Specific primer pair, identification product and method for differentiating field virulent strains and vaccine strains of Eimeria tenella

Abstract

The present invention relates to a specific primer pair, identification product and method for identifying wild strains and vaccine strains of Eimeria tenella. The specific primer pair includes an upstream primer as shown in SEQ ID No.1 and a downstream primer as shown in SEQ ID No.2. The specific primer pair is used to detect Eimeria tenella, and the wild strain and vaccine strain can be distinguished, filling the gap in the current research on Eimeria tenella. In addition, the inventors also found that in the process of using the primer pair to detect Eimeria tenella, the interference of other chicken coccidiosis pathogenic worm strains can also be effectively avoided. The specific primer pair provided by the present invention is suitable for PCR detection, HRM detection and chip detection, etc., and is simple to operate and highly repeatable. The identification method established by using the specific primer pair is helpful to accurately monitor the wild virus infection of chickens after live vaccine immunization, and provides a reference for the prevention and control of chicken coccidiosis.

Description

Technical Field

[0001] The invention relates to the technical field of DNA in vitro amplification in molecular biological detection technology, and relates to a specific primer pair, an identification product and a method for identifying wild toxic strains and vaccine strains of Eimeria tenella. Background Art

[0002] Coccidiosis is a protozoan disease that parasitizes the intestinal epithelial cells of chickens. Among them, Eimeria tenella has the highest infection rate and harm. Eimeria tenella is mainly transmitted through coccidia oocysts and parasitizes in the cecum of chickens. In the clinical characteristics of the disease, farmed animals infected with Eimeria tenella, especially chicks, often become depressed, accompanied by diarrhea, and even bloody stools. At the same time, production performance is significantly reduced, and the number of slaughtered animals is also seriously affected.

[0003] Since the 1940s, chicken coccidiosis has mainly relied on anticoccidial drugs, such as monensin, maduramycin and hainanmycin, which have been developed and applied. However, since the 1970s, the emergence of drug-resistant chicken coccidia has been much faster than the development of new drugs. At the same time, the use of drugs inevitably leads to an increase in drug residues in poultry meat, which has also caused public health concerns. Therefore, the current control of chicken coccidiosis is more often based on live vaccine immunization methods.

[0004] However, the live vaccine for chicken coccidiosis can also colonize in the intestinal tissue, which will affect the molecular detection results of chicken coccidiosis in clinical samples. At the same time, there is also a safety hazard of virulence recovery during the use of live vaccines for chicken coccidiosis. However, how to achieve the identification of vaccine strains and wild strains of chicken coccidiosis is still a research gap. Therefore, based on the effectiveness and safety of live vaccines for chicken coccidiosis, it is urgent to establish a method for identifying vaccine strains and wild strains of chicken coccidiosis.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] One of the purposes of the embodiments of the present invention is to provide a specific primer pair for distinguishing wild strains and vaccine strains of Eimeria tenella. The specific primer pair is used to detect Eimeria tenella, so as to distinguish wild strains and vaccine strains thereof.

[0007] In a first aspect of the present invention, a specific primer pair for identifying wild strains and vaccine strains of Eimeria tenella is provided, the specific primer pair comprising an upstream primer as shown in SEQ ID No.1 and a downstream primer as shown in SEQ ID No.2.

[0008] In a second aspect of the present invention, there is provided a product for differentiating between the wild-type strain and the vaccine strain of Eimeria tenella, said differentiating product comprising the specific primer pair provided in the first aspect of the present invention, and further comprising other differentiating reagents.

[0009] In some embodiments of the present invention, the differentiating product comprises a PCR kit, an HRM kit or a chip.

[0010] In some embodiments of the present invention, the other differentiating reagents comprise one or more of a PCR reaction solution and a DNA polymerase.

[0011] In some embodiments of the present invention, the other differentiating reagents comprise one or more of a positive control standard and a negative control standard.

[0012] In some embodiments of the present invention, the other differentiating reagents have one or more of the following technical features:

[0013] (1) The positive control standard is selected from one or more of the genomic DNA of the wild-type strain of Eimeria tenella, the genomic DNA of the vaccine strain of Eimeria tenella, a recombinant vector containing the fragment shown in SEQ ID NO.3, and a recombinant vector containing the fragment shown in SEQ ID NO.4;

[0014] (2) The negative control standard comprises water.

[0015] In some embodiments of the present invention, the other differentiating reagents comprise an HRM fluorescent dye.

[0016] In a third aspect of the present invention, there is provided a method for differentiating between the wild-type strain and the vaccine strain of Eimeria tenella, said differentiating method comprising the following steps:

[0017] Extract the genomic DNA of the sample to be tested;

[0018] Using the specific primer pair provided in the first aspect of the present invention, perform PCR amplification on the genomic DNA, detect the obtained PCR amplification product, and differentiate the type of Eimeria tenella contained in the sample to be tested according to the detection result.

[0019] In some embodiments of the present invention, the method for detecting the obtained PCR amplification product is agarose gel electrophoresis, and differentiating the type of Eimeria tenella contained in the sample to be tested according to the detection result includes:

[0020] If a 263bp band appears in the lane of the PCR amplification product, then the sample to be tested contains the wild-type strain of Eimeria tenella;

[0021] If a 219bp band appears in the lane of the PCR amplification product, then the test sample contains the vaccine strain of Eimeria tenella;

[0022] If both a 219bp band and a 263bp band appear in the lane of the PCR amplification product, then the test sample contains both the wild strain and the vaccine strain of Eimeria tenella.

[0023] In some embodiments of the present invention, the method for detecting the obtained PCR amplification product is sequencing. The types of Eimeria tenella contained in the test sample are identified according to the detection results, including:

[0024] If the sequencing peak map of the PCR amplification product is a single peak map and completely matches SEQ ID NO.3, then the test sample contains the wild strain of Eimeria tenella;

[0025] If the sequencing peak map of the PCR amplification product is a single peak map and completely matches SEQ ID NO.4, then the test sample contains the vaccine strain of Eimeria tenella.

[0026] Compared with the traditional technology, the present invention has the following beneficial effects:

[0027] Based on the research on Eimeria tenella, the present invention designs a pair of specific primers. Using these primers to detect Eimeria tenella can distinguish between its wild strain and vaccine strain, filling the gap in the current research on Eimeria tenella. Moreover, the inventor also found that during the process of using these primers to detect Eimeria tenella, it can effectively avoid the interference of other pathogenic strains of chicken coccidiosis (such as Eimeria maxima, Eimeria necatrix, Eimeria brunetti).

[0028] The specific primer pair provided by the present invention is applicable to PCR detection, HRM detection, chip detection, etc., with simple operation and high repeatability.

[0029] The identification method established using this specific primer pair helps to accurately monitor the wild virus infection situation of chicken flocks after live vaccine immunization, providing a reference for the prevention and control of chicken coccidiosis. Description of the Drawings

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its beneficial effects, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present application. For those skilled in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0031] Figure 1Electrophoresis results of PCR amplification products of Eimeria tenella ETGZ vaccine strain and Eimeria tenella GD test strain; among them: lanes 1 and 2 correspond to the PCR amplification products of Eimeria tenella GD test strain, and the band size is about 263bp; lanes 3 and 4 correspond to the amplification products of Eimeria tenella ETGZ vaccine strain, and the band size is about 219bp;

[0032] Figure 2 Peak map of differential sites of PCR products of Eimeria tenella ETGZ vaccine strain and Eimeria tenella GD test strain; the sequence of the differential fragment is ACCAAGAAAAGCGGGGAGGAACCTGTCATTTTGCAACACGCGAG;

[0033] Figure 3 Kit specific detection results; in the figure: lanes 1 and 2 correspond to the amplification products of the test strain of Eimeria maxima; lanes 3 and 4 correspond to the amplification products of the vaccine strain of Eimeria maxima; lanes 5 and 6 correspond to the amplification products of the test strain of Eimeria necatrix; lanes 7 and 8 correspond to the amplification products of the vaccine strain of Eimeria necatrix; lanes 9 and 10 correspond to the amplification products of the test strain of Eimeria necatrix; lanes 11 and 12 correspond to the amplification products of the vaccine strain of Eimeria necatrix; lanes 12 and 14 correspond to the amplification products of the wild strain of Eimeria brunetti; lanes 15 and 16 correspond to the amplification products of the precocious strain of Eimeria brunetti; lane 17 corresponds to the amplification product of the test strain of Eimeria tenella; lane 18 corresponds to the amplification product of the vaccine strain of Eimeria tenella; lane 19 corresponds to the negative control. Detailed implementation mode

[0034] The present invention will be further described in detail below in conjunction with the drawings, embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present invention and not to limit the scope of the present invention. The purpose of providing these embodiments and examples is to make the understanding of the disclosed content of the present invention more thorough and comprehensive. It should also be understood that the present invention can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various changes or modifications without departing from the connotation of the present invention, and the equivalent forms obtained also fall within the protection scope of this application. In addition, in the following description, a large number of specific details are given to provide a more thorough understanding of the present invention. It should be understood that the present invention can be implemented without one or more of these details.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the description of the present invention herein are for the purpose of describing embodiments and examples only, and are not intended to limit the present invention.

[0036] Terminology

[0037] Unless otherwise specified or in case of contradiction, the terms or phrases used herein have the following meanings:

[0038] The term "and / or", "or / and", "and / or" as used herein includes any one of two or more related listed items, and also includes any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more than two related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", "and / or", it should be understood that in this application, this technical solution undoubtedly includes the technical solution connected by "logical AND", and also undoubtedly includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, D, that is, it includes combinations of any two or any three of A, B, C, D, and also includes the combination of the four items A, B, C, D (that is, the technical solution connected by "logical AND").

[0039] In the present invention, terms such as "a plurality of", "a variety of", "multiple times", "multiple elements", etc., unless otherwise specified, refer to a quantity greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0040] The "combinations thereof", "any combinations thereof", "any combination modes thereof", etc. used herein include all suitable combination modes of any two or any two or more items in the listed items.

[0041] In this article, the "suitable" in "suitable combination modes", "suitable modes", "any suitable modes", etc. is subject to being able to implement the technical solution of the present invention, solve the technical problems of the present invention, and achieve the expected technical effects of the present invention.

[0042] In this article, "preferred", "better", "more preferred", "it is advisable" are only used to describe embodiments or examples with better effects. It should be understood that they do not constitute a limitation on the protection scope of the present invention.

[0043] In the present invention, terms such as "further", "even further", "especially", etc. are used for descriptive purposes, indicating differences in content, but should not be construed as limiting the scope of protection of the present invention.

[0044] In the present invention, "optionally", "optional", "option" mean that it is optional, that is, it refers to any one of two parallel options of "yes" or "no". If "optional" appears multiple times in a technical solution, without special instructions, and without contradictions or mutual restrictions, each "optional" is independent.

[0045] In the present invention, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only used for descriptive purposes, and should not be construed as indicating or implying relative importance or quantity, nor should it be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and should be understood not to constitute a closed limitation on quantity.

[0046] In the present invention, for the technical features described in an open-ended manner, it includes a closed technical solution composed of the listed features, as well as an open technical solution containing the listed features.

[0047] In the present invention, regarding a numerical interval (i.e., a numerical range), unless otherwise specified, the optional numerical values are considered continuous within the above numerical interval, and include the two numerical endpoints of the numerical range (i.e., the minimum value and the maximum value), as well as each numerical value between these two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer. For example, t is an integer selected from 1 to 10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein.

[0048] The temperature parameter in the present invention, unless otherwise specified, allows both constant temperature treatment and fluctuations within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within a range such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.

[0049] In the present invention, %(w / w) and wt% both represent weight percentage, %(v / v) represents volume percentage, and %(w / v) represents mass-volume percentage.

[0050] The first aspect of the present invention

[0051] The present invention provides a specific primer pair for differentiating wild-type strains and vaccine strains of Eimeria tenella, and the specific primer pair includes an upstream primer as shown in SEQ ID No.1 and a downstream primer as shown in SEQ ID No.2.

[0052] The second aspect of the present invention

[0053] The present invention provides a product for differentiating wild-type strains and vaccine strains of Eimeria tenella, and the differentiating product includes the specific primer pair provided in the first aspect of the present invention and further includes other differentiating reagents.

[0054] The present invention does not make a special limitation on the type of the differentiating product, which can be a PCR kit, an HRM kit, a chip, or the like.

[0055] Optionally, the other differentiating reagents include one or more of PCR reaction solution and DNA polymerase.

[0056] Optionally, the other differentiating reagents include one or more of positive control standard products and negative control standard products.

[0057] Optionally, the positive control standard product is selected from one or more of genomic DNA of wild-type strains of Eimeria tenella, genomic DNA of vaccine strains of Eimeria tenella, recombinant vectors containing the fragment shown in SEQ ID NO.3, and recombinant vectors containing the fragment shown in SEQ IDNO.4.

[0058] Optionally, the recombinant vector is a recombinant plasmid, including but not limited to recombinant pMD18T plasmid.

[0059] It can be understood that the negative control standard product does not contain the fragment shown in SEQ ID NO.3 and does not contain the fragment shown in SEQ IDNO.4, and can be water, such as reverse osmosis water with a purity of not less than 18.25 MΩ·CM.

[0060] In some embodiments of the present invention, the other differentiating reagents include HRM fluorescent dyes.

[0061] The third aspect of the present invention

[0062] The present invention provides a method for differentiating wild-type strains and vaccine strains of Eimeria tenella, and the differentiating method includes the following steps:

[0063] Extract the genomic DNA of the sample to be tested;

[0064] Use the specific primer pair provided in the first aspect of the present invention to perform PCR amplification on the genomic DNA, detect the obtained PCR amplification product, and identify the species of Eimeria tenella contained in the sample to be tested according to the detection result.

[0065] It can be understood that the present invention does not particularly limit the detection method of the PCR amplification product, which can be agarose gel electrophoresis or sequencing. One detection method can be selected, or two or more methods can be selected for combined detection.

[0066] In one example, the method for detecting the obtained PCR amplification product is agarose gel electrophoresis. Identifying the species of Eimeria tenella contained in the sample to be tested according to the detection result includes:

[0067] If a 263bp band appears in the lane of the PCR amplification product, the sample to be tested contains the wild strain of Eimeria tenella;

[0068] If a 219bp band appears in the lane of the PCR amplification product, the sample to be tested contains the vaccine strain of Eimeria tenella;

[0069] If both a 219bp band and a 263bp band appear in the lane of the PCR amplification product, the sample to be tested contains both the wild strain and the vaccine strain of Eimeria tenella.

[0070] In one example, the method for detecting the obtained PCR amplification product is sequencing. Identifying the species of Eimeria tenella contained in the sample to be tested according to the detection result includes:

[0071] If the sequencing peak map of the PCR amplification product is a single peak map and completely matches SEQ ID NO.3, the sample to be tested contains the wild strain of Eimeria tenella;

[0072] If the sequencing peak map of the PCR amplification product is a single peak map and completely matches SEQ ID NO.4, the sample to be tested contains the vaccine strain of Eimeria tenella.

[0073] The identification method of the present invention can be an identification method for non-diagnostic purposes. Specific embodiments

[0075] The embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. For the experimental methods without specific conditions noted in the following examples, the guidance given in the present invention is preferably referred to, and it can also be in accordance with the experimental manuals or conventional conditions in the art, or in accordance with the conditions recommended by the manufacturer, or refer to the experimental methods known in the art.

[0076] In the following specific examples, regarding the measurement parameters of raw material components, if not otherwise specified, there may be slight deviations within the weighing accuracy range. Regarding temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0077] Example 1. Assembly of a PCR detection kit for differentiating wild and vaccine strains of Eimeria tenella

[0078] This kit consists of Premix Taq DNA mix (TAKARA Co., Ltd.), a specific primer pair for differentiating wild and vaccine strains of Eimeria tenella (as shown in SEQ ID No.1 and SEQ ID No.2), a negative control standard, a positive control standard, and ultrapure water.

[0079] The specific composition of each reaction system is shown in Table 1 below.

[0080] Table 1

[0081] Premix Taq DNA mix 25 μL 10 μM forward primer 2 μL 10 μM reverse primer 2 μL Sample or control standard 100 ng - 500 ng Ultra-pure water Make up to 50 μL

[0082] In this kit:

[0083] Premix Taq DNA mix (Cat No. RP901A) is purchased from TaKaRa.

[0084] The upstream and downstream primers are as shown in SEQ ID No.1 and SEQ ID No.2, and the stock solution concentration is 10 μM for both.

[0085] Upstream primer (SEQ ID No.1): 5’-TGGAGAAATCAGCGCTACTGG-3’;

[0086] Downstream primer (SEQ ID No.2): 5’-TGCAAAGGCCAATTTAAGTGCT-3’.

[0087] The negative control standard is reverse osmosis water with a purity of not less than 18.25 MΩ·CM.

[0088] The positive control standard is the genomic DNA of the Eimeria tenella ETGZ vaccine strain and the Eimeria tenella GD test strain, or the recombinant plasmid composed of the nucleotide fragments shown in SEQ ID NO.3 and SEQ ID NO.4 and a cloning vector such as pMD18T.

[0089] SEQ ID NO.3:

[0090] TGGAGAAATCAGCGCTACTGGCAGCATCAAGTTGTTGGAAAGCTTTTATAAAACGGTCGGAGGGGAAAAGAGACCAAGAAAAGCGGGGAGGAACCTGTCATTTTGCAACACGCGAGACCAAGAAAAGCGGGGAGGAACCTGTCATTTTGCAACACGCGAGGCTTATGGTTCAGCTTTCAGCGCTCAACCTCTTAAAGTGTCAGGACCTTAGGCCTACACCTTGTCGTTGTTGTACCACTTAAGCACTTAAATTGGCCTTTGCA,

[0091] SEQ ID NO.4:

[0092] TGGAGAAATCAGCGCTACTGGCAGCATCAAGTTGTTGGAAAGCTTTTATAAAACGGTCGGAGGGGAAAAGAGACCAAGAAAAGCGGGGAGGAACCTGTCATTTTGCAACACGCGAGGCTTATGGTTCAGCTTTCAGCGCTCAACCTCTTAAAGTGTCAGGACCTTAGGCCTACACCTTGTCGTTGTTGTACCACTTAAGCACTTAAATTGGCCTTTGCA.

[0093] Example 2. Preparation of the positive control standard

[0094] (1) Use a rapid DNA extraction kit to extract the genomic DNA of the purified Eimeria tenella ETGZ vaccine strain and the Eimeria tenella GD test strain.

[0095] (2) Using the extracted sample genomic DNA as a template, perform PCR amplification with the specific primer pair for differentiating the field strain and the vaccine strain of Eimeria tenella, where:

[0096] The components of the PCR reaction system are as follows: Premix Taq DNA mix: 25 μL; upstream primer at 10 μM: 2 μL; reverse primer at 10 μM: 2 μL; DNA of the sample to be tested: 1 μL; finally, double-distilled water (ddH 2 O) is added to make up to 50 μL.

[0097] The PCR reaction conditions are: 95 °C for 5 min; 94 °C for 30 sec, 57 °C for 30 sec, 72 °C for 30 sec, for 30 cycles; 72 °C for 10 min.

[0098] (3) After the reaction, take 5 μL of the PCR product and perform electrophoresis detection using a 3 wt% agarose gel to observe whether an electrophoresis band of 219 bp appears for the ETGZ vaccine strain of Eimeria tenella, and whether an electrophoresis band of 263 bp appears for the PCR product corresponding to the GD test strain of Eimeria tenella.

[0099] The results are as Figure 1 shown. Figure 1 Figure [X] shows the electrophoresis results of the PCR amplification products of the ETGZ vaccine strain of Eimeria tenella and the GD test strain of Eimeria tenella; among them:

[0100] Lanes 1 and 2 correspond to the PCR amplification products of the GD test strain of Eimeria tenella, and the band size is approximately 263 bp;

[0101] Lanes 3 and 4 correspond to the PCR amplification products of the ETGZ vaccine strain of Eimeria tenella, and the band size is approximately 219 bp.

[0102] (4) Construct a cloning vector with the PCR product using pMD18T and send it to a sequencing company for sequencing. Among them, the sequencing result of the 263-bp band should be a single peak and be completely matched after comparison with SEQ ID NO.3; the sequencing result peak map of the 219-bp band should be a single peak and be completely matched after comparison with SEQ ID NO.4. When comparing SEQ ID NO.3 and SEQ ID NO.4, the sequence "ACCAAGAAAAGCGGGGAGGAACCTGTCATTTTGCAACACGCGAG" will be missing.

[0103] The results are as Figure 2 shown. Figure 2 Figure [X] shows the peak maps of the different sites of the PCR products of the ETGZ vaccine strain of Eimeria tenella and the GD test strain of Eimeria tenella.

[0104] Example 3. Specificity test of the identification kit

[0105] Please note that the specific figure numbers (e.g., Figure [X] ) are not filled in the translation as they are not provided in the original text. You may need to replace them with the actual figure numbers according to the context.The genomic DNA of vaccine strains or precocious strains and test strains or field virulent strains of Eimeria maxima (Em), Eimeria acervulina (Ea), Eimeria brunette (Eb), and Eimeria necatrix (En) was subjected to PCR amplification using the PCR kit of Example 1 of the present invention, where:

[0106] The PCR reaction system was: Premix Taq DNAmix: 25 μL; upstream primer at 10 μM: 2 μL; reverse primer at 10 μM: 2 μL; DNA of the sample to be tested: 1 μL; finally, double-distilled water (ddH 2 O) was added to make up to 50 μL.

[0107] The PCR reaction conditions were: 95°C for 5 min; 94°C for 30 sec, 57°C for 30 sec, 72°C for 30 sec, for 30 cycles; 72°C for 10 min.

[0108] The results were as Figure 3 shown. In the figure: Lanes 1 and 2 corresponded to the amplification products of the test strain of Eimeria maxima; Lanes 3 and 4 corresponded to the amplification products of the vaccine strain of Eimeria maxima; Lanes 5 and 6 corresponded to the amplification products of the test strain of Eimeria necatrix; Lanes 7 and 8 corresponded to the amplification products of the vaccine strain of Eimeria necatrix; Lanes 9 and 10 corresponded to the amplification products of the test strain of Eimeria necatrix; Lanes 11 and 12 corresponded to the amplification products of the vaccine strain of Eimeria necatrix; Lanes 12 and 14 corresponded to the amplification products of the field virulent strain of Eimeria brunette; Lanes 15 and 16 corresponded to the amplification products of the precocious strain of Eimeria brunette; Lane 17 corresponded to the amplification product of the test strain of Eimeria tenella; Lane 18 corresponded to the amplification product of the vaccine strain of Eimeria tenella; Lane 19 corresponded to the negative control. Combining Figure 3 it can be seen that except for Eimeria tenella, no specific bands were amplified for other strains.

[0109] In summary, the specific primer pair provided by the present invention can be used to distinguish between the wild and vaccine strains of Eimeria tenella. The basis for the distinction includes: if an electrophoresis band of 263 bp appears in the electrophoresis result, or the sequencing result peak map is a single peak map and is completely matched after comparison with SEQ ID NO.3, then the sample belongs to the wild strain of Eimeria tenella; if an electrophoresis band of 219 bp appears in the electrophoresis result, or the sequencing peak map is a single peak map and is completely matched after comparison with SEQ ID NO.4, then the sample is the vaccine strain of Eimeria tenella. If electrophoresis bands of 263 bp and 219 bp appear simultaneously, then the sample is a mixture of the vaccine and wild strains of Eimeria tenella. The method for distinguishing and detecting the wild and vaccine strains of Eimeria tenella provided by the present invention is simple to operate, has high repeatability, and strong specificity.

[0110] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered to be within the scope described in this specification.

[0111] The above-described embodiments merely represent several implementation manners of the present invention, which are convenient for understanding the technical solutions of the present invention specifically and in detail, but should not be construed as a limitation on the protection scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and the equivalent forms obtained also fall within the protection scope of this application. It should also be understood that the technical solutions obtained by those skilled in the art through logical analysis, reasoning, or limited experiments based on the technical solutions provided by the present invention are all within the protection scope of the appended claims of the present invention. Therefore, the protection scope of the present invention patent should be determined by the content of the appended claims, and the specification and drawings can be used to explain the content of the claims.

Claims

1. Specific primer pairs for differentiating wild toxic strains and vaccine strains of Eimeria tenella, Characterized in that, The specific primer pairs include an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.2; The wild toxic strain is the Eimeria tenella GD test strain; The vaccine strain is the Eimeria tenella ETGZ vaccine strain.

2. Identification products for wild toxic strains and vaccine strains of Eimeria tenella, Characterized in that, The identification products include the specific primer pairs described in claim 1 and also include other identification reagents; The wild toxic strain is the Eimeria tenella GD test strain; The vaccine strain is the Eimeria tenella ETGZ vaccine strain.

3. The identification product for wild toxic strains and vaccine strains of Eimeria tenella according to claim 2, Characterized in that, The identification product includes a PCR kit, an HRM kit or a chip.

4. The identification product for wild toxic strains and vaccine strains of Eimeria tenella according to claim 2 or 3, Characterized in that, The other identification reagents include PCR reaction solution.

5. The identification product for wild toxic strains and vaccine strains of Eimeria tenella according to claim 2 or 3, Characterized in that, The other identification reagents include one or more of a positive control standard and a negative control standard.

6. The identification product for wild toxic strains and vaccine strains of Eimeria tenella according to claim 5, Characterized in that, The other identification reagents have one or more of the following technical characteristics: (1) The positive control standard is selected from one or more of genomic DNA of wild toxic strains of Eimeria tenella, genomic DNA of vaccine strains of Eimeria tenella, recombinant vectors containing the fragment shown in SEQ ID NO.3, and recombinant vectors containing the fragment shown in SEQ ID NO.4; (2) The negative control standard includes water.

7. The identification product for wild toxic strains and vaccine strains of Eimeria tenella according to claim 2 or 3, Characterized in that, The other identification reagents include HRM fluorescent dyes.

8. A method for differentiating wild toxic strains and vaccine strains of Eimeria tenella for non-diagnostic purposes, Characterized in that, The differentiation method includes the following steps: Extract genomic DNA of the sample to be tested; Use the specific primer pairs described in claim 1 to perform PCR amplification on the genomic DNA, detect the obtained PCR amplification product, and differentiate the species of Eimeria tenella contained in the sample to be tested according to the detection result; The wild toxic strain is the Eimeria tenella GD test strain; The vaccine strain is the Eimeria tenella ETGZ vaccine strain; The method for detecting the obtained PCR amplification product is agarose gel electrophoresis, and differentiating the species of Eimeria tenella contained in the sample to be tested according to the detection result includes: If a 263bp band appears in the lane of the PCR amplification product, then the sample to be tested contains a wild toxic strain of Eimeria tenella; If a 219 bp band appears in the lane of the PCR amplification product, the test sample contains the vaccine strain of Eimeria tenella; If both a 219 bp band and a 263 bp band appear in the lane of the PCR amplification product, the test sample contains both the wild strain and the vaccine strain of Eimeria tenella.

9. A method for differentiating the wild strain and the vaccine strain of Eimeria tenella for non-diagnostic purposes, characterized in that, the differentiation method comprises the following steps: extracting the genomic DNA of the test sample; using the specific primer pair described in claim 1 to perform PCR amplification on the genomic DNA, detecting the obtained PCR amplification product, and differentiating the species of Eimeria tenella contained in the test sample according to the detection result; the wild strain is the GD test strain of Eimeria tenella; the vaccine strain is the ETGZ vaccine strain of Eimeria tenella; the method for detecting the obtained PCR amplification product is sequencing, and differentiating the species of Eimeria tenella contained in the test sample according to the detection result includes: if the sequencing peak map of the PCR amplification product is a single peak map and completely matches SEQ ID NO. 3, the test sample contains the wild strain of Eimeria tenella; if the sequencing peak map of the PCR amplification product is a single peak map and completely matches SEQ ID NO. 4, the test sample contains the vaccine strain of Eimeria tenella.

Images