Application of CmEAF7 gene in improving cold tolerance and / or fruit quality of melon

Abstract

The present invention discloses the application of CmEAF7 gene in improving cold tolerance and / or fruit quality of melon, wherein the nucleotide sequence of the CmEAF7 gene is shown in SEQ ID NO.1, and the improvement of melon fruit quality is to increase the content of sucrose and fructose in melon fruit. The present invention silences the CmEAF7 gene, and by comparing the cold tolerance phenotype difference between the silenced plant and the negative control before and after cold treatment and the change of ion permeability, it is clear that the CmEAF7 gene can positively regulate the cold tolerance of melon seedlings; in addition, overexpression of the CmEAF7 gene can increase the content of fructose and sucrose in melon fruit, and conversely, silencing the CmEAF7 gene can reduce the content of fructose and sucrose in melon fruit. It can be seen that the CmEAF7 gene plays an important role in improving the cold tolerance of melon and / or the content of fructose and sucrose in fruit, and has potential application value in the coordinated improvement of low temperature resistance and high quality of melon.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology breeding, and specifically relates to the application of a CmEAF7 gene in improving cold tolerance and / or fruit quality of melons. Background Art

[0002] Low temperature and chilling damage is one of the important abiotic stresses that endanger agricultural production. It not only affects the normal growth and development of crops, but also causes irreversible damage to yield and quality. Melon (Cucumis melo L.) is a typical thermophilic crop with an optimal growth temperature between 25-35°C. It is extremely sensitive to low temperatures, especially during the seedling stage. Low temperature and chilling damage is one of the main abiotic stresses that restricts melon production in my country. "Late spring cold" can easily cause melons to encounter chilling damage stress during seedling breeding and early planting, seriously affecting the normal growth of seedlings. At the same time, it is easy to cause a series of problems such as extended seedling development, delayed planting, extended fruiting period, and decreased quality and yield, reducing the production efficiency of the melon industry.

[0003] As an important economic horticultural crop, melon is rich in nutrition and has a sweet taste. It is loved by consumers and is widely planted all over the world. Unlike field crops, the fruit quality of melon has a significant impact on the melon industry. The quality is determined by the combined effects of soluble sugars, organic acids, amino acids, aroma, carotenoids, ascorbic acid, etc. Among them, the type and content of soluble sugars and organic acids directly determine the taste and flavor of the fruit.

[0004] Stress resistance and high quality have always been two important goals of agricultural breeding. Plants are susceptible to a variety of hazards during their growth period, including biotic and abiotic stresses. Faced with the trade-off between survival and growth and development, plants adapt and respond to stress through complex regulatory mechanisms, but this often has an adverse effect on plant growth, development, quality of product organs and yield. Therefore, exploring genes that balance quality and stress has important application value for breeding high-quality new stress-resistant varieties. "Traditional" trade-off genes often have an adverse effect on plant growth, development, quality or yield while enhancing the biotic and abiotic resistance of plants. Therefore, most people in production believe that "variety with good quality has weak resistance, and variety with strong resistance has poor quality". In recent years, more and more studies have discovered some "ideal" trade-off genes that can improve stress resistance without affecting growth, development and yield. These may be "ideal" genes in future breeding.

[0005] The CmEAF7 involved in the present invention is a subunit of histone H4 acetyltransferase, and the functional research of the homologous gene of this gene in plants has rarely been reported. The present invention first discovered that the CmEAF7 gene has important application value in improving the cold tolerance of melon seedlings and the fruit quality, and may become one of the "ideal type" genes in low temperature tolerance and high-quality breeding of melons, with very broad application prospects. It is of great significance to study the influence of genes on the cold tolerance and fruit quality of melons from a molecular level. Summary of the invention

[0006] The purpose of the present invention is to provide an application of the CmEAF7 gene in improving the cold tolerance and / or fruit quality of melon.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is summarized as follows:

[0008] The CmEAF7 gene used in the present invention has a nucleotide sequence as shown in SEQ ID NO.1, or is a derivative gene having the same function as the nucleotide sequence shown in SEQ ID No.1 by substitution, deletion and / or addition of one or more nucleotides.

[0009] The protein encoded by the CmEAF7 gene is selected from:

[0010] (1) whose amino acid sequence is shown in SEQ ID NO.2; (2) a protein derived from (1) which is formed by substituting, deleting or adding one or more (e.g., 1-30; preferably 1-20; more preferably 1-10; such as 5, 3) amino acid residues in the amino acid sequence of SEQ ID NO.2 and has the function of the protein of (1); or

[0011] (3) A protein derived from (1) that has 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the protein sequence defined in (1) and has the function of the protein of (1).

[0012] That is to say, the functions of the genes protected by the present invention include not only the above-mentioned CmEAF7 gene, but also the functions of homologous genes with higher homology to SEQID NO.1 (such as higher than 80%; preferably higher than 90%; preferably higher than 95%; more preferably higher than 98%) in improving plant cold tolerance and / or fruit quality.

[0013] The nucleotide sequence is 381 bp as shown in SEQ ID No.1, which is a CDS sequence. Its gene encodes a protein of 126 amino acids, and the sequence is shown in SEQ ID No.2.

[0014] The present invention also constructs a series of plant expression vectors, and the expression vectors, recombinant vectors or transgenic plant lines containing the above-mentioned genes and the host cells containing the vectors also fall within the protection scope of the present invention.

[0015] The biological function of the CmEAF7 gene disclosed in the present invention in improving plant cold tolerance and / or fruit quality, the low temperature tolerance is manifested as: after low temperature treatment (4°C), the cold tolerance of seedlings of the CmEAF7 gene silenced strain is lower than that of the wild type; the fruit quality is manifested as: the sucrose and fructose contents of the fruits of the CmEAF7 gene silenced strain are lower than those of the control; while the sucrose and fructose contents of the fruits of the CmEAF7 overexpressed strain are higher than those of the control.

[0016] According to its function, cold-resistant and high-quality plants can be obtained through transgenic means. Specifically, by introducing the CmEAF7 gene into the target plant, a transgenic plant can be obtained, which has higher cold resistance and quality than the target plant.

[0017] Specifically, the CmEAF7 gene can be introduced into the target plant through the recombinant expression vector. In the method, the recombinant expression vector can be used to transform plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants.

[0018] In order to improve the excellent traits of plants, the present invention also protects a new plant breeding method, which is the following (1) or (2):

[0019] (1) By increasing the activity of CmEAF7 protein in the target plant, a plant having low temperature tolerance and / or fruit quality better than the target plant is obtained;

[0020] (2) Promoting the expression of the CmEAF7 gene in the target plant to obtain a plant with low temperature tolerance and / or fruit quality better than that of the target plant;

[0021] The implementation method of “promoting the expression of CmEAF7 gene in target plants” can be as follows (1) or (2) or (3):

[0022] (1) Introducing the CmEAF7 gene into target plants;

[0023] (2) introduction of strong promoters and / or enhancers;

[0024] (3) Other common methods in this field.

[0025] Among them, the target plant, the target plant described in the present invention is melon.

[0026] Target gene, also known as target gene, is a gene used for gene recombination, changing the characteristics of receptor cells and obtaining the expected expression product in genetic engineering design and operation. It can be from the organism itself or from a different organism.

[0027] In order to study the function of the gene, the method of "inhibiting the expression of the CmEAF7 gene in the target plant" is sometimes used. The method of "inhibiting the expression of the CmEAF7 gene in the target plant" is to knock out, silence or target mutate the CmEAF7 gene.

[0028] The knockout includes knocking out the CmEAF7 gene using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 technology to obtain a transgenic plant strain. The present invention obtains a silent strain by silencing the CmEAF7 gene to verify that the seedling cold tolerance of the silent strain is lower than that of the wild type, and the sucrose and fructose content of the fruit of the CmEAF7 gene silenced strain is lower than that of the control, indicating that the CmEAF7 gene can positively regulate the cold tolerance of melon seedlings and the sucrose and fructose content of the fruit.

[0029] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants, or forestry plants, etc. The plants can be, for example (but not limited to): dicotyledons, monocotyledons or gymnosperms.

[0030] As a preferred embodiment, the "plant" includes but is not limited to melon, and any plant having the gene or a gene homologous thereto is applicable.

[0031] The "plant" mentioned in the present invention includes the whole plant, its parent and progeny plants and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues and organs, and our target gene or nucleic acid is present in these different parts. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen and microspores, and similarly, each of the aforementioned objects contains the target gene / nucleic acid.

[0032] The present invention includes any plant cell, or any plant obtained or obtainable by the method therein, and all plant parts and propagules thereof. This patent also includes transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and the progeny obtained using the method of this patent have the same characteristics.

[0033] The invention also extends to the harvestable parts of the plants as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also further relates to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starch or proteins. The invention also relates to foods or food additives obtained from the relevant plants.

[0034] Advantages of the present invention:

[0035] The present invention uses VIGS technology to silence the CmEAF7 gene in three melon materials respectively to obtain positive silenced plants. First, the total RNA of the leaves of the positive plants was extracted and cDNA was obtained by reverse transcription, and further fluorescence quantitative PCR was used to prove that the expression level of the CmEAF7 gene in the silenced plants was significantly reduced. Secondly, the silenced plants and the negative controls were further cold-treated, and by comparing the cold tolerance phenotypic differences between the silenced plants and the negative controls before and after the cold treatment and the changes in ion permeability, it was clarified that CmEAF7 can positively regulate the cold tolerance of melon seedlings. The results in the three melon materials were highly consistent, indicating that the CmEAF7 gene has important application value in the molecular breeding of melon low temperature resistance.

[0036] The present invention also uses transient transformation technology to transiently overexpress and silence the fruits of two melon materials during the critical period of sugar accumulation in melon fruits. Fluorescence quantitative PCR proves that the expression of the CmEAF7 gene increases significantly after transient overexpression, while the expression of the CmEAF7 gene in the transient silence sample decreases significantly. The changes in sucrose and fructose content at different time points of overexpression and silencing are further detected using a plant sucrose and fructose content detection kit, confirming that overexpression of CmEAF7 can increase the fructose and sucrose content in melon fruits, while silencing CmEAF7 can reduce the fructose and sucrose content in melon fruits.

[0037] The present invention provides an application of the CmEAF7 gene in improving the cold tolerance of melon seedlings and the fruit quality. Overexpression of the CmEAF7 gene can simultaneously improve the cold tolerance of melon seedlings and increase the sucrose and fructose content in melon fruits. The invention has potential application value in the coordinated improvement of low temperature tolerance and high quality of melon.

[0038] Plants resistant to low temperatures and / or of high quality can be obtained through genetic modification. Specifically, the CmEAF7 gene can be introduced into the target plant to obtain a transgenic plant, which has higher cold tolerance and quality (high sucrose and fructose content) than the target plant, providing a new approach to breeding plants resistant to low temperatures and / or of high quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 is the expression level of CmEAF7 gene in leaves of VIGS-silenced plants;

[0040] Figure 2 It is the cold tolerance identification of HH09, HH14 and H581 CmEAF VIGS silenced plants and negative controls;

[0041] Figure 3 is the comparison of ion permeation before and after cold treatment of CmEAF7 gene silenced plants of HH09, HH14 and H581 and negative control;

[0042] Figure 4 is the expression level of CmEAF7 gene in some samples after transient overexpression and silencing in HH14 and H581 fruits;

[0043] Figure 5 It is the determination of sucrose and fructose content in samples after transient overexpression and silencing in HH14 and H581 fruits. DETAILED DESCRIPTION

[0044] The present invention will be described in detail below through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0045] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained through commercial channels.

[0046] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0047] Unless otherwise indicated, the present invention will be practiced using conventional botanical techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination and bioinformatics techniques that are apparent to those skilled in the art. These techniques are fully explained in the published literature and can be achieved using methods disclosed in the existing literature, except for the methods used in the following examples.

[0048] The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences of non-coding regions, but are not limited to these. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include a coding sequence in a cDNA, and / or include a cDNA and its regulatory sequences. In specific embodiments, such as with respect to an isolated nucleic acid sequence, it is preferably assumed to be cDNA.

[0049] Example 1 Cloning of CmEAF7 gene

[0050] Using the cDNA of melon material HH09 as a template, the full length CDS (381 bp) was amplified by primers CmEAF7-F1 (ACGGGGGACTCTTGACCATGGTAATGGAAAGCGGCGGC containing a vector linker) and CmEAF7-R1 (AAGTTCTTCTCCTTTACTAGTTTAAGACTCTTCTTTGACGAAGAAG containing a vector linker), and the sequence is shown in SEQ ID NO.1. The pCAMBIA1302 vector was double-digested with Nco I and Spe I restriction endonucleases, and the product was purified after digestion at 37°C for 1 hour. The 381 bp CDS full length of CmEAF7 was homologously recombined with the linearized pCAMBIA1302 vector fragment by homologous recombination. The recombinant product was transferred into Escherichia coli competent cells DH5α by heat shock method. After growing on LB plates containing kanamycin resistance for 12 hours, several single clones were picked for expansion culture, and positive detection was performed using CaMV35s universal primers. The positive clones were sequenced by first generation sequencing, which showed that the CDS sequence of CmEAF7 in HH09 was completely consistent with the reference genome (DHL92), as shown in SEQ ID NO.1, and the amino acid sequence encoded by it was shown in SEQ ID NO.2.

[0051] Example 2 Verification of the function of CmEAF7 gene in positively regulating cold tolerance in melon seedlings

[0052] (I) Construction of CmEAF7 gene VIGS expression vector

[0053] Using the cDNA of melon material HH09 as a template, the specific fragment (269 bp) was amplified by primers CmEAF7-F2 (TGTTTTAAATGCCTTTACGTAAGAACAAGACGGCATTTCTG containing a vector linker) and CmEAF7-R2 (AACACACAAAACACCTACGTAGCTTCAGCATCTCCAGGTTA containing a vector linker), and the sequence is shown in SEQ ID NO.3. The TRSV2 vector was single-digested with SnaB I restriction endonuclease, and the product was purified after digestion at 37°C for 2 hours. The 269 bp specific fragment of CmEAF7 was homologously recombined with the linearized TRSV2 vector fragment by homologous recombination. The recombinant product was transferred into the competent E. coli cell DH5α by heat shock method. After growing on the LB plate containing kanamycin resistance for 12 hours, several single clones were picked for expansion culture, and TRSV2-F (TGCGTCGCACTGAGGCA) and TRSV2-R (GCAGCTGACAGACAGACA) universal primers for TRSV2 vector were used for positive detection. After the positive clones were sequenced correctly, the plasmid was extracted and further transferred into the competent Agrobacterium cell GV3101. After growing on the LB plate containing kanamycin and rifampicin resistance for 48 hours, TRSV2-F and TRSV2-R primers were used again for positive identification. The TRSV2-CmEAF7 recombinant bacterial solution was stored in 15% glycerol and stored at -80°C for future use.

[0054] (II) CmEAF7 gene silenced plants

[0055] The seeds of HH09, HH14 and H581 were soaked in warm water (55°C, 30min), the seed coat was peeled off, and the seeds were sown on 1 / 2MS medium after disinfection. After the roots were 1-2cm long, they were used for infection. While sowing, the bacterial solution for infection was prepared. TRSV1, TRSV2 and TRSV2-CmEAF7 Agrobacterium bacterial solution was streaked on LB plates containing kanamycin (100mg / L) and rifampicin (50mg / L) resistance in advance. Single clones were picked and shaken with LB containing kanamycin (100mg / L) and rifampicin (50mg / L) resistance. An appropriate amount of bacterial solution was shaken with LB containing kanamycin (50mg / L) and AS (15μM). When OD 600 When the OD was 0.8-1.0, the bacterial solution was collected in a clean bench, centrifuged at 5000rpm for 5min, and the supernatant was discarded. The cells were resuspended in a resuspension solution (sterile, pH 5.8) containing 4.43g / L MS, 30g / L sucrose, 100μM AS (acetosyringone) and 1.25mM MES, and the OD was adjusted. 600The resuspended bacterial solution of TRSV1 was mixed with the resuspended bacterial solution of TRSV2 and TRSV2-CmEAF7 in equal proportions, and cultured in a dark incubator at 25°C for 2-3 hours before use for subsequent infection.

[0056] In a clean bench, cut a knife at the distal end of the cotyledon with a root length of 1-2 cm (to facilitate further infection of Agrobacterium from the wound), and put it into the resuspended bacterial solution of TRSV1+TRSV2 and TRSV1+TRSV2-CmEAF7 respectively, and vacuum at -0.9MPa for 5 minutes to allow the bacterial solution to penetrate from the root and cotyledon wounds for infection. After absorbing the bacterial solution on sterile filter paper, place it on co-culture medium (4.43g / L MS, 30g / L sucrose, 100μM AS, 1.25mM MES and 8g / L agar, pH 5.8), and co-cultivate at 25℃ in the dark for 4 days. Transplant it into a nutrient pot and place it in an artificial climate box at 25℃ with 16h light / 8h dark for cultivation.

[0057] (III) Identification of CmEAF7 gene expression in silenced plants

[0058] The expression of CmEAF7 gene in silenced plants was identified at the stage of three leaves and one heart. The third true leaf sample was taken and the total RNA of the sample was extracted using the All-Gold RNA Extraction Kit (Code#ET101-01). The All-Gold Reverse Transcription and Fluorescence Quantification Kit (Code#AUQ-01) was used for reverse transcription and real-time fluorescence quantitative PCR, respectively. The specific experimental operation was carried out according to the instructions of the kit. The expression of VIGS silenced plants is shown in Figure 1 shown.

[0059] (IV) Identification of CmEAF7 gene function

[0060] (1) Cold resistance assessment after low temperature treatment

[0061] A 4℃ cold treatment experiment was conducted on the three-leaf, one-heart CmEAF7 VIGS silenced plants (TRSV2-CmEAF7) and the negative control (TRSV2). Samples were taken for the determination of physiological indicators 16 hours after the cold treatment. At the same time, different degrees of cold treatment were carried out according to the differences in the cold tolerance of HH09, HH14 and H581 melon seedlings. Among them, the CmEAF7 silenced plants and negative controls of HH14 material were recovered and cultured at 25℃ for 96 hours after the 4℃ cold treatment for 60 hours; the CmEAF7 silenced plants and negative controls of HH09 and H581 materials were recovered at 25℃ for 6 hours after the 4℃ cold treatment for 60 hours, and then continued to be treated at 0℃ for 48 hours before being recovered and cultured at 25℃ for 96 hours. The results showed that after silencing CmEAF7, the degree of chilling damage of HH09, HH14 and H581 seedlings was significantly higher than that of the corresponding negative controls, that is, the cold tolerance was reduced ( Figure 2 ).

[0062] (2) Determination of ion permeability

[0063] The ion permeation of the materials grown at room temperature, the CmEAF7 silenced plants treated at 4°C for 16 h, and the negative control was measured (the results are shown in Figure 3 ). Add 8 ml of deionized water to a 15 ml centrifuge tube, place the 6 leaf discs from the first true leaf in it, shake at 200 r / min for 15 min at room temperature, and measure the conductivity S1. Boil the 15 ml centrifuge tube in a water bath at 100 ° C for 20 min, then shake at 200 r / min for 20 min in a shaker, and measure the conductivity S2 after the liquid cools to room temperature. The conductivity of the blank control containing only deionized water is recorded as S0, and the ion permeation is calculated according to the following formula:

[0064] Ion permeation amount (%) = (S1-S0) / (S2-S0)*100.

[0065] In summary, we found that after silencing the CmEAF7 gene, the cold tolerance of HH09, HH14 and H581 seedlings decreased. Further comparison of the changes in ion permeability between the silenced plants (TRSV2-CmEAF7) and the negative control (TRSV2) before and after cold treatment showed that the ion permeability of the silenced plants (TRSV2-CmEAF7) after cold treatment was significantly higher than that of the negative control (TRSV2), indicating that the cold tolerance of the plants decreased, indicating that the CmEAF7 gene can positively regulate the cold tolerance of melon seedlings ( Figure 2 and 3 ).

[0066] Example 3 Functional verification of the positive regulation of sucrose and fructose content in melon by CmEAF7 gene

[0067] (1) Construction of CmEAF7 gene transient overexpression vector

[0068] Using the cDNA of melon material HH09 as a template, the full-length sequence of CmEAF7CDS (378 bp, excluding the stop codon) was amplified by primers CmEAF7-F3 (TCTGAGCTCTCTAGAATGGAAAGCGGCGGCAAAG containing a vector linker) and CmEAF7-R3 (TTTGGCGTCTTCCATAGACTCTTCTTTGACGAAGAAG containing a vector linker), and the sequence is shown in SEQ ID NO.4. The pCAMBIA3301-LUC vector was double-digested with Spe I and HindIII restriction endonucleases, and the product was purified after digestion at 37°C for 1 hour. The CmEAF7 full-length CDS was homologously recombined with the linearized pCAMBIA3301-LUC vector fragment by homologous recombination. The recombinant product was transformed into Escherichia coli competent cells DH5α by heat shock method. After sequencing of positive clones, plasmids were extracted and further transferred into Agrobacterium competent cells EHA105. After 48 hours of growth on LB plates containing kanamycin and rifampicin resistance, positive identification was performed. The recombinant bacterial solution of pCAMBIA3301-CmEAF7-LUC (abbreviated as OE-CmEAF7) was stored in 15% glycerol and stored at -80°C for future use.

[0069] (2) Construction of CmEAF7 gene transient silencing vector

[0070] Using the cDNA of melon material HH09 as a template, the full-length sequence of CmEAF7 CDS (378 bp, excluding the stop codon) was amplified by primers CmEAF7-F4 (GCCCTTGCTCACCATGAATTCATGGAAAGCGGCGGCAAAG containing a vector linker) and CmEAF7-R4 (TCTTCACTGTTGATACATATGAGACTCTTCTTTGACGAAGAAG containing a vector linker), and the sequence is shown in SEQ ID NO.4. The pRI101-EGFP vector was double-digested with EcoR I and Nde I restriction endonucleases, and the product was purified after digestion at 37°C for 1 hour. The CmEAF7 CDS was reversely linked to the pRI101-EGFP vector by homologous recombination to construct the antisense fusion expression vector pRI101AS-CmEAF7-EGFP (abbreviated as AS-CmEAF7). The recombinant product was transformed into Escherichia coli competent cells DH5α by heat shock method. After sequencing of positive clones, plasmids were extracted and further transferred into Agrobacterium competent cells EHA105. After 48 hours of growth on LB plates containing kanamycin and rifampicin resistance, positive identification was performed. The pRI101AS-CmEAF7-EGFP recombinant bacterial solution was stored in 15% glycerol and stored at -80°C for future use.

[0071] (3) Transient overexpression and silencing of CmEAF7 gene in melon fruit by injection

[0072] 1. Preparation of infection solution

[0073] A small amount of glycerol bacteria of the overexpression vector (OE-CmEAF7) and its empty vector (OE-LUC) and the antisense silencing vector (AS-CmEAF7) and its empty vector (AS-GFP) were taken out respectively, and added to the LB liquid medium containing kanamycin and rifampicin at a ratio of 1:100 and shaken at 28°C. Then the above bacterial solution was expanded and added to the LB liquid medium containing 25μg / ml rifampicin, 50μg / ml kanamycin, 10mM MES and 20μM AS at a ratio of 1:100, and cultured at 28°C and 200r / min for 18-24h until the bacterial solution OD 600 The value is 1.0-1.5.

[0074] The cells were collected by centrifugation at 5000 rpm for 5 min at room temperature and resuspended in a suspension containing 10 mM MES, 10 mM MgCl2, 200 μM AS, 0.005% Tween 20 (v / v) and 100 mg / L 2,4-D. The OD of the resuspended bacterial solution was adjusted to 600 The concentration of the dilution is 1.0-1.2, incubate at 28℃ in the dark for 2-3h, and set aside.

[0075] 2. Injection method to infect melon fruit

[0076] Melon fruits of the same size were selected from H581 and HH14 20-25 days after pollination for transient transformation. The injection sites were selected as the equator of the melon fruit and the part near the melon stem. The injection depth was about 1 / 2 of the flesh thickness. 0.5 ml of bacterial solution was injected into each hole, and 6-9 points were injected into each melon. Samples were taken at 1.5, 3.5, 5.5 and 7.5 days after injection. The flesh samples near the injection pinhole were taken with a 1 cm diameter punch, and the peel and seed parts were discarded. The expression of LUC and GFP was detected in the in vivo fluorescence imager. Samples were taken according to the fluorescence expression, and the samples were quickly frozen in liquid nitrogen and stored at -80 °C for later use.

[0077] (4) Identification of CmEAF7 gene expression

[0078] The instantaneous transformation pulp samples were ground with liquid nitrogen, and the total RNA of the samples was extracted using the Huayueyang Polysaccharide Polyphenol RNA Extraction Kit (Cat: 0416-50gk). The reverse transcription and real-time fluorescence quantitative PCR were performed using the full-form gold reverse transcription and fluorescence quantitative kit (Code#AUQ-01), respectively. The specific experimental operations were carried out according to the instructions of the kit. The expression levels of some samples are shown in Figure 4 shown.

[0079] (5) Determination of sucrose and fructose content in melon fruit

[0080] The transiently transformed pulp samples were ground with liquid nitrogen, and 0.05 g of the samples were accurately weighed. The sucrose and fructose contents in the transiently overexpressed and silenced samples were detected using the plant sucrose content detection kit (Cat. AKPL006M) and plant fructose content detection kit (Cat. AKPL007M) of Beijing Box Biotechnology Co., Ltd., respectively. Figure 5 After transient expression for 5.5 days, the sucrose and fructose contents in the fruits of overexpression (OE-CmEAF7) in H581 and HH14 were significantly increased compared with the negative control (OE-LUC) fruits. In contrast, the sucrose and fructose contents in the silenced (AS-CmEAF7) fruits were significantly decreased compared with the negative control (AS-GFP) fruits.

[0081] In summary, overexpression of CmEAF7 can increase the content of sucrose and fructose in melon fruit, while silencing CmEAF7 can reduce their content. Therefore, the CmEAF7 gene can positively regulate the content of sucrose and fructose in melon fruit, which helps to improve the quality of melon.

[0082] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. Application of CmEAF7 gene in improving cold tolerance and / or fruit quality of melon, characterized in that: The nucleotide sequence of the CmEAF7 gene is shown in SEQ ID NO.1, and the improvement of melon fruit quality is manifested in the increase of sucrose and fructose content in the melon fruit.

2. The use according to claim 1, characterized in that: By constructing a CmEAF7 overexpression vector, cold-tolerant and / or high-quality transgenic plants are obtained.

3. A plant breeding method, characterized in that: The method is the following (1) or (2): (1) obtaining plants with improved cold tolerance and / or fruit quality by increasing the activity of CmEAF7 protein in target plants; (2) Promoting the expression of CmEAF7 gene in target plants to obtain plants with improved cold tolerance and / or fruit quality; The nucleotide sequence of the CmEAF7 gene is shown in SEQ ID NO.1, the amino acid sequence of the CmEAF7 protein is shown in SEQ ID NO.2, the fruit quality is the sucrose and fructose content in the fruit, and the target plant is melon.

Images