Application of BnVDof1 and its encoding gene in the construction of vascular morphology in rapeseed leaves

Abstract

The present invention belongs to the technical field of plant genetic engineering, and specifically discloses the application of BnVDof1 and its encoding gene in the construction of vascular morphology of rapeseed leaves. Experiments have confirmed that the BnVDof1 overexpressing transgenic plants of the present invention have a phenotype with increased vascular density, and the fructose content in the silique peel of the rapeseed overexpressing strain is significantly higher than that of the wild type, especially "icing" crystals precipitated from the silique peel. Through molecular mechanism exploration, it was found that the transcription factor BnVDof1 can interact with the autophagy core protein Atg8 at the protein level and can bind to the Atg8 promoter at the transcription level, which can improve the homeostasis of plants under adverse stress.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a rapeseed Dof1 transcription factor BnVDof1 protein and a coding gene and application thereof. Background Art

[0002] Rapeseed is a valuable and useful economic crop in the world. It can be used to extract edible oil, make biodiesel, be used as an edible vegetable, and be used for horticultural ornamental purposes. The rapeseed genome has been sequenced and contains more than 100,000 genes. There are important genes related to its developmental process in the rapeseed genome, such as the DOF gene encoding a transcription factor, which may be involved in cell proliferation and stem cell differentiation in the early growth stage of plants. The first DNA transcription factor that binds to the finger (Dof) has been identified in maize (ZmDof1) and has been shown to be involved in light response and transcriptional regulation of carbon metabolism-related genes. Dof TFs are plant-specific and are characterized by a specific zinc finger domain containing a conserved region of 50 amino acids with a C2-C2 finger structure associated with a basic region that specifically binds to a DNA sequence with a 5'-(A / T)AAAG-3' core. To date, eight to nine Dof TF genes have been found in gymnosperms and lower plants. An average of 30 Dof genes are found in angiosperms, including 30 Dof genes in rice (Oryza sativa), 36 Dof genes in Arabidopsis, 37 Dof genes in tomato, and 41 Dof genes in poplar. Recent studies have found that DOF proteins are related to plant light response, photosensitive complexes, defense responses, seed development and germination, regulation of guard cell-specific genes, and response to auxin and gibberellin pathways.

[0003] As petroleum resources are gradually depleted, greenhouse gas emissions increase, and global warming becomes increasingly serious, the production of biofuels has gradually attracted widespread attention from the world. Butanol, as a C4 organic new energy source that can replace fossil fuels, has advantages over ethanol such as high calorific value octane number, good miscibility with gasoline, and convenient pipeline transportation. Therefore, the use of microorganisms to ferment acetone-butanol ethanol (ABE) to produce biofuels has broad application prospects. Traditional ABE fermentation raw materials are corn or molasses, and the raw material cost accounts for more than 30% of the total production cost, which is the main reason for the high price of butanol. Molasses is a by-product of the sugar industry, rich in sucrose and contains other sugars such as raffinose, glucose and fructose. α-Galactosidase (EC.3.2.1.22) catalyzes the hydrolysis of α-(1,6) bonds of galactose residues in oligogalactose (melibiose, raffinose and stachyose) and complex galactomannan. α-Galactosidase has important applications, mainly in the food industry, but also in the pharmaceutical and bioenergy fields. However, the cost of the enzyme limits the profitability of most of these applications. The use of cheap sub-products, such as molasses, as substrates for the production of α-galactosidase reduces production costs and contributes to a green economy. Based on the fact that VDof1 overexpressing rapeseed is rich in total sugars including fructose, and the silique peel has the characteristic of "frost" visible to the naked eye, the present invention can develop VDof1 rapeseed into a future food, as a new source of "molasses", an upstream raw material in the industrial chain of the pharmaceutical and bioenergy fields, further reducing production costs, enriching the layout of the rapeseed industry, and increasing the income of leading agricultural industrialization enterprises and professional farmers in the new era. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a rapeseed Dof1-like transcription factor BnVDof1 protein and its encoding gene and application. BnVDof1 has the function of regulating the vascular morphology of plant leaves, and the fructose content of silique peel in rapeseed overexpression is significantly higher than that of the wild type, and a large amount of "icing"-like crystals accumulate in the silique in the later stage.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] The application of BnVDof1 protein or its encoding gene includes any of the following applications:

[0007] 1) Regulate the vascular morphology of plant leaves;

[0008] 2) Regulate the transport and precipitation of sugars in the pericarp of plant siliques;

[0009] 3) Regulate the total sugar content of plant siliques;

[0010] The amino acid sequence of the BnVDof1 protein is shown in SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2.

[0011] Furthermore, the plant includes rapeseed, Arabidopsis thaliana or rice.

[0012] A method for increasing the total sugar content of rapeseed siliques or promoting the transport and precipitation of sugar in silique peels comprises over-expressing a BnVDof1 protein having an amino acid sequence as shown in SEQ ID NO.1 in rapeseed.

[0013] A method for promoting the formation of plant leaf vascular morphology includes overexpressing a BnVDof1 protein having a nucleotide sequence as shown in SEQ ID NO. 2 in a plant. Furthermore, the plant 1 includes Arabidopsis thaliana, rapeseed and rice.

[0014] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0015] The rape transcription factor BnVDof1 protein provided by the present invention has the function of promoting the construction of plant leaf vascular morphology, can promote the precipitation of frost in silique peel, increase the sugar content of silique, promote the transport and precipitation of sugar in silique peel, and can be applied to the development of new "molasses" strains. The protein encoded by the rape gene BnVDof1 can not only interact with the key protein Atg8 in the autophagy pathway at the protein level, but also can bind to and activate the promoter of the Atg8 gene in the cell, and promote the transcription of the Atg8 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the protein functional domain of the BnVDof1 gene.

[0017] Figure 2 It is the detection of relative expression levels of VDof1 (including AtVDof1 and BnVDof1) genes in transgenic plants, protein detection and sequence sequencing results of the target regions of gene knockout rapeseed materials.

[0018] A. DNA electrophoresis identification results of Arabidopsis wild type Col-0, T-DNA insertion mutant Arabidopsis vdof1, and transgenic Arabidopsis overexpressing VDof1 (including AtVDof1 and BnVDof1) (the primers used in lane 1 are AtVDof1-OE-F and AtVDof1-OE-R; the primers used in lane 2 are AtVDof1-OE-F, AtVDof1-OE-R, and LBa1 (T-DNA left border primer of SALK mutant); the primers used in lane 3 are 35S and AtVDof1-OE-R; the primers used in lane 4 are 35S and BnVDof1-OE-R; the primer sequences are shown in Table 1);

[0019] B. Relative mRNA expression levels of Arabidopsis wild type Col-0, T-DNA insertion mutant Arabidopsis vdof1, and transgenic Arabidopsis overexpressing VDof1 (including AtVDof1 and BnVDof1);

[0020] C. Relative mRNA expression levels of wild-type rapeseed Ck-Bn, rapeseed CRISPR gene editing, and transgenic Arabidopsis overexpressing VDof1 (BnVDof1);

[0021] D. Protein SDS electrophoresis identification of Arabidopsis wild type Col-0, T-DNA insertion mutant Arabidopsis vdof1, and transgenic Arabidopsis overexpressing VDof1 (including AtVDof1 and BnVDof1);

[0022] E. Protein SDS electrophoresis identification of rapeseed wild type Ck-Bn, rapeseed CRISPR gene editing, and transgenic rapeseed overexpressing VDof1 (BnVDof1) (top); protein SDS electrophoresis identification of rice wild type Ck-Os and transgenic rice overexpressing VDof1 (BnVDof1) (bottom);

[0023] Schematic diagram of the gene structure of the FT-DNA insertion mutant vdof1;

[0024] G. Schematic diagram of the target site structure of rapeseed CRISPR gene editing;

[0025] H. Mutation types of rapeseed CRISPR gene editing target sites and sequencing results.

[0026] Figure 3 Tissue cross-sections constructed to alter the leaf vascular morphology of Arabidopsis, rapeseed or rice by VDof1 (including AtVDof1 and BnVDof1) genes (scale bar: 100 μm).

[0027] A. Comparison of vascular morphology of Arabidopsis wild type Col-0, T-DNA insertion mutant Arabidopsis vdof1, and transgenic overexpression of VDof1 (including AtVDof1 and BnVDof1) Arabidopsis. Numbers indicate vascular levels, level 2 indicates main vein vascular, level 3 and level 4 or higher indicates small micro-vein vascular, and the levels increase in sequence. As indicated by the red arrow, transgenic overexpression of VDof1 (including AtVDof1 and BnVDof1) Arabidopsis shows closely spaced small micro-veins (the same as in the figure below);

[0028] B. Comparison of vascular morphology of wild-type rapeseed Ck-Bn, rapeseed CRISPR gene editing, and transgenic rapeseed overexpressing VDof1 (BnVDof1);

[0029] C. Comparison of vascular morphology of wild-type rice Ck-Os and transgenic rice overexpressing VDof1 (BnVDof1).

[0030] Figure 4 Overexpression of BnVDof1 in rapeseed increases sugar content.

[0031] A. Phenotype of “sugar frosting” precipitated from the silique of rapeseed;

[0032] B. Boil siliques to produce "molasses" liquid; the darker the color, the higher the sugar content.

[0033] C. Quantitative statistical graph of soluble sugar in rapeseed silique peel, 3 biological replicates, statistical analysis by t-test, "*" indicates p value is less than 0.05, there is a significant difference.

[0034] Figure 5 The results of the interaction between BnVDof1 and the key autophagy protein Atg8.

[0035] A. BnVDof1 proteins of different lengths interact with the autophagy key protein Atg8 yeast two-hybrid protein;

[0036] B. BnVDof1 interacts with Atg8 pull-down protein in vitro;

[0037] C. BnVDof1 interacts with Atg8 in vivo Co-IP protein (where “*” indicates a mixed band).

[0038] Figure 6 BnVDof1 regulates the transcription of Atg8, a key gene for autophagy.

[0039] A. BnVDof1 directly binds to the Atg8 upstream promoter ChIP-qPCR relative enrichment content diagram, P1, P2, P3 represent the promoter region, P1, P3 have binding signals and are significantly different from the control, as shown in the p value (the same as the figure below);

[0040] B. The results of the dual fluorescein reporter gene experiment of BnVDof1 and Atg8 promoter showed that BnVDof1 activated the expression of Atg8;

[0041] C. In vitro EMSA binding results of BnVDof1::His fusion expression protein and Atg8 partial promoter region probe. DETAILED DESCRIPTION

[0042] The present invention is described in detail below in conjunction with specific embodiments. Based on the following description and these embodiments, those skilled in the art can determine the basic characteristics of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for various purposes.

[0043] The experimental methods in the following examples, unless otherwise specified, are based on the techniques or conditions described in the literature in the field, or the conventional methods specified in the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc. used in the following examples can be obtained from commercial channels.

[0044] Example 1: BnVDof1 regulates the formation of plant leaf vascular morphology, the precipitation of sugar frost from silique peel and increases the fructose content

[0045] This example provides a protein from "Zhongshuang 11" rapeseed, which has the functions of improving plant leaf morphology, promoting the precipitation of "frost" in siliques, and increasing fructose content. Its name is BnVDof1, and the protein sequence is shown in SEQ ID NO.1. In "Zhongshuang 11", the coding gene of BnVDof1 is shown in SEQ ID NO.2. The protein was analyzed for its domain structure, and the N-terminus contained a Dof domain, as well as a classical domain AIM that interacts with the key autophagy protein Atg8 and a non-classical domain UIM. The results are as follows Figure 1 shown.

[0046] 1. Construction of overexpression vector and gene knockout vector

[0047] Construction of overexpression vector: The present invention provides a rapeseed gene BnVDof1, the sequence of which is shown in SEQ ID NO. 2. In the present invention, the rapeseed gene BnVDof1 is derived from "Zhongshuang 11" rapeseed (Brassicanapus L.). In the present invention, the rapeseed gene BnVDof1 is obtained by the following method: RNA is extracted from leaves of Zhongshuang 11 rapeseed; cDNA is obtained by reverse transcription of the RNA; and the full length of the rapeseed gene BnVDof1 is obtained by amplifying the cDNA as a template using a forward primer and a reverse primer.

[0048] The extraction of rapeseed RNA can be carried out by conventional plant tissue RNA extraction methods without other special requirements. In the specific implementation process of the present invention, the TaKaRa MiniBEST Plant RNA Extraction Kit (purchased from TaKaRa) is used to extract rapeseed RNA, and the operation is carried out according to the instructions of the kit. After obtaining the "Zhongshuang 11" rapeseed RNA, refer to the PrimeScript of TaKaRa Company TMThe cDNA was obtained by reverse transcription according to the instructions of 1st Strand cDNA Synthesis Kit. The obtained cDNA was used as a template and the forward primer BnVDof1-OE-F (5'-TAAAGCAACTGTGAGACAAGCA-3') and the reverse primer BnVDof1-OE-R

[0049] (5'-GCACCATGATCCTCCATTC-3') was amplified to obtain the full length of the BnVDof1 gene.

[0050] The amplification system is a 20 μl system, which includes 100 ng template cDNA, 10 μl PCRmix (Kangwei Century), 1.0 μM forward primer and 1.0 μM reverse primer. The amplification reaction program is preferably: 98°C, 30s; 98°C denaturation for 10s, 58°C annealing for 30s, 72°C extension for 60s, 32 cycles; after the cycle is completed, 72°C extension for 5min. The amplification reaction is preferably completed in a BioRad digital PCR instrument.

[0051] After amplification, the PCR product was obtained by 1% agarose gel electrophoresis to obtain a single target band product, and the DNA fragment was recovered using the AxyGEN Mini Gel Recovery Kit (Axygen, USA), following the instructions. PCR vector (Invitrogen) was used for ligation reaction (refer to the instructions for use). The molar ratio of BnVDof1 gene recovery product to TOPO vector in the ligation reaction system was 4:1. The total volume of the ligation reaction was 5 μl, including 4 μl of purified PCR recovery product and 1 μl of TOPO vector. The reaction was carried out at room temperature (25℃~30℃) for 10 minutes. After the reaction, the ligation product was placed on ice for 5 minutes, and then 5 μl of the ligation product was transformed into Escherichia coli DH5α by heat shock method (refer to "Molecular Cloning Laboratory Manual" 3rd edition, Science Press, 2002). Positive clones were screened on LB solid plates containing 50 mg / L spectinomycin, and 5 single clones were selected for sequencing (completed by Qingke Biotechnology Co., Ltd.). The sequencing results showed that the full length of BnVDof1 gene was 1200 bp (with 5'UTR, without stop codon). The TOPO-BnVDof1 vector and pEarleyGate101 were recombined by LR ligase to obtain the pEarleyGate101-BnVDof1 recombinant vector, which was then transformed into E. coli. An appropriate amount of bacterial solution was applied to a kanamycin-resistant LB plate, which was cultured at 37°C overnight. A single clone was streaked and cultured for 12-24 hours. Colony PCR was performed to extract the plasmid of the positive single clone and send the sample to Beijing Qingke Biological Company for sequencing and identification. Plasmid extraction was performed according to the instructions of the Qingke plasmid extraction kit. The pEarleyGate101-BnVDof1 plasmid extracted above was transformed into Agrobacterium GV3101 and EHA105 by freeze-thaw method. About 1-2 μg of plasmid was added to each 50 μL competent medium. The tube bottom was gently mixed with a pipette, and then placed on ice for 3 min, liquid nitrogen for 1 min, 37°C water bath for 5 min, and ice bath for 3 min. Then 600 μL of non-resistant LB liquid medium was added and shaken at 28°C for 3-4 hours. 100 μL of bacterial solution was spread on a solid LB plate with kanamycin, gentamicin and rifampicin. The plate was inverted and cultured at 28°C for 24 hours, and then a single clone was picked for colony PCR identification.

[0052] Construction of gene knockout vector: Based on the structure and homologous sequence alignment of BnVDof1 gene, sgRNA sequence and primers were designed based on the CRISPR2 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), and the target sequence was determined to be 5'-CCCTGTTGGTGGTGGCTCAAGAA-3', where the sequence of the target site is as follows Figure 2 -G, the knockout vector was constructed according to the method recommended by the commercial company Biogle. The oligo sequence used is as follows:

[0053] UP oligo: 5'-TGATTGTTCTTGAGCCACCACCAACA-3'

[0054] LOW oligo: 5'-AAACTGTTGGTGGTGGCTCAAGAAGA-3'

[0055] The constructed knockout vector was sent to a sequencing company for sequencing, and the sequence was confirmed to be correct after comparison. The returned plasmid was transformed into Agrobacterium GV3101 by heat shock method, and colony PCR was performed for identification. The positive strain BnVDof1-crispr was stored at -80℃. 2. Construction of transgenic plants and gene knockout plants

[0056] 2.1 Stable transformation of Arabidopsis thaliana was performed using the Agrobacterium floral dip method. BnVDof1 and AtVDof1 (sequence shown in SEQ ID NO.3) were overexpressed in Arabidopsis thaliana according to the method proposed by Steven J. Clough (Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana). Rapeseed was transformed using the Agrobacterium-mediated hypocotyl transformation method. The rapeseed seeds were sterilized and planted, and cultured in the dark for 7 days. Hypocotyls in good condition were cut and the length was unified to 2-3 cm for Agrobacterium transformation.

[0057] 2.2 The Agrobacterium containing the pEarleyGate101-BnVDof1 recombinant expression vector was used to carry out Agrobacterium-mediated genetic transformation of rapeseed hypocotyls or rice transformation. The genetic transformation, transgenic family screening, etc. were based on the operating procedures proposed by Cardoza V (Cardoza V, Stewart CN. Increased Agrobacterium-mediated transformation and rooting efficiencies in canola (Brassica napus L.) from hypocotyl segment explants [J]. Plant Cell Reports, 2003, 21 (6): 599-604.) and Wang Yaqin et al. (Wang Yaqin, Chen Chunfeng, Chen Xingyao. A method for establishing a high-efficiency regeneration and transformation system of rice Zhonghua 11).

[0058] 2.3 Construction of BnVDof1 gene knockout rapeseed

[0059] 2.3.1 Explant preparation

[0060] Use Brassica napus 29005 seeds as materials for seed surface disinfection:

[0061] (1) Add the seeds to a clean 50 ml centrifuge tube and soak them in 75% alcohol for 5 minutes;

[0062] (2) Pour off the alcohol, add 10 ml of 1.5% mercuric chloride, and soak the seeds for 15 minutes, shaking every few minutes to ensure that the liquid and seeds are in full contact;

[0063] (3) Pour away the mercuric chloride and wash the seeds about four times with sterile distilled water;

[0064] (4) Use a pipette to drain the remaining water and place the seeds into M0 medium using tweezers that have been sterilized in advance, with 50 seeds per bottle and 6 bottles of seeds for each transformation;

[0065] (5) Cultivate in dark at 24°C for 5-6 days.

[0066] 2.3.2 Agrobacterium infection and co-cultivation

[0067] (1) Take 10 μl of the BnVDof1-crispr Agrobacterium culture stored at -80°C, add it to 1 ml of LB liquid medium containing kanamycin, gentamicin and rifampicin, and culture overnight for activation;

[0068] (2) Take out the seedlings that have been cultured in the dark, place them in a sterilized large dish, and cut the hypocotyls with a sterilized scalpel. Each section should be about 0.8 cm long. Pour a small amount of DM medium into the large dish to keep it moist.

[0069] (3) The activated bacterial suspension was inoculated into 20 ml of LB liquid medium containing kanamycin, gentamicin and rifampicin, and cultured at 28°C and 200 rpm until OD 600 The value reached 0.4-0.8; the cells were collected by centrifuge at 2000 rpm, and then 20 ml of DM medium containing 100 μM AS was added, resuspended, and shaken at 28°C for 30 minutes;

[0070] (4) Add the Agrobacterium culture solution cultured in DM medium for 30 minutes to the cut hypocotyls and infect for 30 minutes, shaking every five minutes or so;

[0071] (5) Transfer the explant to an empty culture dish with sterilized filter paper, spread it out, and absorb the bacterial solution with a small filter paper;

[0072] (6) Transfer the explants to M1 medium and culture in the dark at 24°C for two days.

[0073] 2.3.3 Screening and differentiation

[0074] The explants that have been co-cultured for two days are transferred to M2 medium containing 5 mg / L hygromycin and cultured under light for about 3 weeks. At this time, you can see that the explants are stained darker and begin to swell into callus tissue. Thereafter, the explants are transferred to M3 medium containing 8 mg / L hygromycin and cultured in a light incubator with a light length of 16 h / d. Subculture is performed every two weeks to ensure adequate nutrition until small seedlings can be seen differentiating.

[0075] 2.3.4 Rooting

[0076] The callus from which seedlings have grown is transferred into a sterilized empty dish, the seedlings are cut off from the callus tissue using tweezers and a scalpel, and then transferred into an M4 medium light incubator with a light length of 16 h / d.

[0077] Note: M0, M1, M2, M3, and M4 culture media are conventional culture media in this field, with reference to the detailed formula provided by Zheng et al. (Zheng, M. et al. Knockout of two BnaMAX1 homologs by CRISPR / Cas9-targeted mutagenesis improves plant architecture and increases yield in rapeseed (Brassica napus L.). Plant Biotechnol. J. 18, 644–654 (2020).).

[0078] 2.3.5 Acclimation and transplanting

[0079] Open the seal of the well-rooted plants, take out the light incubator, place them in the greenhouse for 3-4 days, then transplant them into the substrate and cover them with clean plastic film to maintain humidity. After 3 days, gradually open holes to prevent wind and allow the plants to adapt to the external environment.

[0080] The above transgenic plants were screened for DNA, RNA expression and protein identification. The pEarleyGate101-BnVDof1 vector carries herbicide resistance. First, the herbicide was sprayed, and the leaf DNA, RNA and total protein of the surviving families were extracted. The VDof1 mutant vdof1 (salk152104c) was ordered from the Salk mutant library. The insertion structure is as follows Figure 2 -F as shown.

[0081] DNA identification: positive transgenic plants were screened with the upstream primer 35S of the plant expression vector and the primer BnVDof1-OE-R. The transgenic families that tested positive by PCR were the T1 generation, and the individual plants were self-pollinated and harvested and numbered for storage. Then the T2 generation was screened again to obtain the homozygous transgenic families. Figure 2-The primers used in lane 1 of A are AtVDof1-OE-F and AtVDof1-OE-R; the primers used in lane 2 are AtVDof1-OE-F, AtVDof1-OE-R and LBa1 (T-DNA left border primer of SALK mutant); the primers used in lane 3 are 35S and AtVDof1-OE-R; the primers used in lane 4 are 35S and BnVDof1-OE-R.

[0082] RNA identification: Real-time quantitative PCR was used to analyze the expression of BnVDof1 gene in different positive transgenic families. According to the full-length sequence of the gene, a fluorescent quantitative primer pair was designed for the gene, BnVDof1-qrtF: ACAAACACATGCCCAAAGCC, BnVDof1-qrtR: TGATCCTTTTCTGGCCTTGC. Real-time fluorescence quantitative PCR was performed on ABI7500 real-time fluorescence quantitative PCR instrument. The 20μl real-time fluorescence quantitative PCR system was as follows: SYRB fluorescent dye 10μl (purchased from Roche), 300ng cDNA 1μl, the above-mentioned upstream / downstream primers 1μl each and RNase-Free water 7μl; the reaction program was as follows: 95℃10min, 95℃10s, 65℃10s, 72℃30s, 45 cycles, and 72℃10min after the cycle was completed.

[0083] Protein identification: Total protein was extracted from plants and subjected to western blot analysis according to a previously described method (Liu, J. et al. A Novel Chimeric Mitochondrial Gene Confers Cytoplasmic Effects on Seed Oil Content in Polyploid Rapeseed (Brassica napus). Mol. Plant 12, 582–596 (2019).). The amount of protein was determined by Bradford protein assay kit. Equal amounts of protein were loaded and separated by 12% SDS-PAGE, and then the proteins were transferred to PVDF membranes.

[0084] DNA electrophoresis results Figure 2 -A, the far left is a 2000bp gene marker, the band pattern of the wild type in lane 2 is between the mutant in lane 3 and the overexpression in lanes 4 and 5, and the single band in lane 3 indicates a homozygous mutant. Figure 2-B, C, it can be seen from the figure that in Arabidopsis plants, the relative expression levels of overexpressed materials AtVDof1 and BnVDof1 are much higher than those of wild type and mutants, and the relative expression level of the gene of vdof1 mutant is lower than that of wild type; in rapeseed plants, the relative expression level of BnVDof1 in two independent overexpression families is higher than that of wild type, and the relative expression level of the gene of CRISPR mutant is lower than that of wild type. The protein identification results are shown in the figure Figure 2 -D, E, as shown in the figure, in Arabidopsis plants, HA-tagged fusion proteins can be detected in the overexpression materials of AtVDof1 and BnVDof1, and the same is true in rapeseed and rice materials.

[0085] 3. CRISPR gene knockout rapeseed plant detection

[0086] The DNA of the T0 generation plants of the CRISPR knockout strain of the BnVDof1 gene of rapeseed was extracted by the CTAB method. A total of 6 T0 generation plants were obtained by BnVDof1-crispr. After numbering, PCR amplification was performed to detect the transformed plants. The primers used were: Hyg-120-F: 5'-TGTAGGAGGGCGTGGATATG-3', Hyg-971-R: 5'-ACTTCTACA CAGCCATCGGT-3', to detect whether the T0 generation transformed plants contained hygromycin selection markers. The DNA of the positive plants was subjected to high-throughput library construction and next-generation sequencing, and the mutation probability of the target site was counted. After the T0 generation of BnVDof1-crispr was harvested, the T1 generation was sown and planted. PCR detection was performed using identification primers, and the results showed that all phenotypic mutations were homozygous mutations, that is, both copies of the BnVDof1 gene on the A and C genomes were knocked out. The sequencing results are as follows: Figure 2 -H, as shown in the figure, compared with the wild-type Ck-Bn, in the 3-1 family, the BnVDof1 gene of the C genome and the A genome respectively inserted a base G, while in the 3-10 family, the BnVDof1 gene of the C genome and the A genome inserted a base A, and the other lacked a base T. At the same time, the hygromycin identification primers were used to separate and identify the T1 generation of BnVDof1-crispr for hygromycin, which was used to screen the single strains in which both copies of the BnVDof1 gene on the A and C genomes were knocked out and had no hygromycin resistance. Since this single strain has no resistance to screening, it can be directly used for transgenic pilot tests and production tests. The identification primers are as follows:

[0087] BnVDof1-crispr-F: GCCAAGATTCTTCTGCAAAGG BnVDof1-crispr-R: GCTGGTTGTGTAGAATCCGAGT.

[0088] Table 1 Primer list

[0089]

[0090] 4. Leaf cross section and vascular density analysis

[0091] Leaf anatomy of rapeseed, rice, and Arabidopsis was analyzed using the fifth pair of fully expanded leaves, flag leaves, and fourth pair of rosette leaves, respectively. Tissue fragments of approximately 2 cm long × 1 cm wide were isolated from the central region of the half leaf. Abnormalities in the venation minor and midveins were quantified by randomly selecting plant leaf segments of 3 cm long × 2 cm wide from the middle of the fourth leaf of 3-week-old plants. All leaves were collected and fixed in FAA solution (50% ethanol, 5% acetic acid, 10% formaldehyde). They were then prepared for paraffin embedding and sectioning. Cross sections were stained with toluidine blue (1% toluidine blue and 2% borate) and observed under an Olympus BX51 microscope equipped with a CCD camera as described by Zhu et al. (Zhu, X. et al. Stress-induced higher vein density in C3-C4 intermediate Moricandia suffruticosa underdrought and heat stress. J. Exp. Bot. (2022). doi: 10.1093 / jxb /

[0092] erac253). At least five biological replicates were sampled for leaf anatomical analysis, e.g. Figure 3 As shown, the results show that VDof1 genes (AtVDof1 and BnVDof1) can promote vascular morphology in plants such as Arabidopsis, rapeseed, and rice. Specifically, overexpression of VDof1 promotes the generation of closely spaced microveins. In Arabidopsis overexpression plants, AtVDof1 and BnVDof1 reduced the physical distance between level 3 and level 4 microveins, respectively, which may mean the regeneration of microveins. In rapeseed overexpression plants, the density of level 3 and level 4 microveins increased significantly and the spacing decreased, while the microveins of CRISPR knockout mutants were lower than those of the wild type, and the spacing between microveins was larger. In rice overexpression, not only the density of level 3 and level 4 microveins increased significantly, but also level 5 microveins were generated in the middle of the main veins.

[0093] 5. Identification experiment of total sugar in silique

[0094] The rapeseed overexpression material was planted in a plant growth room at 22°C, with a photoperiod of 16 h light, 8 h dark, and 30% humidity, and was bagged before budding and flowering. When the siliques grow out, white transparent beads can be observed on the silique skin in the early stage, and also on the stem. In the later stage, the siliques accumulate a large number of "icing sugar" crystals, such as Figure 4-A. Therefore, siliques from more than three independent families were collected for each of the overexpression family and the control, and the "molasses" liquid was boiled in a boiling water bath. The results are shown in Figure 4 -B shows that the three independent families of rapeseed overexpression materials showed dark brown compared with the wild type. The darker the color, the higher the sugar content. The quantitative statistical analysis results of soluble sugar in rapeseed siliques are shown in Figure 4 -C.

[0095] Example 2: Analysis of the molecular mechanism of BnVDof1's involvement in coordination

[0096] 1. Yeast screening library and two-hybridization

[0097] In this example, the rapeseed transcription factor BnVDof1 protein was used to screen potential interacting proteins by yeast screening experiments. Two restriction sites, EcoRI and BamHI, were added to both ends of the BnVDof1 gene amplification primer, and the amplification primers were forward primer PGBK-BnVDof1-F: 5'-ATGGAGGCCCAATTCGAATTCACAAACACATGCCCAAAGCC-3', and reverse primer PGBK-BnVDof1-R: 5'-CAGGTCGACGGATCCGGATCCGCACCATGATCCTCCATTC-3'. The BnVDof1 gene amplification product was connected to the pGBKT7 vector double-digested with EcoRI and BamHI, and the Clonetech Arabidopsis yeast library Mate & Plate Library-Universal Arabidopsis (Normalized) was purchased, and the Matchmaker Gold Yeast Two-Hybrid System yeast two-hybrid system was used to screen potential interacting proteins. The methods of amplification, connection, and plasmid extraction were the same as those in Example 1. Yeast two-hybrid assay methods and results analysis refer to the Yeast Two-hybrid Assay System User Manual (Matchmaker TM Gold Yeast Two-Hybrid System User Manual), and a total of 25 candidate interacting proteins were screened.

[0098] Further yeast two-hybrid point-to-point verification of the potential interacting protein Atg8 was performed. First, the Atg8 gene was cloned, and two restriction sites, EcoRI and BamHI, were added to both ends of the amplification primer. The amplification primers were forward primer: PGAD-Atg8-F: 5'-GAGGCCAGTGAATTCGAATTCATGAAATCGTTCAAGGAACAATAC-3', reverse primer: 5'-GAGCTCGATGGATCCGGATCCACCAAAGGTTTTCTCACTGCTAT-3'. The amplified product was connected to the pGADT7 vector double-digested with EcoRI and BamHI, transformed into Escherichia coli, and after identifying the positive results, the plasmids were extracted respectively. The amplification, connection and plasmid extraction methods are the same as in Example 1. Figure 5 -A The results showed that, except for the positive control, the yeast colonies containing pGBK-BnVDof1 fragment vectors at different positions of the BnVDof1 protein constructed by gene synthesis and pGADT7-Atg8 were able to grow and appear blue on defective medium (QOD) supplemented with X-gal and lacking adenine, histidine, leucine and tryptophan, while the control group could not.

[0099] 2. Pull-down experiment

[0100] The pET-28a vector was used to clone the full-length coding sequence of BnVDof1. The protein purification was performed by a commercial company. The full-length coding sequence of Atg8i was inserted into the pGEX-6p-1 vector. The plasmid was expressed in an E. coli strain. This was done by adding IPTG and incubating at 16°C for 13 hours. The recombinant proteins were purified using amylose resin for maltose binding protein (MBP) tag and Ni NTA Beads 6FF (smart-lifesciences, China) for His tag. Half a microgram of MBP-Atg8 or MBP was incubated with amylose resin (NEB) at 4 degrees Celsius for 1 hour with shaking, and then 0.2 micrograms of His-VDof1 were added. After incubation overnight, the resin was washed several times. The eluate was boiled in 2× SDS loading buffer, and the proteins were separated by SDS-PAGE and then analyzed by western blotting using anti-His (3724s, His) and MBP antibodies, as shown in Figure 5-B shows that the leftmost lane in the protein electrophoresis gel is the protein marker, and the first three lanes are Input, which shows that the negative control MBP, the target fusion protein Atg8::MBP and VDof1::His band sizes correspond correctly. The final Pull-down results show that only when Atg8::MBP is added can VDof1::His be detected by anti-His, while VDof1::His cannot be detected in the negative control MBP group. The above results prove that BnVDof1 physically interacts with Atg8.

[0101] 3. Co-IP experiment

[0102] The p1300-Atg8-mCherry vector was constructed and co-transformed with pEarleyGate101-BnVDof1 into GV3101 Agrobacterium, and then transiently transformed into tobacco leaves. Total protein extraction of leaves was performed 3 days after Agrobacterium infection. Fluorescence co-localization analysis by laser confocal microscopy can be used to observe whether the protein is expressed in leaves. By grinding Agrobacterium-infiltrated tobacco leaf tissue in liquid nitrogen, protein was extracted and immunoprecipitation analysis was performed using HA magnetic beads (11846S, CST) (method reference Bao, Y. et al. COST1 regulates autophagy to control plant drought tolerance. Proc. Natl. Acad. Sci. USA 117, 7482–7493 (2020).). Leaf tissue was lysed with a buffer containing protease and phosphatase inhibitors suitable for immunoprecipitation (P0013, Beyotime Biotechnology). HA beads (10 μL) were added to 50 mL of protein extract and incubated overnight at 4 degrees Celsius. The beads were then washed three times with the buffer used for co-immunoprecipitation. Antibody-bound proteins were dissociated by adding 2× protein loading buffer and boiling for 10 min. The relevant fusion proteins were detected in immunoblot analysis using monoclonal antibodies against Ha(CST) and mCherry(CST), as shown in Figure 5 -C results show that the protein electrophoresis samples are listed as protein marker, input and Co-IP. The input results show that the corresponding proteins in each combination are expressed normally. The final Co-IP results show that only the combination with Atg8::mCherry can detect Atg8::mCherry through Anti-mCherry (such as Figure 5-C* asterisk), while the negative control combination mCherry could not detect the target size band (there were mixed bands in the fourth column of samples, and the protein size was inconsistent with the Input). The above experiments once again confirmed that BnVDof1 interacted with the key autophagy protein Atg8 at the protein molecular level.

[0103] 4. ChIP-qPCR experiment

[0104] We used Magna ChIP TM Chromatin immunoprecipitation (ChIP) assays were performed using a modified version of a published method using a chromatin immunoprecipitation kit (Millipore, 17-610) (for detailed methods, refer to Zhang, P. et al. Rice and Arabidopsis homologs of yeast CHROMOSOME TRANSMISSION FIDELITY PROTEIN4 commonly interact with Polycomb complexes but exert divergent regulatory functions. Plant Cell 33, 1417–1429 (2021)). Chromatin from 21-day-old BnVDof1-overexpressing Arabidopsis seedlings was extracted and sonicated to produce fragments of 200-750 bp in length. After incubation with proteinase K at 37°C for 5 hours and then at 65°C for 6 hours or overnight, the cross-linked DNA fragments were eluted. ChIP was then performed using a commercial HA polyclonal antibody. ChIP-qPCR was performed on the purified DNA samples using KOD SYBR Green mixture, and the results are shown in Figure 2. Figure 6 -A, the top is a schematic diagram of the positions of the three Chip-qPCR detection primers P1, P2, and P3 in the Atg8e promoter region, and the bottom is the relative enrichment content results of the three primers, among which P1 and P3 are significantly enriched. This experiment confirms that BnVDof1 can bind to the promoter region of Atg8e, that is, Atg8 is the target gene of BnVDof1.

[0105] 5. Dual luciferase reporter gene assay

[0106] Based on the identification of BnVDof1 target as Atg8 by ChIP-seq analysis, a 2-kb promoter fragment of Atg8 was cloned into the pGREEN II 0800-LUC vector. The full-length coding sequence of BnVDof1 was amplified and inserted into the pAN580 vector to generate the pAN580-VDof1 effector vector. The negative control was an empty pAN580 vector. Luciferase (LUC) activity was measured using the Dual Luciferase Reporter Assay System Kit (Promega E1910), and the CaMV 35S promoter-driven Renilla luciferase (REN) gene was used as an internal control. The results are shown in Figure 2. Figure 6 -B, the upper part is a schematic diagram of the vector for constructing the Atg8e promoter dual luciferase, and the lower part is the chemical signal ratio of the empty plasmid and the BnVDof1 and Atg8e promoter dual luciferase reporter gene vector transformed in the protoplasts, indicating that BnVDof1 can significantly activate the Atg8e promoter.

[0107] 6. EMSA experiment

[0108] The 200-234bp, 980-1020bp and 1767-1800bp promoter sequences before the start codon of the Atg8 gene were biotin-labeled at Qingke Biotechnology Co., Ltd. The labeled sequences were (Biotin-Atg8-1: 5'--3'). The BnVDof1 sequence was artificially synthesized and inserted into the pet28a-6xHIS vector. The constructed plasmid was transformed into BL21 DE3 competent cells, inoculated with kanamycin-resistant LB plate medium, and grown overnight. After PCR identification of positive results, the cells were cultured in LB liquid medium containing 50μg / ml ampicillin at 37℃ until the bacterial solution OD 600 When the pH is 0.6, add IPTG and culture at 16°C, 150rpm for 13h to induce protein expression. Collect the bacteria with a centrifuge and resuspend them in 1×PBS buffer. After ultrasonic disruption, centrifuge and purify the supernatant with a gravity column (Clontech). Refer to the user manual for the purification process. The purified BnVDof1 protein was subjected to gel electrophoresis mobility experiments with biotin-labeled and non-biotin-labeled Atg8 gene promoters. The experimental steps and result analysis refer to the instruction manual of the Lightshift Chemiluminescent EMSA kit (Thermo Corporation, USA). Figure 6 -C results showed that after 1 minute of ultrasensitive exposure, Atg8e and protein BnVDof1 had migration bands. This experiment once again confirmed that BnVDof1 could bind to the promoter region of Atg8e. Therefore, the above 4-6 experiments fully proved that BnVDof1 regulated the transcription of the key autophagy gene Atg8 at the downstream target gene molecular level.

Claims

1. A method for increasing the total sugar content of rapeseed siliques or promoting the transport and precipitation of sugars in silique peels, characterized in that: The BnVDof1 protein whose amino acid sequence is shown in SEQ ID NO.1 was overexpressed in rapeseed.

2. A method for promoting the formation of plant leaf vascular morphology, characterized in that: The BnVDof1 protein whose amino acid sequence is shown in SEQ ID NO.1 is overexpressed in a plant, wherein the plant is Arabidopsis thaliana, rapeseed or rice.

Images