel, excise the target band, and recover the plasmid band using an agarose gel recovery kit for later use;

[0097] c) mixing the recovered products of step a) and step b) at a molar ratio of about 10:1, adding T4 ligase, and ligating at 25° C. for 1 h;

[0098] d) Transform the ligation product into competent E. coli DH5α, screen for positive clones with 50 μg / mL chloramphenicol, and verify the pACYC184-mlac plasmid obtained by sequencing.

[0099] e) The constructed pACYC184-mlaC plasmid was electroporated into the hvKP competent cell and positive clones were screened with 50 μg / mL chloramphenicol.

[0100] f) Pick a single colony from the positive clone and place it in 5 mL of LB medium containing 50 μg / mL chloramphenicol and culture overnight.

[0101] g) Harvest the cells by centrifugation at 6000 rpm for 5 min, discard the supernatant, lyse the cells with lysis buffer containing protease inhibitors, centrifuge at 12000 rpm for 15 min at 4°C, carefully aspirate the supernatant, and set aside.

[0102] h) Take 40 μL of the protein extracted in the previous step and add 10 μL of SDS-PAGE loading buffer, mix well, and boil at 100°C for 10 minutes. Detect the expression of MlaC protein by Western Blot. The strain that successfully overexpresses MlaC protein should be kept for future use.

[0103] i) hvKP cells overexpressing the MlaC protein were selected and cultured overnight in LB medium containing 50 μg / mL chloramphenicol;

[0104] j) The next morning, transfer the bacterial suspension to 100 mL of LB medium containing 50 μg / mL chloramphenicol. When the OD600 of the suspension reaches approximately 1.0, centrifuge at 6000 rpm for 10 minutes to harvest the cells. Wash twice with PBS, then resuspend in 100 mL of M9 medium and shake at 37°C for 2 hours.

[0105] k) Centrifuge at 6000 rpm for 10 min at 4°C, collect the supernatant (approximately 100 mL), and filter again through a 0.22 μm filter membrane.

[0106] l) Concentrate the supernatant to 1 mL using a 10 kDa ultrafiltration concentrator. Take 40 μL of the concentrated supernatant protein and add 10 μL of SDS-PAGE loading buffer. Mix well and boil at 100°C for 10 min. Detect the presence of MlaC protein in the supernatant by Western Blot.

[0107] The experimental results are as follows Figure 5 As shown, the results show that MlaC protein can be secreted from bacteria.

[0108] Example 5 Identification of the hvKP Secretome

[0109] a) Pick a single hvKP colony and culture it in 5 mL of LB medium overnight;

[0110] b) In the morning, transfer the cells to 100 mL of LB medium. When the OD600 of the culture solution reaches approximately 1.0, centrifuge at 6000 rpm for 10 minutes to harvest the cells. Wash twice with PBS, then resuspend in 100 mL of M9 medium and shake at 37°C for 2 hours.

[0111] c) Centrifuge at 6000 rpm for 10 min at 4°C, collect the supernatant (approximately 100 mL), and filter again through a 0.22 μm filter membrane.

[0112] d) Concentrate the aliquot to 1 mL using a 10 kDa ultrafiltration concentrator and send it to the company for protein profiling. Protein profiling is used to detect the secretory proteome of hvKP and analyze the presence of MlaC protein in the supernatant.

[0113] Through mass spectrometry identification, a total of 782 proteins were identified in the hvKP culture supernatant, including MlaC, further indicating that MlaC protein can be secreted from bacteria.

[0114] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person of ordinary skill in the art may make various modifications and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

[0115] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent replacements and improvements made within the spirit and principles of the present application should be included in the scope of protection of the present application. Sequence Listing <110> Shenzhen People's Hospital <120> An mlaC knockout mutant strain and its construction method and application <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty four <212> DNA <213> Artificial Sequence <400> 1 tagttgcccc gctgaccgcc gtcc 24 <210> 2 <211> twenty four <212> DNA <213> Artificial Sequence <400> 2 aaacggacgg cggtcagcgg ggca 24 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gctgatgttt gggaattgag 20 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <400> 4 tgatcggctg cgcagagatc atggcgacca tgagtaagc 39 <210> 5 <211> 39 <212> DNA <213> Artificial Sequence <400> 5 gcttactcat ggtcgccatg atctctgcgc agccgatca 39 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 catcgaacat ctcacccaca 20 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <400> 7 cccaagcttg ctgggcgagc agtacct 27 <210> 8 <211> 49 <212> DNA <213> Artificial Sequence <400> 8 cgcggatcct taatggtgat ggtgatgatg ttttttctgt tccagggtg 49

Claims

1. A mlaC A gene knockout mutant, characterized in that described mlaC Knockout mutants were generated by knocking out mlaC The gene was obtained from the Chinese Center for Type Culture Collection with the deposit number CCTCC NO: M 2022377.

Citation Information

Patent Citations

  • Linearized DNA vector pHB-1 plasmid and test kit prepared from same and used for editing bacterial genomes

    CN111139258A

  • Lipid transport protein inhibitor, application thereof and antibacterial drug

    CN111632148A