Application of SNP molecular markers associated with birth weight traits in Landrace pigs

Abstract

The present invention belongs to the technical field of pig molecular marker screening, and specifically relates to an application of a SNP molecular marker related to the birth weight trait of Landrace pigs. By collecting ear samples of Landrace pigs, extracting genomic DNA and performing quality inspection, genotyping is performed by GeneSeek Porcine50K SNP high-density chip to obtain SNP typing data, and a SNP molecular marker related to the birth weight trait of pigs is obtained by screening. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, and there is a G / T allele mutation (replacement) at the 51st base of the sequence, and the mutation (replacement) causes the nucleotides of the sequence to produce polymorphism. When the 51st nucleotide of the sequence shown in SEQ ID NO:1 is G, it is determined that the pig has a larger birth weight.

Description

Technical Field

[0001] The present invention belongs to the technical field of pig molecular marker screening, and specifically relates to a SNP molecular marker related to the birth weight trait of Landrace pigs and its application. The molecular marker of the present invention can be used for auxiliary prediction and selection of the birth weight trait of Landrace pigs. Background Art

[0002] Landrace pigs are one of the world's famous lean pig breeds. They have the characteristics of fast growth, high feed conversion rate, and high lean meat rate. They are generally used as the first sire (i.e., the sire used to crossbreed with the base sow to produce dual-purpose sows) (Li Runfan 1994). Piglet birth weight is an important factor affecting the economic benefits of the pig farm. It has a very important impact on the survival rate, growth rate, and time to market of piglets (Li Shihao et al. 2021). Birth weight plays a vital role in the early healthy growth and later fattening of piglets, so it is very important to study the trait of birth weight.

[0003] Genome-wide Association Study (GWAS) is a genome-wide association analysis of common SNP sites on the phenotype of interest, screening out the differences in genotype frequencies of marker sites between the control group and the experimental group, and finding genetic marker sites that are significantly associated with the phenotype (Pulina et al. 2019). Currently, genome-wide association analysis has been widely used in various studies, including human diseases and important economic traits of livestock (Visscher PM et al., 2012).

[0004] There are many factors that affect piglet birth weight, and it is difficult to accurately identify the main effect genes using conventional genetic methods. However, whole genome association analysis based on high-density SNP chips or sequencing provides an effective technical means for locating candidate genes for complex diseases or quantitative traits (Yin Jianliang et al. 2017). At present, most of the research on birth weight traits remains on the statistical analysis of phenotypes, while the whole genome association analysis related to it has the reasons of small sample number and single breed, so it is necessary to expand the breed or number of pigs for further research.

[0005] The ear tissues of 1820 Landrace pigs from a pig farm in southern China were collected, DNA of the ear tissues was extracted and quality tested, and genotyping was performed using GeneSeek Porcine 50K SNP high-density chip to obtain genotype data and corresponding phenotypic data. The MVP package of R language and the FarmCPU model (Liu X et al., 2016) were used to screen out SNP molecular markers related to the birth weight of Landrace pigs, which provided a new method for the development of molecular markers for the prediction of the birth weight of Landrace pigs, and was of great significance for improving the breeding and reproduction efficiency of pigs.

[0006] The correlation between the SNP molecular marker screened by the present invention and the birth weight trait of Landrace pigs reaches a significant level, providing a new resource for the research related to the birth weight trait. Summary of the invention

[0007] The purpose of the present invention is to overcome the defects of the prior art, screen an application of SNP molecular markers related to the birth weight trait of Landrace pigs, obtain SNP typing data by genotyping through GeneSeek Porcine 50K SNP high-density chip, use GWAS to screen SNPs significantly associated with the birth weight trait of Landrace pigs, and provide a new method for predicting the birth weight of pigs.

[0008] The technical solution of the present invention is as follows:

[0009] The applicant collected ear samples of Landrace pigs from a pig farm in southern China, extracted genomic DNA and performed quality testing, and then used GeneSeek Porcine 50K SNP high-density chip to perform genotyping to obtain SNP typing data. Referring to the Ensembl database, the nucleotide sequence of 50 bp upstream and downstream of the accession number rs340374353 fragment was obtained, and the nucleotide sequence is shown in the sequence table SEQ ID NO: 1. The specific sequence is as follows:

[0010]

[0011] The K at the 51st base of the above sequence is a G / T allele (substitution) mutation, and the (substitution) mutation causes the above sequence, ie, the sequence described in SEQ ID NO: 1, to produce nucleotide polymorphism.

[0012] The present invention has developed a molecular marker using the above fragment as a predictor of pig birth weight. When the 51st nucleotide on SEQ ID NO: 1 is G, it is determined that the birth weight of Landrace pigs may increase.

[0013] The above sequence can be used as a molecular marker for breeding the birth weight trait of Landrace pigs and its application.

[0014] The applicant provides a method for screening SNP molecular markers related to the birth weight trait of Landrace pigs, wherein the method comprises the following steps:

[0015] The applicant screened and obtained a SNP molecular marker related to the birth weight trait of Landrace pigs. The nucleotide sequence of the molecular marker is as follows:

[0016]

[0017] The K at the 51st base of the above sequence is replaced by G or T, and this replacement causes polymorphism in the above sequence.

[0018] Based on a SNP molecular marker associated with the birth weight trait of Landrace pigs, when the 51st nucleotide of the sequence shown in SEQ ID NO: 1 is G, it is determined that the birth weight of the pig may increase.

[0019] The SNP molecular marker of the present invention can be used for the prediction and selection of pig birth weight.

[0020] The specific steps of the present invention are:

[0021] ①By collecting ear samples from Landrace pigs from a pig farm in southern China, genomic DNA was extracted and quality tested, and genotyping was performed using the GeneSeek Porcine 50K SNP high-density chip to obtain SNP typing data.

[0022] ② The phenotypic data of 1811 Landrace pigs from a pig farm in southern China were collected and the newborn phenotypes were redefined.

[0023] ③ The FarmCPU model in the MVP package under R language was used to perform genome-wide association study (GWAS).

[0024] The model formula is as follows: i =M i1 b1+M i2 b2+...+M it b t +S ij d j +e i (1) where y i is the observed value of the trait of the ith individual; M i1 , M i2 , ..., M it is the genotype of the t possible associated sites added to the model. This part is empty in the first iteration; b1, b2, ..., b t is the corresponding effect value of the possible associated site added to the model; S ij is the genotype of the jth genetic marker of the ith individual; d j YesS ij The corresponding effect value of i is the residual vector;

[0025] y i =u i +e i (2)y i is the observed value of the trait of the ith individual; u iis the total genetic effect of the ith individual; e i The residual vector model (2) generates possible associated sites as covariates and adds them to the model (1) for iterative calculation until it stops.

[0026] The molecular markers screened by the present invention can be applied to the association analysis of the genotype of genes related to pig birth weight traits or related traits for non-diagnostic purposes, providing new molecular marker resources for molecular marker-assisted selection of pig birth weight traits.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention can detect the genotype of pigs by using gene chip technology in vitro, and improve the detection and analysis of the birth weight of Landrace pigs for non-diagnostic purposes. Compared with the current conventional PCR-RFLP and other methods, the present invention has the advantages of simplicity, rapidity, high sensitivity, etc.

[0029] For more detailed technical solutions, please refer to "Specific Implementation Methods". BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : Schematic diagram of the overall technical process of the present invention.

[0031] Figure 2 : The 50 bp nucleotide sequences of the upstream and downstream of the molecular marker rs340374353 screened by the present invention and the nucleotide sequence of the molecular marker of the present invention. Figure 2 There is a G / T allele mutation at the 51st base of the nucleotide marker shown (the English letter "K" at 51bp is the mutation site).

[0032] Figure 3 : Manhattan plot of the genome-wide association analysis of the present invention. Explanation of the accompanying symbols: The research object is the pig birth weight trait, and the markers pointed by the black circle and arrow are the molecular markers screened by the present invention, and the markers are located on the 13th chromosome of the pig. DETAILED DESCRIPTION

[0033] Description of the sequence listing:

[0034] SEQ ID NO: 1 is the nucleotide sequence of the molecular marker associated with the birth weight trait of Landrace pigs screened by the present invention, and the sequence length is 101 bp. There is an allele mutation (replacement) at the 51 bp of the sequence (i.e., G / T base replacement. For the convenience of preparing the nucleotide sequence table, the base at 51 bp in the sequence table of the present application document is the mutated (replaced) base G as an example). The above replacement or mutation causes the nucleotide sequence shown in SEQ ID NO: 1 to produce polymorphism.

[0035] The sequence and whole genome association analysis results in the present invention are based on the pig genome version 11.1.

[0036] Example 1: Genotyping and detection

[0037] Landrace pig ear samples were collected from a pig farm in southern China, genomic DNA was extracted and quality tested, and SNP typing data were obtained by genotyping using the GeneSeek Porcine 50K SNP high-density chip.

[0038] Use Plink1.9 software to convert the raw data into VCF format, and then use this software to perform quality control on the VCF format file, specifically:

[0039] 1) maf 0.01: remove SNP sites with a minimum allele frequency of less than 1%;

[0040] 2) geno 0.1: remove SNP sites with genotype detection rate less than 90%;

[0041] 3) mind 0.1: individuals with genotype missing rate greater than 10% were eliminated;

[0042] 4) hwe le-6: remove SNP sites with Hardy-Weinberg equilibrium test P value less than 10-6,

[0043] 5) Use Beagle 4.1 software to fill missing genotypes in the chip data after quality control. The command is as follows:

[0044] java-jar-Xmx8g beagle.jar gt=qc.file.vcf out=example.impute

[0045] (2) The genotype data were tested, and finally 1,820 individuals and 34,985 SNPs were used for genome-wide association analysis.

[0046] Example 2: Methods for genome-wide association analysis of pig birth weight traits

[0047] The birth weight phenotype of Landrace pigs used for genotype association analysis came from a pig farm in southern China, with a total of 1,820 individuals. The FarmCPU model in the MVP package under R language was used to perform genome-wide association analysis (GWAS). The specific model formula is as follows: i =M i1 b1+M i2 b2+...+M it b t +S ij d j +ei (1) where y i is the observed value of the trait of the ith individual; M i1 , M i2 , …, M it is the genotype of the t possible associated sites added to the model. This part is empty in the first iteration; b1, b2, ..., b t is the corresponding effect value of the possible associated site added to the model; S ij is the genotype of the jth genetic marker of the ith individual; d j YesS ij The corresponding effect value of i is the residual vector; y i =u i +e i (2)y i is the observed value of the trait of the ith individual; u i is the total genetic effect of the ith individual; e i The residual vector model (2) generates possible associated sites as covariates and adds them to the model (1) for iterative calculation until it stops.

[0048] The significance level of the whole genome association analysis of the present invention is shown in Table 1.

[0049] Table 1 Significant level of genome-wide association analysis of rs340374353

[0050] SNP ID chromosome number Location P-value WU_10.2_13_186219264 13 175654090 5.55E-07

[0051] Table 1 Description: The significant marker level is P value <0.05 / 34985 (Bonferroni correction)

[0052] Example 3: Application of rs340374353 molecular marker typing method in pig birth weight trait association analysis / rs340374353 molecular marker (sequence list SWQ ID NO: 1) and pig birth weight trait association analysis:

[0053] A mixed linear model (MLM) was used to analyze the association between the rs340374353 molecular marker and pig birth weight traits. The specific model is as follows:

[0054] y ijklm =μ+G i +LC j +Sex+ID l +ε ijklm

[0055] Among them, y ijklm is the phenotypic value of the weight trait of the mth individual at birth, μ is the population mean; G i is the genotype effect, LCj is birth order and litter size (fixed effects); Sex is the sex factor (fixed effect); ID l is the individual additive effect (random effect), ε ijklm is the model residual effect. The F test was used to analyze the significance of the differences in birth weight among the three genotype individuals. The analysis results are shown in Table 2.

[0056] Table 2 Polymorphism of accession number rs340374353 fragment

[0057]

[0058]

[0059] Table 2 Description: P < 0.05 indicates significant difference; P < 0.01 indicates extremely significant difference.

[0060] As shown in Table 2, individuals with genotype GG may have a larger birth weight, while individuals with genotype TT may have a smaller birth weight. In the genome-wide association analysis using the FarmCPU model, the rs340374353 marker reached a genome-wide significant level, indicating that the marker is not only significantly associated with the pig's birth weight trait, but also that when the marker mutates to G, it is beneficial for the pig to have a larger birth weight.

[0061] Sequence Listing SEQ ID NO: 1 is the nucleotide sequence of 50 bp upstream and downstream of the molecular marker rs340374353 of the present invention. This fragment is the molecular marker screened by the present invention. The sequence length is 101 bp, and there is a G / T allele mutation at the 51st base of the sequence.

[0062] Main references:

[0063] [1] Li Runfan. Direction of pig hybridization and characteristics of Yorkshire pigs [J]. Rural World, 1994(05): 40.

[0064] [2] Li Shihao et al. Analysis on combining ability of birth weight traits in hybridization of Landrace pig lines[J]. Animal Husbandry and Feed, 2021, 20(11): 20-25.

[0065] [3] Bu Lina et al. Research progress of genome-wide association analysis and its extension methods[J]. Journal of Agricultural Biotechnology, 2019, 27(01): 150-158.

[0066] [4] Yin Jianliang et al., Research progress and prospects of whole genome association analysis in pigs[J]. Chinese Swine Industry, 2017(10): 32-36.

[0067] [5]Visscher P M,Brown M A,McCarthy MI,et al.Five years of GWASdiscovery[J].The American Journal of Human Genetics,2012,90(1):7-24.

[0068] [6]Liu X,Huang M,Fan B,et al.Iterative Usage of Fixed and RandomEffect Models for Powerful and Efficient Genome-Wide Association Studies[J].Plos Genetics,2016,12(2):e1005767。

Claims

1. Application of a SNP molecular marker in marker-assisted selection of pig birth weight traits, wherein the pig breed is Landrace pig, and the nucleotide sequence of the molecular marker is as follows: TGATAGGAGGATATTTTAAAAATAGAAAATTCAAGTTGATTTATACAAAGK(G / T)ACCTAAAATAATGTCTGATGCAGAATCAGGTGGAATAATTGCTATTTTC; The K at the 51st base of the above sequence is replaced by G or T, and this replacement causes nucleotide polymorphism in the sequence shown. The individual with the genotype of GG has a larger initial weight; the individual with the genotype of TT has a smaller initial weight.

Images