Application of SNP molecular markers related to birth weight in Large White pigs

Abstract

The present invention belongs to the technical field of pig molecular marker screening, and specifically relates to the application of SNP molecular markers related to the birth weight trait of Large White pigs. By collecting ear samples of 3244 Large White pigs, extracting genomic DNA and performing quality inspection, genotyping is performed by GeneSeekPorcine 50K SNP high-density chip to obtain SNP typing data, and a SNP molecular marker related to the birth weight trait of Large White pigs is obtained by screening. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, and there is an A / G allele mutation (replacement) at the 51st base of the sequence, and the mutation (replacement) causes the nucleotides of the sequence to produce polymorphism. When the 51st nucleotide of the sequence shown in SEQ ID NO:1 is G, it is determined that the Large White pig has a higher birth weight.

Description

Technical Field

[0001] The present invention belongs to the technical field of pig molecular marker screening, and specifically relates to the application of SNP molecular markers related to the birth weight trait of Large White pigs. The molecular markers of the present invention can be used for auxiliary prediction and selection of the birth weight trait of Large White pigs. Background Art

[0002] Piglet birth weight and litter size are important indicators for measuring the reproductive performance of sows, and are also important economic indicators in pig production (Yan Honglin et al., 2013). In the past few decades, the pig industry has been committed to increasing the litter size of sows and has made great progress. However, with the increase in litter size, the uterus is crowded, intrauterine competition is intensified, and maternal placental nutrient supply during pregnancy is insufficient, which leads to restricted intrauterine development of the fetus and low birth weight (JCLynegaard et al., 2020). In the same litter, piglets cannot compete for piglets that are born and grow normally because of their small birth weight. Therefore, they are not dominant when the sow is breastfeeding, that is, they cannot eat enough colostrum, resulting in poor disease resistance and increased mortality in piglets. Therefore, the piglet birth weight trait is an important indicator affecting pig production performance.

[0003] Genome-wide Association Study (GWAS) uses high-throughput genotyping technology to analyze tens of thousands of single nucleotide polymorphisms (SNPs) and the correlation between these SNPs and clinical manifestations and measurable traits. Large-sample, multi-center, repeated validation technology is carried out at the whole genome level, and the association analysis of related genes and complex traits is performed to reveal the genetic mechanism and basis of different complex traits (Song Zhifang et al., 2018). The whole genome association analysis method has been widely used in various studies, including human diseases and important economic traits of livestock (Visscher PM et al., 2012).

[0004] The birth weight of piglets will be affected by many factors, such as genetic factors, environmental factors, nutritional factors, management factors, etc. (Mo Xuqun et al., 2020). First of all, different breeds of pigs have different genetic properties. In order to obtain the growth trait of piglet birth weight, it is necessary to study and analyze the genetic performance of high-yield pigs and select high-yield sows. Secondly, it is also necessary to focus on selecting advantageous breed parents. The breeds and parities are different. The first mating age, fat condition, and feeding and management conditions of the reserve sows before mating also have a great impact on the birth weight of piglets. In addition, reproductive disorders in pregnant sows (weak birth, stillbirth, low birth weight) or diseases in newborn piglets (directly affecting the growth of piglets or even death) will also affect the birth weight of piglets. Therefore, farms should take measures at multiple levels to increase the birth weight of piglets.

[0005] The present invention collects ear tissues of 3244 Large White pigs from a certain pig farm in southern China, extracts DNA from the ear tissues and performs quality inspection, performs genotyping using GeneSeek Porcine 50K SNP high-density chip to obtain genotype data and corresponding phenotypic data, uses the MVP package of R language and the FarmCPU model (Liu X et al., 2016) to screen out SNP molecular markers related to the birth weight trait of Large White pigs, provides a basis for the development of new molecular markers for the prediction and genetic improvement of the birth weight of Large White pigs, and is of great significance to improving the breeding and reproduction efficiency of pigs.

[0006] The correlation between the SNP molecular marker screened by the present invention and the birth weight trait of Large White pigs reaches a significant level, providing a new resource for the research related to the birth weight trait. Summary of the invention

[0007] The purpose of the present invention is to overcome the defects of the prior art, screen a SNP molecular marker related to the birth weight trait of Large White pigs and its application, obtain SNP typing data by genotyping through GeneSeek Porcine 50K SNP high-density chip, use GWAS to screen SNPs significantly associated with the birth weight trait of Large White pigs, and provide a new method for predicting the birth weight of Large White pigs.

[0008] The technical solution of the present invention is as follows:

[0009] The applicant collected ear samples of large white pigs from a certain pig farm in southern China, extracted genomic DNA and performed quality testing, and then used GeneSeek Porcine 50K SNP high-density chip to perform genotyping to obtain SNP typing data. Referring to the Ensembl database, the nucleotide sequence of the upstream and downstream 51bp fragment of the accession number rs81315787 was obtained, and the nucleotide sequence is shown in the sequence table SEQ ID NO: 1. The specific sequence is as follows:

[0010] TGCCACATGTCCCTTATAGGACATTCAAGACATGTTCTCACTGTCGTCAGR(A / G)GGATATTCCTAGCTGCAGTCTGCTTGGAAGTGTCTTATATAATGTAATGG;

[0011] The R at the 51st base of the above sequence is an A / G allele (substitution) mutation, and the (substitution) mutation causes the above sequence, i.e., the sequence described in SEQ ID NO: 1, to produce nucleotide polymorphism.

[0012] The A at position 51 of the above sequence is an allele mutation, that is, A is mutated (replaced) to G. The base G at position 51 of SEQ ID NO: 1 in the sequence listing of this specification is the mutated base.

[0013] The present invention develops a molecular marker using the above fragment as a predictor of the birth weight of a Large White pig. When the 51st nucleotide on SEQ ID NO: 1 is A, it is determined that the birth weight of the Large White pig may be reduced.

[0014] The above sequence can be used as a molecular marker for the birth weight trait of Large White pigs.

[0015] The applicant provides a method for screening SNP molecular markers related to the birth weight trait of Large White pigs, wherein the method comprises the following steps:

[0016] The applicant screened and obtained a SNP molecular marker related to the birth weight trait of Large White pigs. The nucleotide sequence of the molecular marker is as follows:

[0017] TGCCACATGTCCCTTATAGGACATTCAAGACATGTTCTCACTGTCGTCAGR(A / G)GGATATTCCTAGCTGCAGTCTGCTTGGAAGTGTCTTATATAATGTAATGG, the base replacement of R at the 51st base of the above sequence is A or G, and the replacement causes polymorphism in the above sequence.

[0018] Based on a SNP molecular marker associated with the pig's birth weight trait, when the 51st nucleotide of the sequence shown in SEQ ID NO: 1 is G, it is determined that the birth weight of the Large White pig may increase.

[0019] The SNP molecular marker of the present invention can be used for the prediction and selection of the birth weight trait of Large White pigs.

[0020] The specific steps of the present invention are:

[0021] ①By collecting ear samples of Large White pigs from a pig farm in southern China, extracting genomic DNA and performing quality inspection, genotyping was performed using the GeneSeek Porcine 50K SNP high-density chip to obtain SNP typing data.

[0022] ② The phenotypic data of 3244 Large White pigs from a pig farm in southern China were collected and the newborn pigs were redefined as phenotypes.

[0023] ③Using the FarmCPU model, the FarmCPU model in the MVP package under R language was used to perform genome-wide association analysis (GWAS). The model formula is as follows: i =M i1 b 1 +M i2 b 2 +...+M it b t +S ij d j +e i (1) where y i is the observed value of the trait of the ith individual; M i1 ,M i2 , ..., M it is the genotype of the t possible associated sites added to the model. This part is empty in the first iteration; b 1 , b 2 , ..., b t is the corresponding effect value of the possible associated site added to the model; S ij is the genotype of the jth genetic marker of the ith individual; d j YesS ij The corresponding effect value of i is the residual vector; y i =u i +e i (2)y i is the observed value of the trait of the ith individual; u i is the total genetic effect of the ith individual; e i The residual vector model (2) generates possible associated sites as covariates and adds them to the model (1) for iterative calculation until it stops.

[0024] The molecular markers screened by the present invention can be applied to the association analysis of the genotype or related traits of genes related to the birth weight trait of Large White pigs for non-diagnostic purposes, providing a new molecular marker resource for molecular marker-assisted selection of the birth weight trait of Large White pigs.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention can detect the genotype of pigs by using gene chip technology in vitro, and improve the detection and analysis of the birth weight of Large White piglets for non-diagnostic purposes. Compared with the current conventional PCR-RFLP and other methods, the present invention has the advantages of simplicity, rapidity, high sensitivity, etc.

[0027] For more detailed technical solutions, please refer to "Specific Implementation Methods". BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 : Schematic diagram of the overall technical process of the present invention.

[0029] Figure 2 : The 51bp nucleotide sequences of the upstream and downstream of the molecular marker rs81315787 screened by the present invention and the nucleotide sequence of the molecular marker of the present invention. Figure 2 There is an A / G allele mutation at the 51st base marked by the nucleotide shown (the English letter "R" at 51bp is the mutation site).

[0030] Figure 3 : Manhattan plot of the whole genome association analysis of the present invention. Explanation of the accompanying symbols: The research object is the pig birth weight trait, and the markers pointed by the black circle and arrow are the molecular markers screened by the present invention, and the markers are located on chromosome 8 of the pig. DETAILED DESCRIPTION

[0031] Description of the sequence listing:

[0032] SEQ ID NO: 1 is the nucleotide sequence of the molecular marker associated with the birth weight trait of Large White pigs screened by the present invention, and the sequence length is 101 bp. There is an allele mutation (replacement) at the 51 bp of the sequence (i.e., A / G base replacement, for the convenience of preparing the nucleotide sequence table, the base at 51 bp in the sequence table of the present application document is the mutated (replaced) base G as an example), and the above replacement or mutation causes the nucleotide sequence shown in SEQ ID NO: 1 to produce polymorphism.

[0033] The sequence and whole genome association analysis results in the present invention are based on the pig genome version 11.1.

[0034] Example 1: Genotyping and detection

[0035] (1) Ear samples of Large White pigs from a pig farm in southern China were collected, genomic DNA was extracted and quality tested, and genotyping was performed using the GeneSeek Porcine 50K SNP high-density chip to obtain SNP typing data.

[0036] Use Plink1.9 software to convert the raw data into VCF format, and then use this software to perform quality control on the VCF format file: specifically:

[0037] 1) maf 0.01: remove SNP sites with a minimum allele frequency of less than 1%;

[0038] 2) geno 0.1: remove SNP sites with genotype detection rate less than 90%;

[0039] 3) mind 0.1: individuals with genotype missing rate greater than 10% were eliminated;

[0040] 4) hwe le-6: remove SNP sites with Hardy-Weinberg equilibrium test P value less than 10-6,

[0041] 5) Use Beagle 4.1 software to fill missing genotypes in the chip data after quality control. The command is as follows:

[0042] java-jar-Xmx8g beagle.jar gt=qc.file.vcf out=example.impute

[0043] (2) The genotype data were tested, and finally 3217 individuals and 28748 SNPs were used for genome-wide association analysis.

[0044] Example 2: Method for genome-wide association analysis of Large White pig birth weight traits

[0045] The phenotype of birth weight of Large White pigs used for genotype association analysis came from a pig farm in southern China, totaling 3217 individuals. The FarmCPU model in the MVP package under R language was used to perform genome-wide association analysis (GWAS). The specific model formula is as follows: i =M i1 b 1 +M i2 b 2 +...+M it b t +S ij d j +e i (1) where y iis the observed value of the trait of the ith individual; M i1 ,M i2 , ..., M it is the genotype of the t possible associated sites added to the model. This part is empty in the first iteration; b 1 , b 2 , ..., b t is the corresponding effect value of the possible associated site added to the model; S ij is the genotype of the jth genetic marker of the ith individual; d j YesS ij The corresponding effect value of i is the residual vector; y i =u i +e i (2)y i is the observed value of the trait of the ith individual; u i is the total genetic effect of the ith individual; e i is the residual vector

[0046] Model (2) generates possible associated sites as covariates and adds them to model (1) for iterative calculation until the end.

[0047] The significance level of the whole genome association analysis of the present invention is shown in Table 1.

[0048] Table 1 Significant level of genome-wide association analysis of rs81315787

[0049]

[0050] Table 1 Description: The significant marker level is P value <0.05 / 41547 (Bonferroni correction)

[0051] Example 3: Application of rs81315787 molecular marker typing method in pig birth weight trait association analysis / rs81315787 molecular marker (sequence list SWQ ID NO: 1) and pig birth weight trait association analysis:

[0052] A mixed linear model (MLM) was used to analyze the association between the rs81315787 molecular marker and pig birth weight traits. The specific model is as follows:

[0053] y ijklmn =μ+G i +HYS j +Breed+ID m +ε ijklmn

[0054] Among them, y ijklmn is the phenotypic value of the weight trait of the mth individual at birth; μ is the population mean; Gi Is the genotype effect, HYS k is the combined effect of birth field, birth year and birth season (fixed effect); Breed is the breed effect (fixed effect); ID m is the individual additive effect (random effect), ε ijklmno is the model residual effect. The F test was used to analyze the significance of the differences in birth weight among the three genotype individuals. The analysis results are shown in Table 2.

[0055] Table 2 Polymorphism of accession number rs81315787 fragment

[0056]

[0057]

[0058] Explanation of Table 2: P<0.05 indicates significant difference; P<0.01 indicates extremely significant difference.

[0059] As shown in Table 2, individuals with genotype GG may have higher birth weight, while individuals with genotype AA may have lower birth weight. In the genome-wide association analysis using the FarmCPU model, the rs81315787 marker reached the genome-wide significant level, indicating that the marker is not only significantly associated with the birth weight trait of Large White pigs, but also that when the marker mutates to G, it is beneficial for Large White pigs to have higher birth weight.

[0060] Sequence Listing SEQ ID NO: 1 is the nucleotide sequence of 50 bp upstream and downstream of the molecular marker rs81315787 of the present invention. This fragment is the molecular marker screened by the present invention. The sequence length is 101 bp, and there is an A / G allele mutation at the 51st base of the sequence.

[0061] Main references:

[0062] [1] Yan Honglin et al., Effects of different birth weight, dietary energy levels and slaughter age on pig production performance, carcass traits and meat quality [J]. China Animal Husbandry Magazine, 2013, 49(17): 33-38

[0063] [2] Song Zhifang et al., Application of SNP chip technology to pig traits and its research progress [J]. Pig Science, 2018, 35(04): 116-117.

[0064] [3] Mo Xuqun et al., Factors affecting piglet birth weight and methods to improve it [J]. Jilin Animal Husbandry and Veterinary Medicine, 2020, 5:16-18

[0065] [4]Visscher P M,Brown M A,McCarthy M I,et al.Five years of GWASdiscovery[J].The American Journal of Human Genetics,2012,90(1):7-24.

[0066] [5]Liu X,Huang M,Fan B,et al.Iterative Usage of Fixed and RandomEffect Models for Powerful and Efficient Genome-Wide Association Studies[J].Plos Genetics,2016,12(2):e1005767.

[0067] [6]J.C.Lynegaard,C.F.Hansena,A.R.Kristensen,et al.Body compositionand organ development of intra-uterine growth restricted pigs at weaning[J].Animal(2020),14(2),pp 322–329。

Claims

1. Application of a SNP molecular marker in marker-assisted selection of pigs at birth, wherein the pig breed is Large White pig, and the nucleotide sequence of the molecular marker is as follows: TGCCACATGTCCCTTATAGGACATTCAAGACATGTTCTCACTGTCGTCAGR(A / G)GGATATTCCTAGCTGCAGTCTGCTTGGAAGTGTCTTATATAATGTAATGG; The base substitution of R at the 51st base in the above sequence is A or G, which causes nucleotide polymorphism in the sequence shown. Individuals with genotype GG have a higher birth weight, while individuals with genotype AA have a lower birth weight.

Images