A method for enriching small cDNA fragments from single-cell sequencing and its application in identifying miRNA expression in single-cell transcriptomes

Abstract

The present invention discloses a method for enriching small fragment cDNA of single cell sequencing for identifying miRNA expression in single cell transcriptome, using SPRISlect magnetic beads to sort library fragments, adding PEG10000, isopropanol and trichlorohexammine cobalt complex to the magnetic bead binding solution to improve the enrichment of small fragments of 100 to 300 bp. The present invention innovatively integrates DNA linear amplification and magnetic bead small fragment sorting technology with 10xGenomics single cell library construction method, solving the problem of small fragment PrimRNA data loss caused by insufficient small fragment enrichment ability in the single cell sequencing process in the prior art. The present invention has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for enriching small-fragment cDNA for single-cell sequencing and an application thereof in identifying miRNA expression in a single-cell transcriptome. Background Art

[0002] miRNA plays a role in post-transcriptional regulation of target gene expression. One miRNA can simultaneously target multiple genes in the same cell signaling pathway, affecting important biological processes such as cell growth, tissue differentiation, cell proliferation, embryonic development, and apoptosis. Dysregulated miRNA plays a key role in the progression of various diseases, such as aging, cardiovascular disease, and cancer. Because miRNA is involved in multiple biological processes and affects a variety of human diseases, it has become a potential diagnostic biomarker. Using single-cell transcriptome sequencing technology, the biological significance of miRNA in the cell regulatory network can be analyzed.

[0003] The most widely used high-throughput single-cell transcriptome sequencing technology is the single-cell sequencing technology based on the droplet microfluidics platform developed by 10x genomics. The reverse transcription primers used in this technology are all Poly(dT) reverse transcription primers, which are used to capture transcripts with polyA tails. By combining miRNA transcripts with mRNA transcripts, it is possible to explore more systematic and detailed network operation mechanisms, answer more complex biological problems, and gain deeper insights into biological mechanisms.

[0004] We have currently developed a method to use pri-miRNA to identify miRNA expressed in single-cell transcriptomes. However, since some pri-miRNAs are too short, existing conventional transcriptome library construction methods cannot capture these small fragments. Therefore, we urgently need a suitable method to enrich 100-300bp cDNA as a method to supplement miRNA transcript information.

[0005] At present, the conventional 10x single-cell sequencing library construction process cannot effectively identify more pri-miRNAs. One of the important limiting factors is the inability to enrich small fragments. There are two common methods for sorting target nucleic acids of different sizes. One is gel cutting and recovery, but its experimental method is cumbersome, time-consuming, and the product recovery efficiency is low. The sorting of small fragments requires professional knowledge, and ultraviolet irradiation is dangerous and can easily cause mutations in nucleic acid bases. Another method is described in the conventional 10x single-cell sequencing library construction process, which uses polyethylene glycol (PEG) and sodium chloride to separate and precipitate nucleic acids and sort out the target nucleic acid fragments, but it takes a long time to process, the operation is complicated, and the ability to sort small fragment cDNA is weak. Summary of the invention

[0006] In order to solve the deficiencies in the prior art, the present invention proposes a new technical solution, a method for enriching small fragment cDNA of single cell sequencing for identifying miRNA expression in single cell transcriptome, the present invention adopts SPRI Slect magnetic beads to sort library fragments, and adds PEG 10000, isopropanol and trichlorohexammine cobalt complex to the magnetic bead binding solution to effectively improve the enrichment effect of small fragments (100-300bp). At the same time, in order to further increase the content of cDNA enriched in small fragments, the reverse transcription system and cDNA PCR amplification system are improved. And the improvement / improvement degree of the enrichment effect achieved by the present invention can be clearly distinguished from the existing 10X Genomics magnetic bead binding solution.

[0007] One of the purposes of the present invention is to propose a method for enriching small fragment cDNA for single-cell sequencing that is simple, has a high recovery rate, and can achieve high throughput. The library fragments are sorted using SPRI Slect magnetic beads, and PEG10000, isopropanol, and trichlorohexammine cobalt complex are added to the magnetic bead binding solution to improve the enrichment efficiency of small fragments of 100 to 300 bp.

[0008] The method comprises the following steps:

[0009] (1) Sample preparation: According to the 10X Genomics single cell transcriptome library kit ChromiumNext GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contains RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4Gene 32Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1 to 1.5h. ;

[0010] (2) Prepare cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer, 5× Platinum TM II PCRBuffer 10μl, 10mM dNTP mix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase (Invitrogen TM , 14966100)0.8μl, 5μg SSB (Thermo Scientific TM , 70032Z500UG), all cDNA templates in the previous step;

[0011] (3) cDNA linear amplification;

[0012] (4) PCR product purification;

[0013] (5) cDNA quality inspection: Use Qubit to measure and record the concentration of the purified cDNA, and use the quality inspection instrument Agilent4150Tape Station to inspect the obtained cDNA and record the size of the cDNA fragment;

[0014] (6) cDNA 5′ end phosphorylation;

[0015] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: adapter fragment (NEB, E7335L) 10μM; 10x T4 DNA Ligase buffer 5μl; poly-lysine (Sigma, P3150-100MG) 4mM; T4 DNA ligase (Thermo Scientific, EL0016) 3U. Add H2O to 50μl; incubate the reaction mixture at 22℃ for 10min. Then incubate at 70℃ for 15min to inactivate T4 DNA ligase;

[0016] (8) Enzyme-cleaved linker:

[0017] (9) performing PCR amplification on the cDNA after the adapter ligation;

[0018] (10) Prepare DNA fragment sorting and purification reagents; the magnetic bead binding solution contains 400 mM Tris pH 8.0 (Invitrogen, 15567027), 1 M guanidine thiocyanate (Sigma-Aldrich, G9277-100G), 0.1% Tween-20 (Sigma-Aldrich, P9416-50ML), 7% (W / V) PEG10000 (Sigma-Aldrich, 8218811000), 0.2 mM trichlorohexammine cobalt (Sigma-Aldr ich, 481521-100G), 40% (V / V) isopropanol (Sigma-Aldrich, I9030-100ML) and 50 mg / ml SPRI magnetic particles; the washing solution was 80% anhydrous ethanol (Sanggong, A500737-0500); the elution solution was DNase- and RNase-free sterile water (Invitrogen TM , AM9916);

[0019] (11) cDNA fragment screening; First SPRI-based size selection: Take a new PCR tube, add the cDNA from the previous step, mix the cDNA sample from the previous step with SPRI select magnetic beads (0.75x), vortex to mix, and leave at room temperature for 5 minutes. After the end, place the PCR tube on a magnetic stand and let it stand for 3 minutes. Transfer the supernatant to a new PCR tube for use.

[0020] Second SPRI-based size selection: Add SPRI select magnetic beads (0.2x) to the supernatant in the previous step, vortex to mix, and leave at room temperature for 10 minutes. After the end, place the PCR tube on a magnetic stand for 3 minutes, discard the supernatant, wash the magnetic beads twice with 80% ethanol, then air dry, and finally use elution buffer to elute the target fragment cDNA.

[0021] Specifically, the steps are:

[0022] (1) Sample preparation: According to the 10X Genomics single cell transcriptome library kit ChromiumNext GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contains RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4Gene 32Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0023] (2) Prepare cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer, 5× Platinum TM II PCRBuffer 10μl, 10mM dNTP mix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase (Invitrogen TM , 14966100)0.8μl, 5μg SSB (Thermo Scientific TM , 70032Z500UG), all cDNA templates in the previous step.

[0024] (3) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 58°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument and perform cDNA amplification according to the above PCR amplification program.

[0025] (4) PCR product purification: Purify the PCR product according to the instructions of 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent (BECKMAN, B23319) to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of supernatant into a new PCR tube.

[0026] (5) cDNA quality inspection: Use Qubit to measure and record the concentration of the purified cDNA, and use the quality inspection instrument Agilent4150Tape Station to inspect the obtained cDNA and record the size of the cDNA fragment.

[0027] (6) Phosphorylation of cDNA 5′ end: Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase (Thermo Scientific TM , EK0032) 10U, ATP 10mM, 10x reaction buffer 4μl, ddH2O to 40μl. The reaction mixture was incubated at 37°C for 20min and then incubated at 70°C for 15min to inactivate T4 polynucleotide kinase.

[0028] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: adapter fragment (NEB, E7335L) 10 μM; 10x T4 DNA Ligase buffer 5 μl; poly-lysine (Sigma, P3150-100MG) 4 mM; T4 DNA ligase (Thermo Scientific, EL0016) 3 U. Add H2O to 50 μl; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0029] (8) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer (NEB, B6004SVIAL) 2 μl; User enzyme (NEB, M5505L) 3 μl. The reaction was incubated at 37°C for 15 min.

[0030] (9) PCR amplification of the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix (NEB, M0544L) 40 μl, i7 index primer 2 μl, i5 index primer 2 μl. The reaction was carried out under the following conditions: 98°C pre-denaturation for 30 s, 98°C denaturation for 10 s, 60°C annealing / extension for 65 s, final extension for 5 min, 10 cycles. Store at 4°C.

[0031] (10) Preparation of DNA fragment sorting and purification reagents: The magnetic bead binding solution contains 400 mM Tris pH 8.0 (Invitrogen, 15567027), 1 M guanidine thiocyanate (Sigma-Aldrich, G9277-100G), 0.1% Tween-20 (Sigma-Aldrich, P9416-50ML), 7% (W / V) PEG10000 (Sigma-Aldrich, 8218811000), 0.2 mM trichlorohexammine cobalt (Sigma-Aldr ich, 481521-100G), 40% (V / V) isopropanol (Sigma-Aldrich, I9030-100ML) and 50 mg / ml dapoxetine. SPRI magnetic particles; the washing solution was 80% anhydrous ethanol (Sanggong, A500737-0500); the elution solution was DNase- and RNase-free sterile water (Invitrogen TM , AM9916).

[0032] (11) cDNA fragment screening

[0033] The first SPRI-based size selection: Take a new PCR tube, add the cDNA from the previous step, mix the cDNA sample from the previous step with SPRI select magnetic beads (0.75x), vortex to mix, and leave at room temperature for 5 minutes. After the end, place the PCR tube on a magnetic stand and let it stand for 3 minutes. Transfer the supernatant to a new PCR tube for use.

[0034] Second SPRI-based size selection: Add SPRI select magnetic beads (0.2x) to the supernatant in the previous step, vortex to mix, and leave at room temperature for 10 minutes. After the end, place the PCR tube on a magnetic stand for 3 minutes, discard the supernatant, wash the magnetic beads twice with 80% ethanol, then air dry, and finally use elution buffer to elute the target fragment cDNA.

[0035] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0036] (13) High-throughput sequencing: Subsequent single-cell sequencing analysis was performed with a sequencing depth of 30K reads / cell.

[0037] In step (1), the steps are all performed using 10x Genomics Chromium Single Cell 3′v3.1 (CG000204·Rev D) gel bead kit according to conventional operations. The amount of T4 Gene32 Protein in the reverse transcription system is 1 to 7 μg, preferably 5 μg. The reverse transcription time is 1 to 1.5 hours, preferably 1.5 hours.

[0038] In step (2), the cDNA amplification mixed solution comprises: 2 μM to 8 μM primers, 0.5× to 2× Platinum TM II Taq Hot-Start DNA Polymerase, 4-6 μg SSB, all cDNA templates from the previous step. Preferably, the final concentration of primers is 4 μM, Platinum TM The final dosage of II Taq Hot-Start DNA Polymerase is 2×, and the dosage of SSB is 5 μg. The primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1).

[0039] In step (3), the cDNA amplification: set the PCR amplification program: pre-denaturation at 94°C for 2 minutes, denaturation at 94°C for 15 seconds, annealing at 58°C for 20 seconds, extension at 68°C for 1 minute, 20 cycles, final extension at 68°C for 1 minute, and hold at 4°C. The prepared PCR mixture containing the PBMC cDNA template is placed on a PCR instrument for cDNA amplification. Preferably, the annealing temperature is 58°C and the number of cycles is 20.

[0040] In step (3), the PCR instrument is a Long Gene-T30D super gradient PCR instrument.

[0041] In step (4), the magnetic beads are SPRIselect Reagent (BECKMAN, B23319). The ethanol concentration is 70% to 80%, preferably, the ethanol concentration is 80%.

[0042] In step (5), the quality inspection instruments are Qubit 4 fluorimeter (Thermo Fisher Q33238) and automated electrophoresis system (Agilent 4150 TapeStation).

[0043] In step (6), the amount of T4 polynucleotide kinase used is 1 to 10 U, preferably, the amount of T4 polynucleotide kinase used is 10 U; the incubation time at 37° C. is 15 to 30 min, preferably, the incubation time at 37° C. is 30 min.

[0044] In step (7), the ligase is T4 DNA ligase (Thermo Scientific, EL0016); the amount of polylysine is 0.1-5 mM, preferably, the amount of polylysine is 4 mM; the ligation reaction conditions are 22° C. and the incubation time is 10-30 min, preferably, the incubation time is 10 min; the linker refers to a synthetic self-complementary DNA fragment, and the linker sequence is: 5′- / 5Phos / GATCGGAAGAGCACACGTCTGAACTCCAGTCdnACACTCTTTCCCTACACGACGCTCTTCCGATC-sT-3′ (SEQ ID NO.2).

[0045] Among them, n in SEQ ID NO.2 is U base, which is added as a restriction site, and the U base is subsequently specifically removed by the enzyme User.

[0046] In step (8), the User enzyme cleavage time is 10 to 30 minutes, preferably, the cleavage time is 15 minutes.

[0047] In step (9), the cDNA after the adapter ligation is subjected to PCR amplification: the following ligation reaction mixture is added to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 20μl, i7 index primer 1μl, i5 indexprimer 1μl. The reaction is carried out according to the following conditions: 98°C pre-denaturation for 30s, 98°C denaturation for 10s, 60°C annealing / extension for 65s, final extension for 5min, 10 to 20 cycles. Store at 4°C. Preferably, the number of cycles is 20.

[0048] In step (10), the DNA fragment sorting and purification reagent is prepared: the magnetic bead binding solution contains 1-400mM Tris pH8.0, 1mM-1M guanidine thiocyanate, 0.1% Tween-20, 5%-8% (W / V) PEG10000, 0.05-1mM trichlorohexammine cobalt complex, 30%-40% (V / V) isopropanol and 20-50mg / ml SPRI magnetic particles; the washing solution is 70%-80% anhydrous ethanol; the elution solution is DNase-free and RNase-free sterile water.

[0049] Preferably, the final concentration of Tris pH 8.0 is 400 mM; the final concentration of guanidine thiocyanate is 1 M, the final concentration of PEG10000 is 7% (W / V), the final concentration of trichlorohexammine cobalt complex is 0.2 mM, the final concentration of isopropanol is 40% (V / V), the final concentration of SPRI magnetic particles is 50 mg / ml, and the final concentration of anhydrous ethanol is 80%.

[0050] In step (11), the first SPRI-based size selection is performed using nucleic acid purification magnetic beads by controlling the percentage concentration ratio of PEG10000, isopropanol and trichlorohexammine cobalt complex, and the magnetic bead supernatant is collected to recover nucleic acid fragments below 300 nt.

[0051] In step (11), the second SPRI-based size selection is performed using nucleic acid purification magnetic beads by controlling the percentage concentration ratio of PEG10000, isopropanol and trichlorohexammine cobalt complex to recover the nucleic acid fragments adsorbed on the nucleic acid purification magnetic beads, and the length of the nucleic acid fragments is greater than 100 nt.

[0052] In step (11), the molecular weight of PEG is preferably 4000-10000, more preferably 10000. The pH of the magnetic bead binding solution is 7-8, more preferably pH 8. The magnetic beads are ferroferric oxide particles with a hydrophilic polymer medium coated on the surface and having an active functional group hydroxyl group, and the particles are super compliant.

[0053] In step (12), the quality inspection instruments are Qubit 4 fluorimeter (Thermo Fisher Q33238) and automated electrophoresis system (Agilent 4150 TapeStation).

[0054] The beneficial effect of the present invention is that the present invention innovatively integrates DNA linear amplification and magnetic bead small fragment sorting technology with the 10xGenomics single-cell library construction method, solving the problem of small fragment Pri mRNA data loss caused by insufficient small fragment enrichment capacity in the single-cell sequencing process in the prior art. The present invention has broad application prospects. DETAILED DESCRIPTION

[0055] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0056] Embodiment 1:

[0057] (1) Sample preparation: The experimental operation was performed according to the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contained RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4 Gene32 Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0058] (2) Preparation of cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 5× Platinum TM II PCRBuffer 10μl, 10mM dNTPmix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase 0.8μl, 5μg SSB, all cDNA templates from the previous step.

[0059] (3) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 60°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0060] (4) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0061] (5) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0062] (6) cDNA 5′ end phosphorylation

[0063] Add the following reaction mixture to the PCR tube: 500ng cDNA captured in the previous step; T4 polynucleotide kinase 10U, ATP 10mM, 10x reaction buffer 4μl, ddH2O to 40μl. Incubate the reaction mixture at 37℃ for 20min. Then incubate at 70℃ for 15min to inactivate T4 polynucleotide kinase.

[0064] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 4 mM poly-lysine (Sigma, P3150-100MG); 3 U T4 DNA ligase (ThermoScientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0065] (8) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0066] (9) Perform PCR amplification on the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 40μl, i7 index primer 2μl, i5 indexprimer 2μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0067] (10) Preparation of DNA fragment sorting and purification reagents

[0068] The magnetic bead binding solution contains 400mM Tris pH 8.0, 1M guanidine thiocyanate, 0.1% Tween-20, 7% (W / V) PEG10000, 0.2mM trichlorohexammine cobalt complex, 40% (V / V) isopropanol and 50mg / ml SPRI magnetic particles; the washing solution is 80% anhydrous ethanol; the elution solution is DNase and RNase-free sterile water.

[0069] (11) cDNA fragment screening

[0070] The first SPRI-based size selection: Take a new PCR tube, add the cDNA from the previous step, mix the cDNA sample from the previous step with SPRI select magnetic beads (0.75x), vortex to mix, and leave at room temperature for 5 minutes. After the end, place the PCR tube on a magnetic stand and let it stand for 3 minutes. Transfer the supernatant to a new PCR tube for use.

[0071] Second SPRI-based size selection: Add SPRI select magnetic beads (0.2x) to the supernatant in the previous step, vortex to mix, and leave at room temperature for 10 minutes. After the end, place the PCR tube on a magnetic stand for 3 minutes, discard the supernatant, wash the magnetic beads twice with 80% ethanol, then air dry, and finally use elution buffer to elute the target fragment cDNA.

[0072] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0073] (13) High-throughput sequencing: Subsequent single-cell sequencing analysis was performed with a sequencing depth of 30K reads / cell.

[0074] The results are shown in Table 1.

[0075] Embodiment 2:

[0076] (1) Sample preparation: The experimental operation was performed according to the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contained RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4 Gene32 Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0077] (2) Preparation of cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 5× Platinum TM II PCRBuffer 10μl, 10mM dNTPmix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase 0.8μl, 5μg SSB, all cDNA templates from the previous step.

[0078] (3) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 60°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0079] (4) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0080] (5) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0081] (6) cDNA 5′ end phosphorylation

[0082] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0083] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 4 mM poly-lysine (Sigma, P3150-100MG); 3 U T4 DNA ligase (ThermoScientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0084] (8) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0085] (9) Perform PCR amplification on the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 40μl, i7 index primer 2μl, i5 index primer 2μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0086] (10) Preparation of DNA fragment sorting and purification reagents

[0087] The magnetic bead binding solution contains 400mM Tris pH 8.0, 1M guanidine thiocyanate, 0.1% Tween-20, 7% (W / V) PEG10000, 0.2mM trichlorohexammine cobalt complex, 40% (V / V) isopropanol and 50mg / ml SPRI magnetic particles; the washing solution is 80% anhydrous ethanol; the elution solution is DNase and RNase-free sterile water.

[0088] (11) cDNA fragment screening

[0089] The first SPRI-based size selection: Take a new PCR tube, add the cDNA from the previous step, mix the cDNA sample from the previous step with SPRI select magnetic beads (0.75x), vortex to mix, and leave at room temperature for 5 minutes. After the end, place the PCR tube on a magnetic stand and let it stand for 3 minutes. Transfer the supernatant to a new PCR tube for use.

[0090] Second SPRI-based size selection: Add SPRI select magnetic beads (0.2x) to the supernatant in the previous step, vortex to mix, and leave at room temperature for 10 minutes. After the end, place the PCR tube on a magnetic stand for 3 minutes, discard the supernatant, wash the magnetic beads twice with 80% ethanol, then air dry, and finally use elution buffer to elute the target fragment cDNA.

[0091] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0092] (13) High-throughput sequencing: Subsequent single-cell sequencing analysis was performed with a sequencing depth of 30K reads / cell.

[0093] The results are shown in Table 1.

[0094] Embodiment 3:

[0095] (1) Sample preparation: The experimental operation was performed according to the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contained RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4 Gene32 Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0096] (2) Preparation of cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 5× Platinum TM II PCRBuffer 10μl, 10mM dNTPmix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase 0.8μl, 5μg SSB, all cDNA templates from the previous step.

[0097] (3) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 60°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0098] (4) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0099] (5) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0100] (6) cDNA 5′ end phosphorylation

[0101] Add the following reaction mixture to the PCR tube: 50ng cDNA captured in the previous step; T4 polynucleotide kinase 10U, ATP 10mM, 10x reaction buffer 4μl, ddH2O to 40μl. Incubate the reaction mixture at 37℃ for 20min. Then incubate at 70℃ for 15min to inactivate T4 polynucleotide kinase.

[0102] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 4 mM poly-lysine (Sigma, P3150-100MG); 3 U T4 DNA ligase (ThermoScientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0103] (8) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0104] (9) PCR amplification of the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 40μl, i7 index primer 2μl, i5 index primer 2μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0105] (10) Preparation of DNA fragment sorting and purification reagents

[0106] The magnetic bead binding solution contains 400mM Tris pH 8.0, 1M guanidine thiocyanate, 0.1% Tween-20, 7% (W / V) PEG10000, 0.2mM trichlorohexammine cobalt complex, 40% (V / V) isopropanol and 50mg / ml SPRI magnetic particles; the washing solution is 80% anhydrous ethanol; the elution solution is DNase and RNase-free sterile water.

[0107] (11) cDNA fragment screening

[0108] The first SPRI-based size selection: Take a new PCR tube, add the cDNA from the previous step, mix the cDNA sample from the previous step with SPRI select magnetic beads (0.75x), vortex to mix, and leave at room temperature for 5 minutes. After the end, place the PCR tube on a magnetic stand and let it stand for 3 minutes. Transfer the supernatant to a new PCR tube for use.

[0109] Second SPRI-based size selection: Add SPRI select magnetic beads (0.2x) to the supernatant in the previous step, vortex to mix, and leave at room temperature for 10 minutes. After the end, place the PCR tube on a magnetic stand for 3 minutes, discard the supernatant, wash the magnetic beads twice with 80% ethanol, then air dry, and finally use elution buffer to elute the target fragment cDNA.

[0110] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0111] (13) High-throughput sequencing: Subsequent single-cell sequencing analysis was performed with a sequencing depth of 30K reads / cell.

[0112] The results are shown in Table 1.

[0113] Comparative Example 1

[0114] In this comparative example, the cDNA conventional exponential amplification program in the 10X Genomins 3'V3.1 library construction manual was used to construct the library.

[0115] (1) Human PBMC single-cell isolation: Obtain PBMC single-cell suspension according to conventional PBMC single-cell isolation methods.

[0116] (2) Sample preparation: The experimental procedure was performed according to the 10X Genomics single-cell transcriptome library kit Chromium Next GEMSingle Cell 3′ Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels.

[0117] (3) Preparation of cDNA amplification reagent: The components of the amplification mixed solution are: Amp Mix 50 μl (10x Genomics Chromium Next GEM Single Cell 3′ Reagent Kits v3.1), cDNA primer 1 μM (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO.1)), and first-strand cDNA template 35 μl.

[0118] (4) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 60°C for 20 s, extension at 68°C for 1 min, 13 cycles, final extension at 68°C for 1 min, hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0119] (5) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0120] (6) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0121] (7) cDNA 5′ end phosphorylation

[0122] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0123] (8) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 3 Weiss U of T4 DNA ligase (Thermo Scientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 25 min to inactivate T4 DNA ligase.

[0124] (9) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0125] (10) Perform PCR amplification on the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 20μl, i7 index primer 1μl, i5 index primer 1μl. Perform the reaction under the following conditions: pre-denaturation at 98℃ for 30s, denaturation at 98℃ for 10s, annealing / extension at 60℃ for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0126] (11) Library fragment screening was performed according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 library construction kit.

[0127] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0128] (13) High-throughput sequencing: conduct subsequent single-cell sequencing analysis.

[0129] The results are shown in Table 2.

[0130] Comparative Example 2

[0131] In this comparative example, the reverse transcription time in the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′ Reagent Kits v3.1 (CG000204·Rev D) was extended to 1 h, and the remaining steps were the same as those in Comparative Example 1.

[0132] (1) Human PBMC single-cell isolation: Obtain PBMC single-cell suspension according to conventional PBMC single-cell isolation methods.

[0133] (2) Sample preparation: The experimental operation was performed according to the 10X Genomics single cell transcriptome library kit ChromiumNext GEMSingle Cell 3′ Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription time was extended from the original 45 minutes to 1 hour.

[0134] (3) Preparation of cDNA amplification reagent: The components of the amplification mixed solution are: Amp Mix 50 μl (10x Genomics Chromium Next GEM Single Cell 3′ Reagent Kits v3.1), cDNA primer 1 μM (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO.1)), and first-strand cDNA template 35 μl.

[0135] (4) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 60°C for 20 s, extension at 68°C for 1 min, 13 cycles, final extension at 68°C for 1 min, hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0136] (5) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0137] (6) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0138] (7) cDNA 5′ end phosphorylation

[0139] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0140] (8) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 3 Weiss U of T4 DNA ligase (Thermo Scientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 25 min to inactivate T4 DNA ligase.

[0141] (9) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0142] (10) PCR amplification of the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 20μl, i7 index primer 1μl, i5 index primer 1μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0143] (11) Library fragment screening was performed according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 library construction kit.

[0144] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0145] (13) High-throughput sequencing: Perform subsequent single-cell sequencing analysis.

[0146] The results are shown in Table 2.

[0147] Comparative Example 3

[0148] In this comparative example, the reverse transcription time in the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′ Reagent Kits v3.1 (CG000204·Rev D) was extended to 1.5 h, and the remaining steps were the same as those in Comparative Example 1.

[0149] The results are shown in Table 2.

[0150] Comparative Example 4

[0151] In this comparative example, 5 μg of T4Gene 32 Protein (NEB) was added to the reverse transcription system in the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′ Reagent Kits v3.1 (CG000204·Rev D), and the reverse transcription time was extended to 1.5 h. The remaining steps were the same as those in Comparative Example 1.

[0152] Comparative Example 5

[0153] In this comparative example, the number of cDNA amplification cycles in the 10X Genomins 3'V3.1 library construction instructions was increased to 20, and the remaining steps were the same as those in Comparative Example 1.

[0154] (1) Human PBMC single-cell isolation: Obtain PBMC single-cell suspension according to conventional PBMC single-cell isolation methods.

[0155] (2) Sample preparation: The experimental procedure was performed according to the 10X Genomics single-cell transcriptome library kit ChromiumNext GEMSingle Cell 3′ Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels.

[0156] (3) Preparation of cDNA amplification reagent: The components of the amplification mixed solution are: Amp Mix 50 μl (10x Genomics Chromium Next GEM Single Cell 3′ Reagent Kits v3.1), cDNA primer 1 μM (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO.1)), and first-strand cDNA template 35 μl.

[0157] (4) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 60°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0158] (5) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0159] (6) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0160] (7) cDNA 5′ end phosphorylation

[0161] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0162] (8) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 3 Weiss U of T4 DNA ligase (Thermo Scientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 25 min to inactivate T4 DNA ligase.

[0163] (9) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0164] (10) PCR amplification of the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 20μl, i7 index primer 1μl, i5 index primer 1μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0165] (11) Library fragment screening was performed according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 library construction kit.

[0166] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0167] (13) High-throughput sequencing: conduct subsequent single-cell sequencing analysis.

[0168] The results are shown in Table 2.

[0169] Comparative Example 6

[0170] In this comparative example, the number of cDNA amplification cycles in the 10X Genomins 3'V3.1 library construction instructions was reduced to 10, and the remaining steps were the same as those in Comparative Example 1.

[0171] The results are shown in Table 2.

[0172] Comparative Example 7

[0173] In this comparative example, the number of library amplification cycles in the 10X Genomins 3'V3.1 library construction instructions was increased to 20, and the remaining steps were the same as those in comparative example 1.

[0174] The results are shown in Table 2.

[0175] Comparative Example 8

[0176] The amplification enzyme used in this comparative example is Platinum TM II Taq Hot-Start DNA Polymerase PCR Kit (Roche, kk2602) was used to amplify cDNA according to the instructions of the reagent, and the remaining steps were the same as those in Comparative Example 5.

[0177] (1) Human PBMC single-cell isolation: Obtain PBMC single-cell suspension according to conventional PBMC single-cell isolation methods.

[0178] (2) Sample preparation: The experimental procedure was performed according to the 10X Genomics single-cell transcriptome library kit ChromiumNext GEMSingle Cell 3′ Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels.

[0179] (3) Prepare a PCR amplification mixed solution. The amplification mixed solution contains: 1 μM cDNA primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 1× Platinum TM II Taq Hot-Start DNA Polymerase, all cDNA templates from the previous step.

[0180] (4) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 60°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0181] (5) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0182] (6) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0183] (7) cDNA 5′ end phosphorylation

[0184] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0185] (8) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 3 Weiss U of T4 DNA ligase (Thermo Scientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 10 min. Then incubate at 70°C for 25 min to inactivate T4 DNA ligase.

[0186] (9) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0187] (10) Perform PCR amplification on the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 20μl, i7 index primer 1μl, i5 index primer 1μl. Perform the reaction under the following conditions: pre-denaturation at 98℃ for 30s, denaturation at 98℃ for 10s, annealing / extension at 60℃ for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0188] (11) Library fragment screening was performed according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 library construction kit.

[0189] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0190] (13) High-throughput sequencing: conduct subsequent single-cell sequencing analysis.

[0191] The results are shown in Table 3.

[0192] Comparative Example 9

[0193] In this comparative example, the final concentration of the cDNA primer is increased to 2 μM, and the remaining steps are completely consistent with those in comparative example 8.

[0194] The results are shown in Table 3.

[0195] Comparative Example 10

[0196] In this comparative example, the final concentration of the cDNA primer is increased to 4 μM, and the remaining steps are completely consistent with those in comparative example 8.

[0197] The results are shown in Table 3.

[0198] Comparative Example 11

[0199] In this comparative example, the final concentration of the cDNA primer is increased to 8 μM, and the remaining steps are completely consistent with those in comparative example 8.

[0200] The results are shown in Table 3.

[0201] Comparative Example 12

[0202] This comparative example uses a conventional PCR amplification procedure, and the annealing temperature for cDNA amplification is set to 58° C. The remaining operating steps and reagent usage are consistent with those of comparative example 10.

[0203] The results are shown in Table 4.

[0204] Comparative Example 13

[0205] This comparative example uses a conventional PCR amplification procedure, and the annealing temperature for cDNA amplification is set to 65° C. The remaining operating steps and reagent usage are consistent with those of comparative example 10.

[0206] The results are shown in Table 4.

[0207] Comparative Example 14

[0208] SSB was used as a PCR reaction additive, 5 μg SSB was added to the cDNA amplification reaction system, and the remaining operation steps and reagent usage were consistent with Comparative Example 12.

[0209] The results are shown in Table 4.

[0210] Comparative Example 15

[0211] SSB was used as a PCR reaction additive. 6 μg SSB was added to the cDNA amplification reaction system, and the remaining operation steps and reagents used were consistent with those in Comparative Example 12.

[0212] The results are shown in Table 4.

[0213] Comparative Example 16

[0214] SSB was used as a PCR reaction additive. 4 μg SSB was added to the cDNA amplification reaction system, and the remaining operation steps and reagents used were consistent with those in Comparative Example 12.

[0215] The results are shown in Table 4.

[0216] Comparative Example 17

[0217] This comparative example uses Platinum TM II Taq Hot-Start DNA Polymerase dosage was reduced to 0.5×, and the remaining operation steps and reagent usage were consistent with Comparative Example 14.

[0218] The results are shown in Table 4.

[0219] Comparative Example 18

[0220] This comparative example uses Platinum TM II Taq Hot-Start DNA Polymerase dosage was reduced to 0.2×, and the remaining operation steps and reagent usage were consistent with Comparative Example 14.

[0221] The results are shown in Table 4.

[0222] Comparative Example 19

[0223] This comparative example uses Platinum TM II Taq Hot-Start DNA Polymerase dosage was increased to 2×, and the remaining operation steps and reagent usage were consistent with Comparative Example 14.

[0224] The results are shown in Table 4.

[0225] Comparative Example 20

[0226] In this comparative example, the amplified cDNA was electrophoresed using a freshly prepared 2% agarose gel, and the 100-300 bp library fragment was recovered according to the instructions of the Qiagen QIAquick Gel Extraction Kit (28704). The remaining steps were the same as those in Comparative Example 19.

[0227] (1) Sample preparation: The experimental operation was performed according to the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contained RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4 Gene32 Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0228] (2) Preparation of cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 5× Platinum TM II PCRBuffer 10μl, 10mM dNTPmix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase 0.8μl, 5μg SSB, all cDNA templates from the previous step.

[0229] (3) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 58°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0230] (4) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0231] (5) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0232] (6) cDNA 5′ end phosphorylation

[0233] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0234] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 3 U T4 DNA ligase (Thermo Scientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 25 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0235] (8) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0236] (9) PCR amplification of the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 40μl, i7 index primer 2μl, i5 index primer 2μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0237] (10) Use fresh TAE / TBE buffer and freshly prepared 2% agarose gel electrophoresis to separate the cDNA fragments. After the fragments are completely separated, quickly cut the desired bands under ultraviolet light. The DNA exposure time under ultraviolet light should not exceed 30 seconds.

[0238] (11) Recover 100-300 bp library fragments according to the Qiagen QIAquick Gel Extraction Kit (28704) instructions.

[0239] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0240] (13) High-throughput sequencing: Subsequent single-cell sequencing analysis was performed with a sequencing depth of 30K reads / cell.

[0241] The results are shown in Table 6.

[0242] Comparative Example 21

[0243] In this comparative example, the amplified library was treated with Invitrogen E-Gel TM EX 2% agarose gel electrophoresis was performed, and 100-300 bp library fragments were recovered according to the instructions of the Thermo Scientific GeneJET gel recovery kit. The remaining steps were the same as those in Comparative Example 19.

[0244] (1) Sample preparation: According to the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contained RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4 Gene32 Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0245] (2) Preparation of cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 5× Platinum TM II PCRBuffer 10μl, 10mM dNTPmix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase 0.8μl, 5μg SSB, all cDNA templates from the previous step.

[0246] (3) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 58°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0247] (4) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0248] (5) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0249] (6) cDNA 5′ end phosphorylation

[0250] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0251] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 3 U T4 DNA ligase (Thermo Scientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 25 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0252] (8) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0253] (9) Perform PCR amplification on the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 40μl, i7 index primer 2μl, i5 index primer 2μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0254] (10) Using Invitrogen E-Gel TM EX 2% agarose gel electrophoresis was used to separate cDNA fragments. After the fragments were completely separated, the desired bands were quickly cut out under ultraviolet light. The exposure time of DNA under ultraviolet light should not exceed 30s.

[0255] (11) Recover 100-300 bp library fragments according to the instructions of the Thermo Scientific GeneJET Gel Extraction Kit.

[0256] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0257] (13) High-throughput sequencing: Subsequent single-cell sequencing analysis was performed with a sequencing depth of 30K reads / cell.

[0258] The results are shown in Table 6.

[0259] Comparative Example 22

[0260] In this comparative example, the amplified library was screened by magnetic bead method, and the magnetic bead binding solution was prepared: 400mMTris pH 8.0, 1M guanidine isothiocyanate, 0.1% Tween-20, 6% (W / V) PEG4000, 30% (V / V) isopropanol and 50mg / ml SPRI magnetic particles. The remaining steps were the same as those in comparative example 19.

[0261] (1) Sample preparation: The experimental operation was performed according to the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contained RT Reagent B 18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4 Gene32 Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0262] (2) Preparation of cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 5× Platinum TM II PCRBuffer 10μl, 10mM dNTPmix 1μl, 2×Platinum TM II Taq Hot-Start DNA Polymerase 0.8μl, 5μg SSB, all cDNA templates from the previous step.

[0263] (3) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 58°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0264] (4) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0265] (5) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0266] (6) cDNA 5′ end phosphorylation

[0267] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0268] (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 3 U T4 DNA ligase (Thermo Scientific, EL0016). Make up to 50 μl with H2O; incubate the reaction mixture at 22°C for 25 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0269] (8) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0270] (9) Perform PCR amplification on the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 40μl, i7 index primer 2μl, i5 indexprimer 2μl. Perform the reaction under the following conditions: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing / extension for 65s, final extension for 5min, 10 cycles. Store at 4℃.

[0271] (9) Preparation of DNA fragment sorting and purification reagents

[0272] The magnetic bead binding solution contains 400mM Tris pH 8.0, 1M guanidine thiocyanate, 0.1% Tween-20, 6% (W / V) PEG4000, 30% (V / V) isopropanol and 50mg / ml SPRI magnetic particles; the washing solution is 80% anhydrous ethanol; and the elution solution is DNase- and RNase-free sterile water.

[0273] (10) cDNA fragment screening

[0274] The first SPRI-based size selection: Take a new PCR tube, add the cDNA from the previous step, mix the cDNA sample from the previous step with SPRI select magnetic beads (0.75x), vortex to mix, and leave at room temperature for 5 minutes. After the end, place the PCR tube on a magnetic stand and let it stand for 3 minutes. Transfer the supernatant to a new PCR tube for use.

[0275] Second SPRI-based size selection: Add SPRI select magnetic beads (0.2x) to the supernatant in the previous step, vortex to mix, and leave at room temperature for 10 minutes. After the end, place the PCR tube on a magnetic stand for 3 minutes, discard the supernatant, wash the magnetic beads twice with 80% ethanol, then air dry, and finally use elution buffer to elute the target fragment cDNA.

[0276] (11) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0277] (12) High-throughput sequencing: Subsequent single-cell sequencing analysis was performed with a sequencing depth of 30K reads / cell.

[0278] The results are shown in Table 6.

[0279] Comparative Example 23

[0280] In this comparative example, the amplified library was screened by magnetic bead method, 6% PEG10000 and 30% isopropanol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0281] The results are shown in Table 6.

[0282] Comparative Example 24

[0283] In this comparative example, the amplified library was screened by magnetic bead method, 6% PEG10000 and 35% isopropanol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0284] The results are shown in Table 6.

[0285] Comparative Example 25

[0286] In this comparative example, the amplified library was screened for fragments using a magnetic bead method, and 6% PEG10000 and 40% isopropanol were used in the preparation of the magnetic bead binding solution, while other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0287] The results are shown in Table 6.

[0288] Comparative Example 26

[0289] In this comparative example, the amplified library was screened by magnetic bead method, 7% PEG10000 and 30% isopropanol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0290] The results are shown in Table 6.

[0291] Comparative Example 27

[0292] In this comparative example, the amplified library was screened by magnetic bead method, 7% PEG10000 and 35% isopropanol were used to prepare magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0293] The results are shown in Table 6.

[0294] Comparative Example 28

[0295] In this comparative example, the amplified library was screened for fragments using a magnetic bead method, and 7% PEG10000 and 40% isopropanol were used in the preparation of the magnetic bead binding solution, while other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0296] The results are shown in Table 6.

[0297] Comparative Example 29

[0298] In this comparative example, the amplified library was screened by magnetic bead method, 8% PEG10000 and 30% isopropanol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0299] The results are shown in Table 6.

[0300] Comparative Example 30

[0301] In this comparative example, the amplified library was screened by magnetic bead method, 8% PEG10000 and 35% isopropanol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0302] The results are shown in Table 6.

[0303] Comparative Example 31

[0304] In this comparative example, the amplified library was screened for fragments using a magnetic bead method, and 8% PEG10000 and 40% isopropanol were used to prepare the magnetic bead binding solution, while other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0305] The results are shown in Table 6.

[0306] Comparative Example 32

[0307] In this comparative example, the amplified library was screened by magnetic bead method, 9% PEG10000 and 30% isopropanol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0308] The results are shown in Table 6.

[0309] Comparative Example 33

[0310] In this comparative example, the amplified library was screened for fragments using a magnetic bead method, and 9% PEG10000 and 35% isopropanol were used in the preparation of the magnetic bead binding solution, while other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0311] The results are shown in Table 6.

[0312] Comparative Example 34

[0313] In this comparative example, the amplified library was screened by magnetic bead method, 9% PEG10000 and 40% isopropanol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0314] The results are shown in Table 6.

[0315] Comparative Example 35

[0316] In this comparative example, the amplified library was screened by magnetic bead method, 7% PEG10000 and 40% methanol were used to prepare magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0317] The results are shown in Table 7.

[0318] Comparative Example 36

[0319] In this comparative example, the amplified library was screened by magnetic bead method, 7% PEG10000 and 40% pentanediol were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 19.

[0320] The results are shown in Table 7.

[0321] Comparative Example 37

[0322] In this comparative example, the amplified library was screened by magnetic bead method, and 7% PEG10000, 40% isopropanol and 10 mM sodium chloride were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 28.

[0323] The results are shown in Table 8.

[0324] Comparative Example 38

[0325] In this comparative example, the amplified library was screened by magnetic bead method, and 7% PEG10000, 40% isopropanol and 10 mM magnesium chloride were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 28.

[0326] The results are shown in Table 8.

[0327] Comparative Example 39

[0328] In this comparative example, the amplified library was screened by magnetic bead method, and 7% PEG10000, 40% isopropanol and 10 mM trichlorohexammine cobalt complex were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 28.

[0329] The results are shown in Table 8.

[0330] Comparative Example 40

[0331] In this comparative example, the amplified library was screened by magnetic bead method, and 7% PEG10000, 40% isopropanol and 1 mM trichlorohexammine cobalt complex were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 28.

[0332] The results are shown in Table 8.

[0333] Comparative Example 41

[0334] In this comparative example, the amplified library was screened by magnetic bead method, and 7% PEG10000, 40% isopropanol and 0.2 mM trichlorohexammine cobalt complex were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 28.

[0335] The results are shown in Table 8.

[0336] Comparative Example 42

[0337] In this comparative example, the amplified library was screened by magnetic bead method, and 7% PEG10000, 40% isopropanol and 0.05 mM trichlorohexammine cobalt complex were used in the preparation of magnetic bead binding solution, and other components remained unchanged. The remaining steps were the same as those in comparative example 28.

[0338] The results are shown in Table 8.

[0339] Comparative Example 43

[0340] In this comparative example, 1 mM PEG 4000 was added to the cDNA plus linker reaction system, and the remaining operation steps and reagent usage were consistent with those in comparative example 41.

[0341] (1) Human PBMC single-cell isolation: Obtain PBMC single-cell suspension according to conventional PBMC single-cell isolation methods.

[0342] (2) Sample preparation: The experimental operation was performed according to the 10X Genomics single cell transcriptome library kit ChromiumNext GEMSingle Cell 3′Reagent Kits v3.1 (CG000204·Rev D), and the human PBMC sample RNA captured by Poly(dT) was reverse transcribed into the first-strand cDNA with cell labels. The reverse transcription system contained RT Reagent B18.8μl, Template Switch Oligo 2.4μl, and RT Enzyme C 8.7μl. 5μg T4Gene 32 Protein (NEB, M0300L) was added to the reverse transcription system, and the reverse transcription time was 1.5h.

[0343] (3) Prepare a PCR amplification mixed solution. The components of the amplification mixed solution are: 4 μM cDNA primer (the primer sequence is: AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO. 1)), 5 μg SSB, 2× Platinum TM II Taq Hot-Start DNA Polymerase, all cDNA templates from the previous step.

[0344] (4) cDNA amplification: Set the PCR amplification program as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 58°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, hold at 4°C. Place the prepared PCR mixture containing the PBMC cDNA template on a PCR instrument for cDNA amplification.

[0345] (5) PCR product purification: Purify the PCR product according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 Library Construction Kit. After the PCR reaction, add 1.2×SPRIselect Reagent to the sample, mix well, incubate at room temperature for 5 min, transfer to a magnetic rack until the solution is clear, discard the supernatant, add 200 μl of freshly prepared 80% ethanol, let stand at room temperature for 30 s, discard the supernatant, repeat once, air dry, add 22 μl Buffer EB, mix well, incubate at room temperature for 2 min, transfer to a magnetic rack until the solution is clear, and aspirate 20 μl of the supernatant into a new PCR tube.

[0346] (6) cDNA quality inspection: The concentration of the purified cDNA was determined and recorded using Qubit, and the obtained cDNA was quality inspected using the quality inspection instrument Agilent 4150 Tape Station, and the size of the cDNA fragments was recorded.

[0347] (7) cDNA 5′ end phosphorylation

[0348] Add the following reaction mixture to the PCR tube: 100 ng cDNA captured in the previous step; T4 polynucleotide kinase 10 U, ATP 10 mM, 10x reaction buffer 4 μl, ddH2O to 40 μl. Incubate the reaction mixture at 37°C for 20 min. Then incubate at 70°C for 15 min to inactivate T4 polynucleotide kinase.

[0349] (8) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: 10 μM adapter fragment; 5 μl 10xT4 DNA Ligase buffer; 1 mM PEG 4000; T4 DNA ligase (Thermo Scientific, EL0016) 3 Weiss U. Add H2O to 50 μl; incubate the reaction mixture at 22°C for 17 min. Then incubate at 70°C for 15 min to inactivate T4 DNA ligase.

[0350] (9) Enzyme-cutting adapter: Add 10x rCutSmart TM Buffer 2μl; User enzyme 3μl. The reaction was incubated at 37℃ for 15min.

[0351] (10) Perform PCR amplification on the cDNA after linker ligation: Add the following ligation reaction mixture to the PCR tube in the previous step: NEBNext Ultra Q5 Master Mix 20 μl, i7 index primer 1 μl, i5 index primer 1 μl. Perform the reaction under the following conditions: 98°C pre-denaturation for 30 s, 98°C denaturation for 10 s, 60°C annealing / extension for 65 s, final extension for 5 min, 20 cycles. Store at 4°C.

[0352] (11) Library fragment screening was performed according to the instructions of the 10x Genomics Chromium Single Cell 3′v3.1 library construction kit.

[0353] (12) Library quality control: The library concentration was determined and recorded using Qubit, and the obtained library was quality checked using the quality control instrument Agilent 4150 Tape Station, and the library fragment size was recorded.

[0354] (13) High-throughput sequencing: conduct subsequent single-cell sequencing analysis.

[0355] The results are shown in Table 9.

[0356] Comparative Example 44

[0357] In this comparative example, 1 mM polylysine was added to the cDNA plus linker reaction system, and the remaining operating steps and reagent usage were consistent with those in comparative example 41.

[0358] The results are shown in Table 9.

[0359] Comparative Example 45

[0360] In this comparative example, 4 mM polylysine was added to the cDNA plus linker reaction system, and the remaining operating steps and reagent usage were consistent with those in comparative example 41.

[0361] The results are shown in Table 9.

[0362] The present invention proposes a simple method with high recovery rate and high throughput to enrich small fragment cDNA for single cell sequencing for identification of miRNA expression in single cell transcriptome. The cDNA linear amplification and magnetic bead small fragment sorting method described in the present invention can be directly grafted into the conventional 10x Genomics single cell library construction standard process, solving the defect of small fragment Pri mRNA data loss caused by insufficient small fragment enrichment capacity in the current single cell sequencing process.

[0363] According to the experimental results of Examples 1 to 3 of the present invention provided in Table 1 of the present invention, it is shown that the experimental method provided by the present invention can meet the requirements of a starting sample amount of cDNA of more than 50 ng for library construction, and at the same time enrich small fragment cDNA of single-cell sequencing for identification of miRNA expression in single-cell transcriptome, and various quality indicators of the experiment meet the ideal requirements.

[0364] Table 1 Examples 1 to 3

[0365]

[0366] In order to develop a method for identifying miRNA expression in a single-cell transcriptome by enriching small fragment cDNA of a single cell, the present invention conducted a series of comparative experiments, and the results are shown in Comparative Examples 1 to 45. A series of explorations were conducted from the aspects of RNA transcription conditions, cDNA amplification methods, amplification conditions, and optimization of magnetic bead binding liquid systems, and the contents of the present invention were obtained through creative research.

[0367] Comparative Example 1 uses the current conventional 10X Genomins 3'V3.1 single cell library construction instructions to construct a library for the obtained human-PBMC sample, and the results are shown in Table 2: Comparative Example 1 Under the conventional 10X Genomins 3'V3.1 library construction method, the sample cDNA quality is within the normal range, but after subsequent small fragment library sorting, only a very small amount of small fragment library is finally enriched, and it is difficult to detect the expression information of miRNA in the single cell transcriptome by sending the sorted library for sequencing. The small amount of small fragment library may be caused by low reverse transcription yield, and this situation is changed by extending the reverse transcription time. Comparative Examples 2 to 3 increase the reverse transcription time to 1h and 1.5h, and the results show that the cDNA concentration is increased compared with Comparative Example 1. The cDNA yield obtained by increasing the reverse transcription time by 1.5h compared with 1h of reverse transcription did not increase significantly. The results showed that although the cDNA concentration of Comparative Examples 2 to 3 increased compared with Comparative Example 1, the yield of the small fragment library was low after sorting, and it was difficult to detect the expression information of miRNA in the single cell transcriptome by sending the sorted library for sequencing. Therefore, simply increasing the reverse transcription time cannot increase the yield of the small fragment library. From the perspective of improving the reverse transcription efficiency of RNA, the problem of RNA secondary structure cannot be ignored, because the reverse transcriptase will terminate the reaction or fall off from the template after encountering such a structure. T4 gene 32protein is a single-stranded DNA binding protein that increases the yield and extension capacity of reverse transcription during RT-PCR. By introducing T4 Gene 32Protein during the reverse transcription process, the results in Table 2 show that the cDNA concentration of Comparative Example 4 increased compared with Comparative Example 3 after introducing T4 Gene32Protein during the reverse transcription process, and the cDNA yield increased significantly accordingly, but the concentration of the small fragment library was low after sorting, and did not meet the sequencing standard on the machine. In summary, the present invention selects to introduce T4 Gene 32 Protein into the 10X Genomins 3'V3.1 reverse transcription system.

[0368] Next, the present invention conducts a series of exploratory experiments on cDNA amplification methods and amplification conditions. First, the cDNA amplification cycle number and library amplification cycle number are increased by comparative examples 5 to 11. The results of comparative examples 5 to 6 show that the cDNA amplification cycle number is increased to 20, and the cDNA yield is increased accordingly, but the dimer small fragments increase, and the yield after the small fragment library is sorted is low, which does not meet the sequencing standard on the machine. The reduction of the cDNA amplification cycle number leads to a corresponding reduction in cDNA yield and a reduction in dimer small fragments. Comparative example 7 increases the library amplification cycle number to 20, but the yield after the small fragment library is sorted does not reach the ideal effect. It is thus determined that simply changing the amplification cycle number and the library amplification cycle number is not enough to improve the quality of the small fragment library. Secondly, the way to solve the loss of gene fragments in ordinary transcriptome sequencing also includes: changing the high-fidelity DNA polymerase, increasing the primer concentration, and changing the PCR amplification program. The results are shown in Table 3. Comparative Example 5 used the amplification enzyme provided in 10x Genomics Chromium Next GEM SingleCell 3′Reagent Kits v3.1 for amplification, but the cDNA concentration after amplification was extremely low. After increasing the number of amplification cycles, it still did not reach the ideal library construction concentration, and the product after cDNA amplification had small bands. Reducing the number of amplification cycles can avoid the appearance of small bands in the product. Comparative Example 8 used a cDNA amplification enzyme with hot start, Platinum TM IITaq Hot-Start DNAPolymerase (Invitrogen TM ,14966001) and amplified according to the instructions. The enzyme introduced a single deoxyadenosine (A) at the 3' end of the amplified product. The results are shown in Table 3. TM II Taq Hot-Start DNA Polymerase, the cDNA concentration increased, and the cDNA amplification bands were observed, and there were basically no dimer bands, but the ideal library construction concentration was still not reached. Therefore, the cDNA primer concentration was adjusted based on the conditions of Comparative Example 8, and the final concentrations of cDNA primers were adjusted to 2μM, 4μM and 8μM in Comparative Examples 9 to 11. The results are shown in Table 3. When the final concentration of cDNA primers was increased to 4μM, the cDNA concentration increased, and the dimer bands were less, but the ideal library construction concentration was not reached; the final concentration of cDNA primers was 8μM, and the concentration of the cDNA product obtained was highly increased, but the PCR product dimer bands were more.

[0369] On the other hand, since the Tm value of cDNA primer is 60°C, the PCR annealing temperature was explored by comparing Examples 12 to 13. The results are shown in Table 3. When the annealing temperature is set to 58°C, the concentration of cDNA after quality inspection is relatively good. The lower annealing temperature leads to non-specific amplification of small bands after cDNA amplification. When the annealing temperature is set to 65°C, the concentration of cDNA product decreases slightly. It may be that the annealing temperature is set too high, which affects the ineffective combination of primers and templates and fails to promote cDNA amplification. Comprehensively judged, in the cDNA amplification system, the amplification enzyme uses Platinum TM II Taq Hot-Start DNA Polymerase, cDNA primer concentration was 4 μM, and annealing temperature during cDNA amplification was 58°C.

[0370] Table 2 Comparative Examples 1-4

[0371]

[0372] Table 3 Comparative Examples 5-13

[0373]

[0374] Based on the verification of comparative examples 1-13, a method for improving the efficiency of reverse transcription, as well as a series of conditions such as high-fidelity DNA polymerase, cDNA primer concentration, and cDNA amplification cycle number that can increase the yield of cDNA have been determined. However, small dimer bands are prone to appear at high cycle numbers. For this reason, it is necessary to find a method to achieve the purpose of both improving the efficiency of cDNA amplification and reducing small dimer fragments. Single-Stranded DNA Binding Protein (SSB) synergistically binds single-stranded DNA with high affinity, and its binding degree to double-stranded DNA is not high. After binding to single-stranded DNA, SSB makes the helical dimer unstable, so that the DNA polymerase can more easily contact the substrate. PCR can be optimized by adding this binding protein to the reaction solution. SSB can be added during the PCR experiment to stabilize the denatured DNA, and it can also be used as a PCR reaction additive to protect ssDNA from being digested by nucleases. Studies have shown that SSB can improve the PCR performance under complex templates by directly or indirectly acting on the polymerase, increasing the chain displacement activity and the affinity for the primer template. In the present invention, SSB (Thermo Scientific, 70032Z500UG) is used as a cDNA amplification reaction additive. The results are shown in Table 4. When 5 μg SSB is added to the cDNA amplification reaction system in Comparative Example 14, the concentration of the cDNA amplification product is significantly improved. The most suitable amount of SSB is explored. The results of Comparative Examples 15 to 16 show that when 6 μg SSB is added to the cDNA amplification reaction system, the concentration of the cDNA amplification product and the library is not significantly improved compared with Comparative Example 14. When 4 μg SSB is added to the cDNA amplification reaction system, the concentration of the cDNA amplification product and the library is reduced compared with Comparative Example 14. Therefore, after comprehensive judgment, it is finally determined to use 5 μg SSB to improve the efficiency of the cDNA amplification reaction.

[0375] Since SSB makes the helical dimer unstable, allowing DNA polymerase to more easily contact the substrate, changing the amount of DNA polymerase may further improve the cDNA amplification efficiency. TM IITaq Hot-Start DNA Polymerase dosage, with cDNA quality as the quality control index. As shown in Table 4, the results of Comparative Examples 17 to 19 show that Platinum TM II Taq Hot-Start DNA Polymerase dosage was reduced to 0.5× and 0.2×, and the quality of cDNA products increased with the increase of Platinum TMII Taq Hot-Start DNA Polymerase, and the amount of Platinum TM II Taq Hot-Start DNA Polymerase dosage was increased to 2×, the PCR product concentration was improved, and the dimer bands were less.

[0376] Therefore, the present invention determines that in the cDNA amplification system, the amplification enzyme uses 2×Platinum TM II Taq Hot-Start DNA Polymerase, cDNA primer concentration was 4 μM, SSB dosage was 5 μg, PCR amplification conditions were pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 58°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and hold at 4°C.

[0377] Table 4 Comparative Examples 14-19

[0378]

[0379]

[0380] Comparative Example 19: The library was screened for fragments according to the conventional 10X Genomins 3'V3.1 single-cell library construction instructions. The results are shown in Table 5: The quality of the sample cDNA was within the normal range. After fragment sorting, the concentration of the enriched small fragment library was very low and did not meet the ideal sequencing requirements. Even though Platinum TM II Taq Hot-Start DNA Polymerase dosage was increased to 2×, and 20 cycles of PCR amplification were performed. It was determined that the low concentration of small fragment library may be due to the fact that the magnetic bead system used in the conventional 10XGenomins 3'V3.1 single cell library fragment sorting process is not suitable for the enrichment of small fragment library, and the cohesion of small fragment DNA is weak, and it is impossible to screen enough small fragment libraries under limited binding capacity. After the various parameters of cDNA amplification were determined, the cDNA concentration was greatly improved and met the requirements for library construction. Next, the library fragment size screening conditions need to be explored and improved.

[0381] At present, a large number of comparative examples have shown that in order to enrich high-quality single-cell sequencing small fragment libraries, the method of increasing cDNA production alone is not feasible, and the method of directly targeting small fragment library enrichment may be a way to solve the problem. Therefore, in the present invention, two methods for sorting DNA fragments of different sizes are tried. One method is to use conventional agarose gel cutting to recover the target fragment, and the other method is to increase the DNA cohesion by optimizing the magnetic bead binding liquid system, so as to directly capture the small fragments that are easily lost in conventional single-cell transcriptome sequencing. First, conventional agarose gel cutting is used to recover the target fragment. Comparative Examples 20 and 21 separate DNA fragments of different sizes by setting 2% agarose gel electrophoresis, and use a gel recovery kit to recover small fragment DNA. The experimental results are shown in Table 5. Comparative Examples 20 to 21 use gel recovery kits purchased on the market to screen small fragments of the library, and refer to the sequencing standards of the illumina Hiseq 2500 sequencing platform to make a comprehensive comparison and judgment based on the quality of the library. The results show that the concentration of the small fragment library enriched by the gel cutting recovery kit method is very low, which fails to meet the requirements of on-machine sequencing. The possible reason is that the small fragment DNA is lost a lot during the gel recovery process, resulting in low quality of the small fragment library. Therefore, it is judged that the gel recovery kit solution cannot achieve the purpose of the present invention. Directly improving the magnetic bead sorting system and targeting small fragment cDNA enrichment may be a way to solve the problem.

[0382] Table 5 Comparative Examples 20-21

[0383]

[0384] The existing 10X Genomins 3'V3.1 magnetic bead system is difficult to achieve the ideal small fragment enrichment effect, and we began to try to make a homemade magnetic bead sorting system to recover the small fragment library in the solution. And with the different dosages of the main reagents of the magnetic bead system, it has the selective recovery ability for DNA fragments of different molecular weights. Comparative Example 22 uses 6% (W / V) PEG4000 and 30% (V / V) isopropanol to prepare the magnetic bead binding liquid system, and the concentration of the small fragments sorted is low. Comparative Example 23 uses 6% (W / V) PEG10000 and 30% (V / V) isopropanol to prepare the magnetic bead binding liquid system, and the concentration of the small fragments sorted is improved.

[0385] Next, comparative examples 24 to 34 explore the best combination of PEG10000 and isopropanol dosage when other conditions remain unchanged. After a series of comparisons of parameter combinations, the results are shown in Table 6. The cDNA amounts obtained by PEG10000 of several concentrations are not much different. Among them, the data of 7% PEG10000 and 40% isopropanol combination perform best, and the concentration of small fragment library enriched is greatly improved, and the library quality inspection concentration meets the requirements of the machine. In comparative examples 35 and 36, the present invention attempts to prepare magnetic bead binding liquid by replacing isopropanol with two alcohols (methanol and pentanediol). The results are shown in Table 7. The data of 40% isopropanol performs best, and the concentration of small fragment enriched is the best. In summary, the magnetic bead binding liquid system prepared by 7% PEG10000 and 40% isopropanol is determined.

[0386] Studies have shown that the interaction of ions plays an important role in the DNA condensation process. The laws of physics dictate that in order to bring negatively charged DNA fragments close to each other, their negative charges must be neutralized in large quantities to overcome the strong mutual repulsion. The present invention attempts a series of verification experiments to explore the effects of monovalent sodium ions, divalent magnesium ions, and trivalent cobalt ions on the DNA condensation effect, and further improves the small fragment enrichment effect of the magnetic bead system in the present invention. Comparative Examples 37 to 39 were compared with a series of parameter combinations, and the results are shown in Table 8. 10mM sodium chloride, 10mM magnesium chloride, and 10mM trichlorohexammine cobalt complex were introduced into the homemade magnetic bead binding liquid system, respectively. The comparison results show that trichlorohexammine cobalt complex is best for improving the small fragment enrichment ability of the magnetic bead binding liquid, so it is decided to introduce chlorohexammine cobalt complex into the magnetic bead binding liquid system.

[0387] Comparative Examples 39 to 42 explored the optimal dosage of trichlorohexaamine cobalt complex, and the results showed that the introduction of 10mM trichlorohexaamine cobalt complex can effectively improve the concentration of the enriched small fragment library. The trichlorohexaamine cobalt dosage reduced to 1mM and 0.05mM does not bring about an increase in the overall small fragment library concentration. The trichlorohexaamine cobalt dosage reduced to 0.2mM can significantly improve the enriched small fragment cDNA library concentration, reaching the ideal sequencing requirements. Comprehensively judged, the data of the magnetic bead binding liquid sorting system of 7% PEG10000, 40% isopropanol, and 0.2mM trichlorohexaamine cobalt complex combination performed best. Based on the above results, 7% PEG10000, 40% isopropanol, and 0.2mM trichlorohexaamine cobalt complex combination were finally selected to form a magnetic bead binding liquid sorting system.

[0388] In the cDNA plus adapter reaction system, increasing DNA cohesion may improve the connection efficiency and shorten the reaction time. Therefore, comparative examples 43 to 45 attempt to add 1mM PEG 4000 and 1mM polylysine to the cDNA plus adapter reaction system. The results are shown in Table 9. Under the background of obtaining similar library data under the same conditions, after adding 1mM polylysine, the reaction time can be shortened to 15min, which saves 2min compared to adding 1mM PEG 4000. Comparative Example 45 further adjusts the amount of polylysine, and the results show that after adding 4mM polylysine, the reaction time can be shortened to 10min, greatly shortening the reaction time. In summary, in the cDNA plus adapter reaction system, adding 4mM polylysine can improve the connection efficiency and shorten the connection reaction time.

[0389] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention rather than all the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

[0390] Table 6 Comparative Examples 22-34

[0391]

[0392]

[0393]

[0394] Table 7 Comparative Examples 35-36

[0395]

[0396] Table 8 Comparative Examples 37-42

[0397]

[0398]

[0399] Table 9 Comparative Examples 43-45

[0400]

Claims

1. A method for enriching small fragment cDNA for single cell sequencing, characterized in that: SPRI Slect magnetic beads are used to sort library fragments, and the magnetic bead binding solution contains 400mM Tris pH 8.0, 1M guanidine isothiocyanate, 0.1% Tween-20, 7% W / V PEG10000, 0.2mM trichlorohexammine cobalt complex, 40% V / V isopropanol and 50mg / ml SPRI magnetic particles to improve the enrichment of small fragments of 100-300bp; the method is used to identify miRNA expression in single-cell transcriptomes.

2. The method according to claim 1, characterized in that The method comprises the following steps: (1) Sample preparation: Experimental operation was performed according to the 10X Genomics single cell transcriptome library kit Chromium Next GEMSingle Cell 3′ Reagent Kits v3.1, and the human PBMC sample RNA captured by Poly dT was reverse transcribed into the first-strand cDNA with cell labels; wherein the reverse transcription system contained 18.8 μl of RT Reagent B, 2.4 μl of Template Switch Oligo, and 8.7 μl of RT Enzyme C; 5 μg of T4 Gene32 Protein was added to the reverse transcription system, and the reverse transcription time was 1 to 1.5 h; (2) Prepare cDNA amplification mixed solution: The components of the amplification mixed solution are: 4 μM primer, 10 μl 5×PlatinumTMIIPCRBuffer, 1 μl 10 mM dNTP mix, 0.8 μl 2×Platinum TM II Taq Hot-Start DNA Polymerase, 5 μg SSB, and all cDNA templates from the previous step; (3) cDNA linear amplification; (4) PCR product purification; (5) cDNA quality inspection: Use Qubit to measure and record the concentration of the purified cDNA, and use the quality inspection instrument Agilent4150Tape Station to inspect the obtained cDNA and record the size of the cDNA fragment; (6) cDNA 5′ end phosphorylation; (7) cDNA plus adapter: Add the following ligation reaction mixture to the PCR tube in the previous step: adapter fragment 10 μM; 10x T4 DNA Ligase buffer 5 μl; poly-lysine 0.1-5 mM; T4 DNA ligase 3 U, H2O to 50 μl; incubate the reaction mixture at 22°C for 10 min, and then incubate at 70°C for 15 min to inactivate T4 DNA ligase; (8) Enzyme-cleaved linker: (9) Performing PCR amplification on the cDNA after linker ligation to obtain a PCR product, i.e., the amplified cDNA: (10) Preparation of DNA fragment sorting and purification reagents: the magnetic bead binding solution contains 400 mM Tris pH 8.0, 1 M guanidine thiocyanate, 0.1% Tween-20, 7% W / V PEG10000, 0.2 mM cobalt trichloride hexammine complex, 40% V / V isopropanol and 50 mg / ml SPRI magnetic particles; the washing solution is 80% anhydrous ethanol; the elution solution is DNase- and RNase-free sterile water; (11) cDNA fragment screening; First SPRI-based size selection: Take the cDNA amplified in step (9) into a new PCR tube, add 0.75x SPRI select magnetic beads, vortex to mix, and place at room temperature for 5 minutes. After the end, place the PCR tube on a magnetic stand and let it stand for 3 minutes. Transfer the supernatant to a new PCR tube for use; Second SPRI-based size selection: Add 0.2x SPRI select magnetic beads to the supernatant in the previous step, vortex to mix, and leave at room temperature for 10 minutes. After the end, place the PCR tube on a magnetic stand for 3 minutes, discard the supernatant, wash the magnetic beads twice with 80% ethanol, then air dry, and finally use elution buffer to elute the target fragment cDNA.

3. The method according to claim 2, characterized in that In step (2), the primer is as shown in SEQ ID NO.

1.

4. The method according to claim 2, characterized in that In step (3), the cDNA linear amplification is as follows: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 58°C for 20 s, extension at 68°C for 1 min, 20 cycles, final extension at 68°C for 1 min, and holding at 4°C.

5. The method according to claim 2, characterized in that In step (6), the cDNA 5′ end phosphorylation step is as follows: the following reaction mixture is added to a PCR tube: 100 ng cDNA captured in step (5); 10 U of T4 polynucleotide kinase, 10 mM ATP, 4 μl of 10x reaction buffer, and ultrapure water to make up to 40 μL.

6. The method according to claim 5, characterized in that In step (6), the reaction mixture was incubated at 37°C for 20 min.

7. The method according to claim 2, characterized in that In step (8), the specific steps are: Join 10xrCutSmart TM Buffer 2 μl; User enzyme 3 μl; the reaction was incubated at 37°C for 15 min.

8. Use of the method for enriching small fragment cDNA for single-cell sequencing as described in any one of claims 1 to 7 in identifying miRNA expression in single-cell transcriptome.

Images