Genes responsible for ToBRFV resistance in tomatoes

Abstract

The present invention relates to a tomato (Solanum lycopersicum) plant resistant to ToBRFV, comprising a QTL of SEQ ID No. 1 to 4 on chromosome 8. The presence of the QTL on chromosome 8 is identified by using at least one marker selected from the SNPs shown in SEQ ID No. 1 to 42. The QTL is present in the genome of a tomato plant, representative seeds of which are deposited in NCIMB with the deposit number NCIMB 43637.

Description

Technical Field

[0001] The present invention relates to a tomato (Solanum lycopersicum) plant comprising a QTL comprising an allele of a gene that confers resistance to Tomato Brown Ruffled Fruit Virus (ToBRFV). The present invention also relates to an allele of a gene that confers resistance to ToBRFV. The present invention further relates to a method for producing a ToBRFV-resistant tomato plant, and a method for identifying and selecting such a plant comprising an allele of said gene. The present invention also relates to progeny, seeds and fruits of a Tomato Brown Ruffled Fruit Virus-resistant tomato plant, to propagation material suitable for producing tomato plants and to a food comprising such a tomato fruit or part thereof. The present invention also relates to a cell or tissue culture, which is produced by a Tomato Brown Ruffled Fruit Virus-resistant tomato plant or can be regenerated into a Tomato Brown Ruffled Fruit Virus-resistant tomato plant. The present invention also relates to a marker for identifying an allele of a gene that confers resistance to Tomato Brown Ruffled Fruit Virus, and the use of said marker. Background Art

[0002] Viral diseases are one of the main threats that vegetable growers have to deal with, both in protected and open field crop cultivation. Once a crop is infected, the virus can spread rapidly through vectors (usually insects) that are difficult to control. In addition, cultivation methods often lead to further spread of the virus, through transmission through tools and sap from field workers.

[0003] The best protection against viral infections is the use of resistant varieties. Resistances have been identified for many known viruses and these have been incorporated into suitable tomato varieties through breeding, allowing growers to achieve good yields even under viral pressure. Resistance can generally be divided into different types, the most common being tolerance and resistance. Tolerance does not necessarily mean a lower level of resistance, but it indicates that the plant has no symptoms or reduced symptoms, even if the virus is still able to replicate within the host. Resistance describes a mechanism in which not only are symptoms absent or greatly reduced, but viral replication within the plant is also limited, i.e. absent or greatly reduced.

[0004] In 2015, a new tobamovirus virus was reported to have appeared in tomatoes (Salem et al., A new tobamovirus infecting tomato crops in Jordan. Arch Virol. 2016 Feb; 161(2): 503-6. Epub 2015 Nov 19). The virus was shown to be related to the known tobacco mosaic virus genus tobacco mosaic virus (TMV), tomato mosaic virus (ToMV) and tomato mild mottle virus (ToMMV), with the sequence identity of the closest related sequences of ToMMV and ToMV being about 80% to 90%. The symptoms of the plants were quite mild, but almost all the fruits showed very severe brown wrinkle symptoms. The virus was observed to destroy the commonly used resistance genes for ToMV (Tm-1, Tm-2 and Tm-2 2 ), the latter also known as Tm-2 a A later publication showed that the virus was also found in Israel and determined to infect pepper (Capsicum annuum) plants (Luria et al., (2017): A new Israeli tobamovirus isolate infects tomato plants harboring Tm-2 2 resistancegenes.PLoS ONE 12(1):e0170429.Doi:10.1371 / journal.pone.0170429). Symptoms appear to vary based on the variety affected, and in some cases, they appear primarily on the vegetative parts, in the form of severe or mild mottling, necrosis, leaf distortion, or other symptoms. Because the virus is clearly distinct from the known tobacco mosaic virus genus, it has been given a new name: Tomato brown wrinkled fruit virus (TBRFV). At the same time, the commonly used abbreviation for this virus is ToBRFV, so this abbreviation is now also used in this application.

[0005] Over the past few years, ToBRFV has spread rapidly to many countries and has had a major impact on tomato fruit production in a rapidly increasing number of vegetable growing regions. Due to the severity of the fruit symptoms, the presence of ToBRFV has a very high impact on tomato growers as it renders the fruit essentially unmarketable. The virus is at least mechanically transmitted, which makes the spread easy, rapid and difficult to control. The spread of the virus may also occur via infected seeds. Summary of the invention

[0006] It is an object of the present invention to provide tomato plants of the species Solanum lycopersicum showing true resistance to Tomato Brown Ruffle Fruit Virus (ToBRFV).

[0007] Another object of the present invention is to provide alleles of genes that confer resistance to ToBRFV.

[0008] Due to the problem of very fast spread of the new ToBRFV, with major impacts on tomato production in certain regions, the urgency of obtaining resistant tomato plants was very high. Moreover, due to the very efficient transmission of the virus, it was expected that the virus could spread quickly to other regions. Therefore, a large germplasm screening was organized to understand the presence of possible sources. Initially, resistant materials from several species of currant tomato (Solanum pimpinellifolium) were identified and by fine mapping and phenotyping of populations between these sources and tomato lines, QTLs on chromosomes 6, 11 and 12 were discovered, as described in co-pending applications WO2019110130 and WO2019110821. The introgression of these QTLs in tomato resulted in useful phenotypic resistance levels, but in laboratory experiments it was found that the virus titers remained relatively high, indicating that the virus could still replicate in the plants.

[0009] Therefore, for one of the sources of gooseberry tomato used, GNL.3951, further populations were developed for additional QTL mapping by combining it with internal breeding lines to obtain plants with stronger true resistance based on limiting viral replication. Plants of all generations were bioassayed, but qPCR analysis was also performed to determine the presence and level of virus titers in the plants (Example 2).

[0010] Identification and characterization of QTLs by molecular markers provides the opportunity to use genetic linkage markers to identify the presence of QTLs and therefore the presence of resistance, which is clearly more efficient than using bioassays in conjunction with qPCR analysis. For this purpose, new QTL mapping studies were performed on F2 populations, backcrosses and F1 hybrids with sources. These observations led to the identification of a new QTL region on chromosome 8 (Example 1).

[0011] The present invention provides a tomato plant resistant to Tomato Brown Ruffle Fruit Virus (ToBRFV), the plant comprising a QTL comprising an allele of a gene on chromosome 8 that restricts viral replication in the plant. The allele of the gene on chromosome 8 is particularly an allele of a gene derived from or introgressed into a tomato species.

[0012] The first QTL region identified on chromosome 8 is located between SEQ ID No. 1 and SEQ ID No. 42. The presence of the QTL on chromosome 8 can be identified by a genetic linkage marker selected from the SNPs shown in SEQ ID No. 1 to 42, preferably by a marker selected from the SNPs shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 34 and SEQ ID No. 42. The QTL was determined to be tightly linked to a marker selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 29 and SEQ ID No. 30. The genetic linkage marker used to identify the QTL is a marker represented by any one of the sequences present in the QTL listed in Figure 1.

[0013] The QTL region initially identified on chromosome 8 was further fine-mapped to determine the location of the gene that confers resistance in the QTL. The first fine-mapping operation produced a smaller QTL region, which is located between SEQ ID No.22 and SEQ IDNo.34. This smaller QTL region contains 7 genes. Five markers from the first positioning, including three markers determined to be highly linked, appeared in the sequence of one of those genes (Tom2a gene), indicating that there is a polymorphism in Tom2a compared to the ToBRFV susceptible reference genome (version SL3_00). Due to the presence of the best linkage marker in this gene, Tom2a appears to be the most likely candidate gene for ToBRFV resistance of the present invention. The gene was sequenced and then compared with the published reference genome, and two other polymorphisms were determined. The polymorphism between the reference genome sequence SL3_00 and the resistance sequence of Tom2a can be identified by any one of the markers shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 or SEQ ID No. 44. The resistance sequence of Tom2a constitutes the allele of the present invention.

[0014] Further studies and observations were conducted to confirm that the Tom2a gene is involved in ToBRFV resistance. In this process, a population with recombination in the QTL region was cultivated. Through marker analysis and phenotypic analysis of these recombinant strains, other genes present in the QTL region were excluded as potential contributors to ToBRFV resistance, and it can be confirmed that the Tom2a gene is the causal gene of ToBRFV resistance of the present invention (Example 4; Figure 4).

[0015] The present invention relates to a tomato plant comprising a QTL on chromosome 8, said QTL comprising a Tom2a allele conferring resistance, wherein the presence of the QTL on chromosome 8 is genetically linked to at least one marker selected from the group consisting of the SNPs shown in SEQ ID No. 1 to 44, preferably a marker selected from the group consisting of the SNPs shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 34, SEQ ID No. 42, SEQ ID No. 43 and SEQ ID No. 44, most preferably a marker selected from the group consisting of SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No. 44.

[0016] The present invention provides a Tom2a allele that confers resistance on chromosome 8 of tomato, the Tom2a allele that confers resistance comprising SEQ ID No.45, or comprising a homologous Tom2a sequence having at least 70% sequence identity with SEQ ID No.45. The presence of the Tom2a allele or homologous Tom2a sequence that confers resistance in a tomato plant results in resistance to ToBRFV. SEQ ID No.45 shows the coding sequence (CDS) of the Tom2a allele that confers resistance. As used herein, a Tom2a allele that confers resistance is a version of the Tom2a gene that results in resistance to ToBRFV.

[0017] SEQ ID No. 45 encodes a protein comprising SEQ ID No. 46. The present invention relates to a Tom2a protein comprising SEQ ID No. 46, or a homologous Tom2a protein having at least 70% sequence identity with SEQ ID No. 46, which protein causes resistance to ToBRFV.

[0018] The wild-type sequence of the Tom2a gene comprises SEQ ID No. 47, and encodes a protein comprising SEQ ID No. 48. Polymorphisms in the genomic sequence of the gene can be used to identify the presence of an allele of the Tom2a gene that confers resistance, the gene comprising the SNP shown in the sequence of SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43, or SEQ ID No. 44. By using any of these SNPs as a marker, by determining the presence of the SNP, the Tom2a allele that confers resistance can be identified.

[0019] Homologous Tom2a genes comprise homologous sequences having at least 70% sequence identity to SEQ ID No. 45, preferably at least 75%, 77%, 80%, 83%, 85%, 87%, 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity. Homologous Tom2a proteins comprise homologous sequences having at least 70% sequence identity to SEQ ID No. 46, preferably at least 75%, 77%, 80%, 83%, 85%, 87%, 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0020] In one embodiment, the homologous Tom2a allele conferring resistance retains the polymorphism identifiable by SEQ ID No.26 or by SEQ ID No.28 or by SEQ ID No.43 or by SEQ ID No.44. In one embodiment, the resistance-conferring Tom2a allele or its homologous allele retains a polymorphism combination identifiable by SEQ ID No.26 and SEQ ID No.28; SEQ ID No.26 and SEQ ID No.43; SEQ ID No.26 and SEQ ID No.44; SEQ ID No.28 and SEQ ID No.43; SEQ ID No.28 and SEQ ID No.44; SEQ ID No.43 and SEQ ID No.44; SEQ ID No.26 and SEQ ID No.28 and SEQ ID No.43; SEQ ID No.26 and SEQ ID No.28 and SEQ ID No.44; SEQ ID No.26 and SEQ ID No.43 and SEQ ID No.44; SEQ ID No.28 and SEQ ID No.43 and SEQ ID No.44; or SEQ ID No.26 and SEQ ID No.28 and SEQ ID No.43 and SEQ ID No.44.

[0021] Since the gene is present on the negative strand in the disclosed genome, SEQ ID No.26 identifies an A to G transition at position 559 of SEQ ID No.47; SEQ ID No.28 identifies a GGC deletion at positions 312-314 of SEQ ID No.47; SEQ ID No.43 identifies a G to A transition at position 673 of SEQ ID No.47, and SEQ ID No.44 identifies an A to G transition at position 844 of SEQ ID No.47.

[0022] In one embodiment, the homologous Tom2a allele that confers resistance retains at least one of the A to G transition at position 559 of SEQ ID No.47; the GGC deletion at positions 312-314 of SEQ ID No.47; the G to A transition at position 673 of SEQ ID No.47, the A to G transition at position 844 of SEQ ID No.47, or any of those polymorphisms at the corresponding positions of the homologous Tom2a gene. In a further embodiment, the homologous Tom2a allele that confers resistance retains a combination of two, three, or all four of these polymorphisms. Figure 5 shows the CDS sequences of the Tom2a wild type and the Tom2a allele that confers resistance, both individually and in an aligned manner.

[0023] In one embodiment, the homologous Tom2a allele sequence encodes a protein comprising at least one of a deletion of A at position 105 of SEQ ID No.48, a transition to G at position 187 of SEQ ID No.48, a transition to S at position 225 of SEQ ID No.48, or a transition to A at position 282 of SEQ ID No.48.

[0024] In one embodiment, the protein encoded by the resistance-conferring Tom2a allele or a homologous protein thereof retains the Ala deletion at position 105 of SEQ ID No.48, the Arg to Gly substitution at position 187 of SEQ ID No.48, the Gly to Ser substitution at position 225 of SEQ ID No.48, or the Thr to Ala substitution at position 282 of SEQ ID No.48, or the modification at the corresponding position of the homologous protein. In one embodiment, the protein encoded by the resistance-conferring Tom2a allele retains a combination of two, three or all four of these polymorphisms. Figure 6 shows the wild-type Tom2a protein sequence and the resistance-conferring Tom2a allele individually and in an aligned manner.

[0025] As used herein, sequence identity is the percentage of nucleotides or amino acids that are identical between two sequences after correct alignment. Those skilled in the art know how to align sequences, for example by using sequence alignment tools, such as It can be used for both nucleotide and protein sequences. In order to obtain the most significant results, the best possible alignment giving the highest sequence identity score should be obtained. The percentage of sequence identity is calculated by comparing the length of the shortest sequence in the evaluation, whereby in this case, the sequence represents a gene comprising at least a start codon and a stop codon, or a complete protein encoded by such a gene.

[0026] The Tom2a protein is a four-transmembrane protein, which is a protein with four transmembrane protein / peripheral protein domains. The protein comprises an N-terminal and a C-terminal tail, and four transmembrane domains, which are connected by two non-cytoplasmic loops and a very short cytoplasmic loop (Figure 8). The observed mutations are present at the end of the second transmembrane domain (TM2), especially the Ala deletion at position 105, and at the C-terminal tail of the protein. The Ala deletion at position 105 affects the TM2 domain and may also affect the short cytoplasmic loop behind it. The present invention relates to mutations in the Tom2a gene that affect the TM2 domain, or mutations that affect the cytoplasmic loop, or mutations that affect the C-terminal tail of the protein, or combinations of the mutations.

[0027] In one embodiment, the resistance-conferring Tom2a allele encodes a non-functional protein.

[0028] Figure 1 provides a SEQ ID No. sequence that can be used as a marker or for developing a marker to identify the presence of a QTL on chromosome 8 that contains an allele of the Tom2a gene of the present invention that leads to ToBRFV resistance in tomato plants. Table 4 shows the nucleotides in the sequence that identify the presence of the QTL, and therefore identify resistant plants, and the position of the SNP in the sequence of Figure 1. As used herein, the "SNP shown" in a certain SEQ ID No. is a nucleotide in the sequence that indicates resistance, as shown in the "Nucleotides of the SNP in Figure 1, used as markers of the present invention" column of Table 4. When the sequence of the marker is located on the SL3_00 version of the publicly available tomato genome reference sequence, it can be traced back to the physical position corresponding to the SNP polymorphism in the marker sequence. The position is also shown in Table 4. The SL3_00 version of the public tomato genome reference sequence can be accessed, for example, on the Solgenomics website (solgenomis.net), and is a reference to the "public tomato genome" used in this article. The positions of the markers of the present invention are derived from the public map, and these positions are related to the physical positions.

[0029] This is accomplished by using markers to identify the presence of a QTL or Tom2a allele conferring resistance, in particular by identifying the presence of a resistance-indicating nucleotide at the SNP position in the marker sequence. The wild-type nucleotide is the nucleotide present at that position in the disclosed genome.

[0030] As used herein, a tomato plant is a plant of the species Solanum lycopersicum.

[0031] As used herein, resistance to Tomato Brown Crinkle Fruit Virus is resistance to the virus described in Salem et al. (2016, supra), which is classified as NCBI classification ID 1761477.

[0032] As used herein, when a marker and ToBRFV resistance are co-segregated in a segregating population produced by a cross between a plant comprising a QTL of the present invention and a plant lacking the QTL, the marker is genetically linked to a QTL comprising an allele of the Tom2a gene of the present invention, and thus can be used to identify the QTL. A marker genetically linked to a QTL can be used to identify the QTL because a linkage marker is present in the QTL. The marker present in the Tom2a allele of the present invention that confers resistance is completely linked, and thus directly indicates the presence of an allele of the gene that confers resistance.

[0033] The ToBRFV resistance of the present invention is inherited in a recessive manner. This means that when the alleles of the Tom2a gene of the present invention are present homozygously, the viral replication in the plant is absent or greatly reduced compared to plants in which the alleles of the present invention are absent or heterozygous. However, heterozygous plants can be used to cultivate homozygous plants by hybridization and selection, so heterozygous plants also constitute a part of the present invention.

[0034] Virus replication is appropriately determined by qPCR testing to determine ToBRFV resistance of the present invention as described in Example 2. Confirmation of the resistance can be determined by bioassay, for example, using a standard mechanical sap inoculation technique of the tobacco mosaic virus genus, which is known to those skilled in the art and is also described, for example, by Luria et al. (2017, supra).

[0035] To determine the resistance phenotype, seeds of the test material were sown in standard seedling trays and at least 10 seedlings were inoculated 4 weeks after sowing. The inoculum was prepared by grinding leaves of tomato plants infected with ToBRFV in 0.01M phosphate buffer (pH 7.0) mixed with diatomaceous earth. Then, the seedlings were sprinkled with emery powder before gently rubbing the leaves with the inoculum. Resistance was scored on a scale of 0-5; a description of the scoring scale can be found in Table 3. Bioassays were performed 14-21 days (dai) after inoculation to observe symptoms in tomato seedlings.

[0036] Resistance to ToBRFV is determined by comparison with a control variety known to be susceptible to ToBRFV. Examples of ToBRFV susceptible tomato varieties are Livento F1 and Adventure F1, which do not have the resistance-conferring Tom2a allele of the present invention on chromosome 8 and are used as susceptible controls. Since no tomato varieties were known to have resistance to ToBRFV of the present invention before the completion of the present invention, it is not possible to include resistance controls known before the completion of the present invention. However, as resistance controls, plants grown from seeds deposited as NCIMB 43637 can be used; plants grown from this deposit contain the resistance-conferring Tom2a allele of the present invention on chromosome 8. The test is performed on 10 plants of a particular line and the average score is taken. The test is performed correctly when the average score of the susceptible (S) control is higher than 3.0, preferably higher than 3.5. Once this average is reached, it is the right time to score the assay.

[0037] Table 3: ToBRFV resistance rating

[0038] score symptom 0 Asymptomatic 1 Rough, single spots, some slight discoloration 2 Mottled, clearly visible symptoms 3 Severe mottled, head begins to deform 4 Severe mottling, stem necrosis, severe head deformation, blister spots 5 Plant Death

[0039] As used herein, when using the scoring according to Table 3, the average score of ToBRFV-resistant tomato plants homozygously comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 is 1.5 or lower, preferably a score lower than 1.0.

[0040] As used herein, resistance means that virus replication is reduced or absent in plants infected with ToBRFV. The reduction in virus replication can be measured by qPCR testing. In order to determine whether the strain has a reduction in ToBRFV virus replication or the absence of virus replication, the virus titer is determined in leaf samples of at least 5 plants infected with ToBRFV taken from the strain. A leaf punch sample with a diameter of 6 mm is taken from each plant and then ground in 500 μl PBS buffer solution. 50 μl of the resulting suspension is used in a 96-well KingFisher Flex separation protocol, thereby using the innuPREP DNA / RNA virus PLUS kit for separation of leaf material. The sample is then analyzed in a 96CFX qPCR thermal cycler (Biorad) to obtain a Cq_ToBRFV value, which represents the number of cycles required to obtain a viral PCR product, using a program of 50°C for 5 minutes, 95°C for 20 seconds, and then 95°C for 10 seconds, 60°C for 60 seconds for 40 cycles.

[0041] To be able to compare values ​​for samples of different sizes and backgrounds, the Tomato PHD reference gene (a tomato housekeeping gene) was included in the qPCR assay, which corrects for any variations in the amount of sample material and then generates Cq_PHD values. The primers used in the assay are given in Table 1. The PCR volumes used in the assay are given in Table 2.

[0042] Table 1: ToBRFV and PHD primers used for qPCR assays

[0043] Primers sequence TBFRV FW 3 (SEQ ID No. 49) GTACATCTTGCTGGTCTTGT TBFRV RV 3 (SEQ ID No. 50) CGCTCTCTCCATTCTCTTATC TBFRV P3 (SEQ ID No.51) FAM-TGGTGGTGTCAGTGTCTGTTTGGT-BHQ1 PHD FW1 (SEQ ID No.52) TACCAACTCTTCCTCCCATAG PHD RV1 (SEQ ID No. 53) TGGATCGCACTGTGAGTA PHD P1 (SEQ ID No.54) TxR 5'-TTCAAAGACTTCTCCGCCCGTCAC-3'BHQ2

[0044] Table 2: qPCR assay volumes

[0045]

[0046]

[0047] In order to accurately determine the final value of the virus titer, the delta-delta Ct method was used, with PHD as the housekeeping gene and ToBRFV as the target gene. The final value was Cq_corr, calculated as Cq_ToBRFV–Cq_PHD. When the average Cq_corr of at least 5 plant samples was higher than -11.00, or when the average Cq-corr was at least 5.00 higher than the average Cq_corr of the susceptible control, the plant was determined to have a reduction in ToBRFV viral replication (Example 2, Table 5).

[0048] In one embodiment, the resistant plants of the present invention comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein have, in order of increasing preference, an average Cq_corr score of greater than -11.00, -10.50, -10.00, -9.50, -9.00, -8.50, -8.00, -7.50 or -7.00.

[0049] In one embodiment, the resistant plants of the present invention comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein have, in order of increasing preference, an average Cq_corr score of at least 5.00, 5.50, 6.00, 6.50, 7.00, 7.50, 8.00 higher than the average of the susceptible controls.

[0050] The calculation of the above average is preferably performed as an average taken from at least 2 tests. When the average Cq_corr value of the susceptible control in the test is -12 or lower, preferably -13 or lower, most preferably -14 or lower, the plant is properly infected with ToBRFV.

[0051] Tomato plants having the resistance-conferring Tom2a allele of the present invention, which results in ToBRFV resistance, can be grown from seeds deposited as NCIMB 43637.

[0052] NCIMB 43637 has the ToBRFV resistance of the present invention and comprises the QTL of the present invention located between SEQ ID No.1 and 42 on chromosome 8, and the QTL comprises the resistance-conferring Tom2a allele having SEQ ID No.45. The QTL, and therefore the resistance-conferring Tom2a allele, is present in the deposit NCIMB 43637 in a homozygous form. The QTL in NCIMB 43637 is linked to any one of the markers represented by the SNPs shown in SEQ ID No.1 to 44, and can therefore be identified by any one of the markers represented by the SNPs shown in SEQ ID No.1 to 44. The resistance-conferring Tom2a allele in NCIMB43637 comprises the polymorphisms shown in SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQID No.29, SEQ ID No.30, SEQ ID No.43 and SEQ ID No.44. The Tom2a allele conferring resistance can in particular be identified by determining the presence of the SNP shown in SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 43 or SEQ ID No. 44.

[0053] In the ToBRFV bioassay or qPCR test, plants containing the resistance-conferring Tom2a allele of the present invention on chromosome 8 can be used as resistant control varieties. When the plant, line or population to be evaluated shows the same resistance as NCIMB43637, and the plant, line or population contains the resistance-conferring Tom2a allele on chromosome 8 described herein, the plant, line or population is considered to have the ToBRFV resistance of the present invention and is therefore a plant of the present invention.

[0054] The plant of the present invention is optionally a cultivated tomato plant having improved agronomic characteristics making it suitable for commercial cultivation. Thus, the plant is an agriculturally superior plant.

[0055] In one embodiment, the ToBRFV-resistant tomato plants of the present invention do not require an allele of the Tm-1 gene that confers resistance. In one embodiment, the ToBRFV-resistant tomato plants of the present invention do not require a TOM1 gene or a TOM3 gene that confers resistance. The ToBRFV-resistant tomato plants of the present invention comprising a Tom2a allele that confers resistance do not require the presence of the Tm-1 gene, the TOM1 gene, or the TOM3 gene that confers tobacco resistance to exhibit resistance.

[0056] In one embodiment, the ToBRFV-resistant tomato plant of the present invention comprises a resistance-conferring Tom2a allele and a resistance-conferring QTL on chromosome 11, as described in co-pending application WO2019110821. The resistance-conferring QTL on chromosome 11 specifically comprises a resistance-conferring CCA gene or a resistance-conferring Albino3-like gene, which are described in WO2021110855 and co-pending application PCT / EP2021 / 055008, respectively. The combination of these QTLs, in particular the combination of the resistance-conferring Tom2a allele with any of the genes, results in stronger and more durable resistance of tomatoes to ToBRFV.

[0057] The present invention also relates to tomato fruits harvested from the plants of the present invention, wherein the tomato fruits comprise in their genome the resistance-conferring Tom2a alleles of the present invention, which genes result in ToBRFV resistance in the plant. Such tomato fruits are also referred to herein as "fruits of the present invention" or "tomato fruits of the present invention". As used herein, "tomato fruits" are fruits produced by plants of the species Tomato.

[0058] The present invention relates to a method for producing a tomato plant resistant to ToBRFV, the method comprising introducing a QTL comprising a Tom2a allele conferring resistance on chromosome 8 of a tomato plant lacking the QTL, wherein the QTL region is located between SEQ ID No.1 and SEQ ID No.42 and is linked to any marker selected from the group consisting of the SNPs shown in SEQ ID No.1 to 44, preferably to a marker selected from the group consisting of the SNPs shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.14, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19, SEQ ID No.24, SEQ ID No.25, SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, SEQ ID No.34, SEQ ID No.42, SEQ ID No.43 and SEQ ID No.44, most preferably to a marker selected from the group consisting of the SNPs shown in SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, SEQ ID No.34, SEQ ID No.42, SEQ ID No.43 and SEQ ID No.44. The markers are linked to the SNPs shown in SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No. 44.

[0059] The present invention relates to a method for producing a ToBRFV-resistant tomato plant, said method comprising introducing the Tom2a allele conferring resistance as described herein into a tomato plant lacking said allele.

[0060] When plant sex is compatible, the Tom2a allele of the present invention that confers resistance can be introduced from another plant that comprises the Tom2a allele that confers resistance by commonly used breeding techniques (e.g., hybridization and selection). Such introduction can come from plants of the same species that can be easily hybridized, or from plants of related species. The difficulty of hybridization can be overcome by techniques known in the art, such as embryo rescue, or homologous transgenesis can be applied. Suitable markers as described herein are used to track the incorporation of the Tom2a allele that confers resistance into another plant.

[0061] The above methods are particularly useful for introducing the resistance-conferring Tom2a alleles of the present invention into plant species suitable for incorporation of such genetic information. In a specific embodiment, the resistance-conferring Tom2a allele can be introduced from a currant tomato plant comprising the resistance-conferring Tom2a allele, or from another Solanum species that is sexually compatible with tomato, into a tomato plant lacking the resistance-conferring Tom2a allele, for example by using standard breeding methods including crossing and selection. In another embodiment, the resistance-conferring Tom2a allele can be introduced from a tomato plant comprising the resistance-conferring Tom2a allele into a tomato plant lacking the resistance-conferring Tom2a allele using standard breeding methods.

[0062] The Tom2a allele conferring resistance on chromosome 8 can be introduced from representative seeds of tomato plants, which are deposited in NCIMB under the deposit number NCIMB 43637, or from seeds deposited in NCIMB 43637, or from progeny (sexual or vegetative progeny) of the deposit. The introduction of the Tom2a allele conferring resistance on chromosome 8 of tomato results in ToBRFV resistance.

[0063] Alternatively, the resistance-conferring Tom2a alleles of the present invention can be transferred or introduced from another sexually incompatible plant (e.g., by using a transgenic method). The technology that can be appropriately used includes general plant transformation techniques known to those skilled in the art, such as using an Agrobacterium-mediated transformation method. Genome editing methods, such as using a CRISPR / Cas system, can also be used to obtain the plants of the present invention, such as by editing an endogenous susceptible Tom2a gene to modify it into a resistance-conferring Tom2a allele. Susceptible Tom2a genes can be particularly targeted to induce mutations that result in Ala deletions at position 105 of SEQ ID No.48, Arg to Gly conversions at position 187 of SEQ ID No.48, Gly to Ser conversions at position 225 of SEQ ID No.48, or Thr to Ala conversions at position 282 of SEQ ID No.48, or any of those modifications at corresponding positions of homologous proteins. Targeted modifications that produce combinations of those modifications also form part of the present invention. Susceptible Tom2a genes can be further edited to obtain non-functional Tom2a proteins, which are part of the present invention.

[0064] The present invention also relates to plants of the present invention comprising the resistance-conferring Tom2a alleles of the present invention, which alleles homozygously or heterozygously cause ToBRFV resistance. The plants are plants of inbred lines, hybrids, double haploids or segregating populations. Preferably, the plants of the present invention are non-transgenic plants.

[0065] The present invention also relates to tomato seeds comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8, wherein the plant grown from the seed is a plant of the present invention. In a preferred embodiment, the resistance-conferring Tom2a allele of the present invention is homozygous in the seed, and the plant grown from the seed is resistant to ToBRFV. The present invention also relates to seeds produced by the plant of the present invention, wherein the seed contains the resistance-conferring Tom2a allele of the present invention, and therefore, the plant grown from the seed is a plant of the present invention. The present invention also relates to the use of the seed for producing the plant of the present invention by growing the seed into a plant. The present invention also relates to a plant part of the plant of the present invention comprising a fruit or a seed, wherein the plant part comprises the resistance-conferring Tom2a allele of the present invention on chromosome 8 in its genome.

[0066] Furthermore, the present invention also relates to a food or processed food comprising the tomato fruit of the present invention or a part thereof. The food may have undergone one or more processing steps. Such processing steps may include, but are not limited to, any one or a combination of the following treatments: peeling, cutting, washing, juicing, cooking, cooling or a salad mix comprising the fruit of the present invention. The processed form obtained is also part of the present invention.

[0067] The present invention also relates to propagation material suitable for producing the tomato plant of the present invention, wherein the propagation material is suitable for sexual reproduction and is particularly selected from microspores, pollen, ovary, ovule, embryo sac and egg cell; or the propagation material is suitable for vegetative propagation and is particularly selected from cuttings, roots, stems, cells, protoplasts; or the propagation material is suitable for tissue culture of regenerated cells and is particularly selected from leaves, pollen, embryos, cotyledons, hypocotyls, meristem cells, roots, root tips, anthers, flowers, seeds and stems; wherein the plant produced by the propagation material comprises the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein, which gene confers resistance to ToBRFV. The plant of the present invention can be used as a source of propagation material.

[0068] The present invention further relates to cells comprising the resistance-conferring Tom2a alleles of the present invention as defined herein. The cells of the present invention can be obtained from the plants of the present invention or present in the plants of the present invention. Such cells can be in isolated form, or parts of complete plants, or parts thereof, and still constitute cells of the present invention, because such cells contain genetic information that determines the resistance-conferring Tom2a alleles as described herein, which genes lead to ToBRFV resistance in cultivated tomato plants. Each cell of the plant of the present invention carries the genetic information that leads to ToBRFV resistance. The cells of the present invention can also be regenerated cells that can be regenerated into new plants of the present invention. In this case, the presence of the genetic information is the presence of the resistance-conferring Tom2a alleles of the present invention on chromosome 8, wherein the resistance-conferring Tom2a alleles are as defined herein.

[0069] The invention further relates to plant tissue of the plant of the invention, said tissue comprising the resistance-conferring Tom2a allele of the invention on chromosome 8 as defined herein. The tissue may be undifferentiated tissue or already differentiated tissue. Undifferentiated tissue is, for example, a stem tip, anther, petal or pollen and can be used for micropropagation to obtain plantlets that grow into new plants of the invention. The tissue may also be grown from a cell of the invention.

[0070] The present invention also relates to the offspring of the plant, cell, tissue or seed of the present invention, the offspring comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein, the presence of the resistance-conferring Tom2a allele (preferably in homozygous form) leading to ToBRFV resistance. Such offspring itself can be a plant, cutting, seed, cell or tissue.

[0071] As used herein, "progeny" means the first and all other progeny, such as F1, F2 or other generations, produced by crossing a plant of the present invention, wherein the crossing includes crossing with itself or crossing with another plant, and wherein the progeny determined as progeny comprises the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein, which gene leads to resistance to ToBRFV. The plant of the present invention used in the crossing is optionally a plant grown from the seed of deposit NCIMB 43637 or from its progeny seed, the progeny seed being a direct or further progeny produced by crossing a plant grown from the deposited seed with itself or with another plant for one or more generations, wherein the progeny seed retains the resistance-conferring Tom2a allele of the present invention on chromosome 8.

[0072] Progeny also include tomato plants that carry the resistance-conferring Tom2a allele of the present invention on chromosome 8 and are resistant to ToBRFV, and are obtained from the plant of the present invention or the progeny of the plant by vegetative propagation or another form of propagation.

[0073] The present invention further relates to a part of a tomato plant of the present invention suitable for sexual reproduction, which plant part comprises the resistance-conferring Tom2a allele of the present invention on chromosome 8, said resistance-conferring Tom2a allele being as defined herein. Such a part is for example selected from microspores, pollen, ovary, ovule, embryo sac and egg cell.

[0074] In addition, the present invention relates to a part of the tomato plant of the present invention suitable for vegetative propagation, in particular a cutting, root, stem, cell or protoplast comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8, the resistance-conferring Tom2a being as defined herein. The parts of the plant as described above are considered to be propagation material. Plants produced from propagation material comprise the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein, the presence of the resistance-conferring Tom2a allele resulting in ToBRFV resistance.

[0075] The present invention further relates to a tissue culture of a plant of the present invention, which is also a propagation material and comprises in its genome the resistance-conferring Tom2a allele of the present invention on chromosome 8, the resistance-conferring Tom2a allele being as defined herein. The tissue culture comprises regenerated cells. Such a tissue culture may be selected from or derived from any part of a plant, in particular from leaves, pollen, embryos, cotyledons, hypocotyls, meristem cells, roots, root tips, anthers, flowers, seeds or stems. The tissue culture can be regenerated into a tomato plant comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein, wherein the regenerated tomato plant expresses ToBRFV resistance and is also part of the present invention.

[0076] The present invention also relates to the use of the plant of the present invention in plant breeding. Therefore, the present invention also relates to a breeding method for cultivating a cultivated tomato plant resistant to ToBRFV, wherein a plant comprising the Tom2a allele of the present invention on chromosome 8 that confers resistance as defined herein is used to confer said resistance to another plant. Representative seeds that can be used for plant breeding to develop another plant with ToBRFV resistance are deposited in NCIMB with the deposit number NCIMB 43637.

[0077] The present invention also relates to the use of the QTL of the present invention on chromosome 8 for breeding tomato plants resistant to ToBRFV, in particular the use of the Tom2a allele conferring resistance as defined herein for breeding tomato plants resistant to ToBRFV.

[0078] The present invention also relates to a marker for identifying ToBRFV resistance in a tomato plant, or a currant tomato plant, or a plant of another Solanum species that is sexually compatible with tomato, said marker being selected from the group consisting of the SNPs shown in SEQ ID No. 1 to 44, preferably selected from the group consisting of the SNPs shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No. 44, most preferably selected from the group consisting of the SNPs shown in SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 43 and SEQ ID No. 44. Any other marker developed based on the polymorphism in the region defined above between SEQ ID No. 1 and SEQ ID No. 42, in particular based on the polymorphism compared to SEQ ID No. 47, is also part of the present invention.

[0079] The use of any marker selected from the group consisting of the SNPs shown in SEQ ID No. 1 to 44, preferably selected from the group consisting of the SNPs shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No. 44, most preferably selected from the group consisting of the SNPs shown in SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 43 and SEQ ID No. 44 for identifying ToBRFV resistance in a tomato plant, or a gooseberry tomato plant, or a plant of another Solanum species sexually compatible with tomato, is also part of the present invention. Any use of these markers for the development of other markers for identifying QTLs on chromosome 8, in particular for identifying resistance-conferring Tom2a alleles leading to ToBRFV resistance, including determining any other polymorphisms in the region between SEQ ID No. 22 and 34 is also part of the present invention.

[0080] The present invention also relates to a method for selecting ToBRFV-resistant tomato plants, or ToBRFV-resistant currant tomato plants, or ToBRFV-resistant plants of another Solanum species that is sexually compatible with tomato, the method comprising identifying the presence of the resistance-conferring Tom2a allele of the present invention on chromosome 8, and selecting plants comprising the resistance-conferring Tom2a allele as ToBRFV-resistant plants.

[0081] The presence of the resistance-conferring Tom2a allele of the present invention on chromosome 8 is appropriately identified using at least one marker selected from the SNPs shown in SEQ ID No.1 to 44, preferably selected from the SNPs shown in SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, SEQ ID No.43 and SEQ ID No.44, and most preferably selected from the SNPs shown in SEQ ID No.26, SEQ ID No.28, SEQ ID No.43 and SEQ ID No.44.

[0082] The present invention also relates to a method for testing a tomato plant, a currant tomato plant, or a plant of another Solanum species that is sexually compatible with tomato for the presence of the resistance-conferring Tom2a allele of the present invention that confers ToBRFV resistance, the method comprising detecting in the genome of the plant the presence of a marker sequence selected from the SNPs shown in SEQ ID No. 1 to 44, preferably selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No. 44, most preferably a marker selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 43 and SEQ ID No. 44.

[0083] The method of testing the presence of the resistance-conferring Tom2a allele of the present invention in a tomato plant, a currant tomato plant, or another Solanum species plant compatible with tomato optionally further comprises selecting a tomato plant, a currant tomato plant, or another Solanum species plant compatible with tomato as a ToBRFV-resistant plant comprising the resistance-conferring Tom2a allele. The tomato plant, the currant tomato plant, or another Solanum species plant compatible with tomato can then be used as a source for introgressing the Tom2a allele conferring ToBRFV resistance into a tomato plant lacking the resistance-conferring Tom2a allele.

[0084] The present invention also relates to a method for producing a tomato plant resistant to ToBRFV, the method comprising:

[0085] a) crossing a plant of the invention comprising the resistance-conferring Tom2a allele of the invention on chromosome 8 with another plant;

[0086] b) optionally subjecting the plants resulting from the crossing to one or more rounds of selfing and / or crossing to obtain the next generation population;

[0087] c) selecting plants comprising the resistance-conferring Tom2a allele on chromosome 8 as defined herein from the population produced by the cross of step a) or the next generation population of step b), wherein the plants are resistant to ToBRFV when the resistance-conferring Tom2a allele is homozygously present.

[0088] The present invention also relates to a method for producing a tomato plant resistant to ToBRFV, the method comprising:

[0089] a) crossing a first parent plant comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 with a second parent plant, wherein the second parent plant is a plant that does not comprise the resistance-conferring Tom2a allele of the present invention;

[0090] b) backcrossing the plant obtained in step a) with the second parent plant for at least three generations;

[0091] c) selecting plants from the third or higher backcross population that contain at least the resistance-conferring Tom2a allele on chromosome 8 of the first parent plant of step a).

[0092] The selection of plants comprising the resistance-conferring Tom2a allele on chromosome 8 is suitably performed by using a molecular marker genetically linked to the resistance-conferring Tom2a allele, the marker being selected from the SNPs shown in SEQ ID No. 1 to 44, preferably selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No. 44, most preferably selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 43 and SEQ ID No. 44, for identifying the resistance-conferring Tom2a allele on chromosome 8. Alternatively or additionally, the plants may be confirmed to be resistant to ToBRFV, in particular by performing a qPCR test to determine the absence or great reduction of virus titers in the plants after infection with ToBRFV.

[0093] In one embodiment, the plant of the present invention used in the method of producing a tomato plant resistant to ToBRFV is a plant grown from seeds deposited under NCIMB deposit number NCIMB 43637, or a progeny plant thereof.

[0094] The present invention also provides a method for introducing another desired trait into a tomato plant comprising ToBRFV resistance, comprising:

[0095] a) crossing a tomato plant of the invention comprising the Tom2a allele on chromosome 8 conferring resistance with a second tomato plant comprising another desired trait to produce F1 offspring;

[0096] b) optionally selecting plants in the F1 comprising the Tom2a allele conferring resistance and other desired traits;

[0097] c) crossing the optionally selected F1 offspring with either parent to produce backcross offspring;

[0098] d) selecting backcross progeny comprising ToBRFV resistance and other desired traits; and

[0099] E) optionally continuously repeating steps c) and d) one or more times to produce a fourth or higher backcross progeny selected to contain other desired traits and to be resistant to ToBRFV. Optionally backcrossing is performed until the backcross progeny is stable and can be used as a parental line, which can be achieved after 3 to 10 backcrosses.

[0100] In one embodiment, the plant of the present invention used in the method of introducing other desirable traits into a tomato plant comprising ToBRFV resistance is a plant grown from seeds deposited under NCIMB deposit number NCIMB 43637, or a progeny plant thereof.

[0101] Optionally, the selfing step is performed after any hybridization or backcrossing step in the above method. Alternatively, after any hybridization or selfing step of the method, plants that contain the resistance-conferring Tom2a allele of the present invention and other desired traits on chromosome 8 that result in ToBRFV resistance are selected. The other desired traits may be selected from, but are not limited to, the following: resistance to bacterial, fungal or viral diseases, resistance to insects or pests, improved germination rate, plant size, plant type, improved yield, improved shelf life, tolerance to water stress, tolerance to salt stress, tolerance to heat stress, and male sterility. The present invention includes tomato plants produced by the method and tomato fruits obtained therefrom.

[0102] The present invention further relates to a method for producing a tomato plant comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 by using tissue culture or by using vegetative propagation, wherein the homozygous presence of the resistance-conferring Tom2a allele results in resistance to ToBRFV.

[0103] The present invention further provides a method for producing a tomato plant comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 and being resistant to ToBRFV by using double haploid production technology to produce a double haploid line that homozygously comprises the resistance-conferring Tom2a allele of the present invention and is resistant to ToBRFV.

[0104] The present invention further relates to a method for producing a tomato plant comprising the resistance-conferring Tom2a allele of the present invention on chromosome 8 as defined herein, wherein the presence of said resistance-conferring Tom2a allele results in ToBRFV resistance, said method comprising growing a seed comprising said resistance-conferring Tom2a allele into said tomato plant. In one embodiment, the seed used in said method is a seed deposited in NCIMB under the deposit number NCIMB 43637 or a progeny seed thereof.

[0105] The present invention further relates to a method for seed production, comprising growing a tomato plant from the seeds of the present invention, allowing the plant to produce tomato fruits with seeds, harvesting the tomato fruits, and extracting those seeds. The production of seeds is suitably carried out by hybridizing with itself or with another plant, which is optionally also a plant of the present invention. The seeds so produced have the ability to grow into a plant comprising the Tom2a allele that confers resistance of the present invention. In a preferred embodiment of the plant for seed production, the Tom2a allele that confers resistance exists homozygously.

[0106] The present invention further relates to hybrid seeds and methods for producing the hybrid seeds, comprising hybridizing a first parent plant with a second parent plant and harvesting the resulting hybrid seeds, wherein the first parent plant and / or the second parent plant is a plant of the present invention comprising the Tom2a allele of the present invention on chromosome 8 as defined herein that confers resistance. The resulting hybrid seeds and hybrid plants that can be grown from the hybrid seeds are also part of the present invention. In a preferred embodiment, both parental plants contain the Tom2a allele of the present invention that confers resistance, and the hybrid seeds homozygously contain the Tom2a allele of the present invention that confers resistance.

[0107] As used herein, the introgression of the resistance-conferring Tom2a allele of the present invention on chromosome 8 comprises introducing the resistance-conferring Tom2a allele into a recipient plant that does not carry the resistance-conferring Tom2a allele or that carries the resistance-conferring Tom2a allele heterozygously from a donor plant comprising the resistance-conferring Tom2a allele by standard breeding techniques. Breeding methods such as crossing and selection, backcrossing, recombinant selection, or other breeding methods that result in the transfer of genetic sequences from resistant plants to susceptible plants can be used. The selection of plants comprising the resistance-conferring Tom2a allele of the present invention can be carried out by performing a qPCR test, or by observing a bioassay for resistance to ToBRFV, or can be carried out using markers as defined herein, by marker-assisted breeding, or a combination of these selection methods, preferably a marker selected from the SNPs shown in SEQ ID No. 1 to 44, preferably a marker selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No. 44, most preferably a marker selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 43 and SEQ ID No. 44. The donor plant can be a tomato plant, a gooseberry tomato plant, or another Solanum species plant that is sexually compatible with tomato. The selection is started from the F1 generation or any further progeny of the initial cross between the recipient plant and the donor plant, and then further crossed with itself or with another plant, appropriately using the markers identified and defined herein.

[0108] The present invention will be further described in the following examples, and the examples are for illustrative purposes only. The examples are not meant to limit the present invention in any way. In the examples and applications, reference is made to the following drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0109] Figure 1 - Nucleotide sequences of SEQ ID No. 1 to 44, including SNPs indicating ToBRFV resistance.

[0110] Figure 2 - Changes in virus titers in susceptible strains, resistant donors and F2 populations based on qPCR observations.

[0111] Figure 3 - qPCR results of deposits.

[0112] Figure 4 - Tom2a was identified as the causal gene for ToBRFV resistance by marker analysis combined with recombinant line phenotypic analysis.

[0113] Figure 5 - CDS sequence Tom2a gene SEQ ID No.45: GNL_R (resistant), the resistance-conferring allele from GNL.3951 as shown in NCIMB 43637; SEQ ID No.47: reference genome SL3_00 (susceptible); individually and in an aligned manner.

[0114] Figure 6 - Tom2a protein sequences SEQ ID No. 46: protein encoded by the Tom2a allele conferring resistance; SEQ ID No. 48: wild type protein, susceptible; encoded by the reference sequence of SL3_00; individually and in an aligned manner.

[0115] Figure 7 - Average qPCR results showing virus titer (Cq_corr) of plants with susceptible wild type of the line used as susceptible parent in cross-bred isogenic lines, and plants of these isogenic lines have a QTL on chr 11, a QTL on chr 8 comprising the resistance-conferring Tom2a allele of the present invention, a combination of QTLs on chr 8 and chr11, and lacking both QTLs.

[0116] Figure 8 - Prediction of Tom2a protein domains and membrane.

[0117] preservation

[0118] Seeds of tomato (Solanum lycopersicum) population 20R.1552Q08_04 were deposited on July 14, 2020 with the deposit number NCIMB 43637 at NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, UK, and the seeds homozygously contain the Tom2a allele conferring resistance of the present invention on chromosome 8. Example

[0119] Example 1

[0120] Mapping of the ToBRFV resistance QTL on chromosome 8

[0121] It was observed that the BC3F2 populations made from the currant tomato source GNL.3951 and the internal breeding line TB2 had good phenotypic resistance levels in the early stage, but when qPCR was performed, they separated the virus titer levels. The source plant itself had a low virus titer after infection (Example 2, Figure 2, Table 5), so it was clear that the complete resistance mechanism was not transferred during the breeding process. Since resistance is expected to be more reliable when viral replication is restricted, it was decided to hybridize BC3F2 with the donor plant again to obtain a new F1. Subsequently, F2 populations were prepared from 3 F1 plants, and qPCR observations were performed again to determine the virus titer in the plant after infection with ToBRFV. It was observed that two populations had virus titer levels comparable to the source plants, which means that the plants not only had no symptoms, but also that the virus replication in the plants was greatly reduced. However, the third population showed a large number of separations in the qPCR test (Example 3, Figure 2).

[0122] This observation was followed by extensive marker analysis to determine which genetic regions remained heterozygous and to identify differences between the three populations. In this way, it appeared that the region on chromosome 8 could be responsible for the restriction of viral replication and the better resistance levels. This region was fixed for the two F2 populations that showed low viral titers, but remained isolated for the populations where there was viral segregation in the plants after infection. This QTL region on chromosome 8 could be further narrowed down through further fine mapping. The identification of recombinants within the original QTL initially produced a smaller region of approximately 1.5 Mbp, located between SEQ ID No.1 and SEQ ID No.42. Within this region, a number of polymorphic SNP markers linked to the QTL were identified.

[0123] The polymorphic SNP markers present in the QTL region identified in this analysis are listed in Table 4. The exact physical location of the SNPs based on the published SL3_00 tomato map can also be found in Table 4. Figure 1 gives the sequences of these markers, i.e., the SNPs representing resistance are combined with many surrounding nucleotides for marker design. These markers, in particular the SNPs in these markers, were determined to be co-segregated with the QTL. The markers can be used to identify the presence of the QTL in plants grown from the deposit or their progeny. These markers can further be used to identify the presence of the QTL on chromosome 8 of the present invention for ToBRFV resistance in any other tomato population containing the QTL. In addition, the markers can be used to identify resistance in currant tomatoes or another Solanum species.

[0124] Further observations were made on F2 and F3 plants selected to homozygously harbor the QTL, which confirmed that the presence of the QTL resulted in disease scores averaging 0–1, occasionally approaching 1.5, and low virus titers observed by qPCR analysis, according to the ranking described in Table 3. Further backcrosses were performed using the breeding line as the recurrent parent, and in subsequent selfed populations of the backcross generation, the homozygous presence of the QTL was found to result in plants resistant to ToBRFV.

[0125] Table 4

[0126]

[0127]

[0128] The position of the SNP occurs at position 101 of SEQ ID No., as shown in Figure 1, where the position is indicated in bold and underlined. For SEQ ID No. 28, the polymorphism used as a marker is located at positions 101-104. For SEQ ID No. 30, the polymorphism used as a marker is located at positions 101-103. In this way, when compared to the wild-type sequence, a GCC deletion and a G deletion can be identified after position 101, respectively.

[0129] SEQ ID No. 28 and 30 are not technically SNPs, as they are not single nucleotide polymorphisms, but indels. SEQ ID No. 28 has a deletion of nucleotides TGCC starting at position 61.253.155 of the wild-type sequence in the published reference genome, with the nucleotides TGCC being replaced by T, resulting in an actual GCC deletion. The positions corresponding to 61.253.155 to 61.253.161 in the wild-type sequence are TGCCGCT, while the resistant strain has TGCT, i.e., a GCC deletion, as shown at positions 101-104 of SEQ ID No. 28. SEQ ID No. 30 has a deletion of nucleotides TG starting at position 61.254.440 of the wild-type sequence in the published reference genome, with the nucleotides TG being replaced by T, resulting in an actual G deletion. The positions corresponding to 61.254.440 to 61.254.443 in the wild-type sequence are TGGA, while the resistant strain has TGA, ie there is a G deletion, as shown at positions 101-103 of SEQ ID No. 30. For simplicity, in the context of the present invention, these insertion deletion polymorphisms are also referred to as SNPs.

[0130] Example 2

[0131] qPCR testing of sources of ToBRFV resistance

[0132] The source plants of the ToBRFV resistance phenotype were infected with ToBRFV and then the virus titer was observed. This was done to determine whether the resistance was only phenotypic, so that there were no symptoms but the virus was still replicating, so the source plants could be called tolerant, or if the virus titer was really greatly reduced or even absent, so the source plants were truly resistant.

[0133] The measurement of virus titer was accomplished by performing a qPCR test. In this test, leaf punch samples with a diameter of approximately 6 mm were taken from ToBRFV-infected plants. These samples were ground in 500 μl of PBS buffer solution, and 50 μl of the resulting suspension was used in a 96-well KingFisher Flex separation protocol. Isolation of leaf material was performed using the innuPREP DNA / RNA Virus PLUS Kit. The samples were analyzed in a 96CFX qPCR thermal cycler (Biorad) using a program of 5 minutes at 50°C, 20 seconds at 95°C, followed by 40 cycles of 10 seconds at 95°C and 60 seconds at 60°C. The number of cycles required to obtain a PCR product is a measure of the amount of virus present in the sample (Cq_ToBRFV). In order to be able to compare samples with different genetic backgrounds and with different sample sizes, the tomato reference gene PHD gene was included in each PCR run to correct the results (Cq_PHD). The final value Cq_corr for each sample is calculated as Cq_ToBRFV-Cq_PHD=Cq_corr. Since Cq_PHD is usually between 25 and 29, samples with very high virus titers (e.g., Cq_ToBRFV of 7) will result in a final Cq_corr of approximately -20. Samples with low virus titers will result in a Cq_corr of approximately -10 to 0.

[0134] The primers used in the assay are given in Table 1. The PCR volumes used in the assay are given in Table 2.

[0135] From five different trials, samples of two in-house breeding lines (TO1 and TB2) and two source plants with a resistant phenotype (i.e., they were asymptomatic in the bioassay) were collected. In each trial, 5 to 10 plants were included for each line. Each of these samples was subjected to qPCR analysis to determine the viral titer after infection. The first trial, Jordan_Winter, was an actively inoculated field trial. The other trials were conducted under controlled conditions, whereby seedlings were inoculated and scored. Some differences between the results of each genotype were observed in the different trials, but there was an excellent correlation between viral titer and genotype (Table 5). The two tolerant lines scored comparable and had average Cq_corr values ​​between -14.94 and -19.94. The asymptomatic source GNL.3919 obviously must be considered a tolerant source, as the viral titer was not much lower than that of the susceptible breeding lines, with values ​​between -11.70 and -17.19. However, the other source, GNL.3951, scored very convincingly in all trials and had consistently low virus titer levels, with average Cq_corr values ​​for each trial between -0.40 and -8.75. Therefore, it was confirmed that in order to obtain true resistance with reduced viral replication in plants, the genetics of GNL.3951 must be used.

[0136] Table 5 - Average Cq_corr scores for the trials

[0137]

[0138] Example 3

[0139] qPCR testing of ToBRFV backcrosses and F2 populations and deposits

[0140] BC3F2 populations were initially generated between GNL.3951 and the susceptible tomato line TB2 as described in Example 1. Virus titers were determined in samples of these populations subjected to the ToBRFV bioassay and were found to be incomparable to those of GNL.3951 origin. Therefore, a new cross was made between BC3F2 and GNL.3951 and this F1 was selfed to obtain an F2 population.

[0141] Once again, three F2 populations were infected with ToBRFV to observe viral symptoms. In these three F2 populations generated from three F1 plants, a virus resistance phenotype was found to be present. However, when a qPCR assay was performed to determine the viral titer, the viral titer of one of the F2 populations showed clear separation, while the other two populations had viral titer levels comparable to the resistance sources (Figure 2). It was concluded that true resistance, i.e. a reduction in viral replication, cannot necessarily be determined by bioassays, but must be confirmed by tests measuring viral titers. It was also confirmed that it is possible to obtain true resistance, i.e. a reduction in viral titer, in tomato plants.

[0142] From one of the F2 populations in which no viral titer was isolated in qPCR, an F3 population was obtained by selfing. As described in Example 1, using markers developed in parallel from the QTL analysis, it was confirmed that the plants had a QTL on chromosome 8 linked to the markers of Table 4. Once again, the plants were infected with ToBRFV and qPCR analysis of viral titer was performed. It was confirmed that the F3 population also had a reduction in viral replication, so these plants maintained resistance (Figure 3). It was found that the markers developed for QTL on chromosome 8 were co-segregated with the reduction in viral titer and can therefore be used to identify a reduction in viral titer. One of these F3 populations, 20R.1552Q08_4, was subsequently deposited as NCIMB 43637 for use in the present invention.

[0143] Example 4

[0144] Identification of Tom2a as a causal gene for ToBRFV resistance

[0145] In order to determine the actual gene that confers ToBRFV resistance in the QTL region on chromosome 8, a further fine mapping step was first performed using recombinants (i.e., lines with recombination in the QTL region, derived from the lines originally used). After phenotyping of the recombinants, the QTL region involved was shortened to the region of markers shown in SEQ ID No. 22 to SEQ ID No. 34. Within this region, there are seven putative genes (Figure 4).

[0146] Initially, markers with SEQ ID No.26, SEQ ID No.29 and SEQ ID No.30 were identified as the most preferred, and these markers were present in one of those genes, identified as Solyc08g077220.3 in the S13_00 genome, and named Tom2a. The purpose was to confirm that this gene was a gene that conferred resistance in the material. The resistance was conferred by the alleles of the genes disclosed herein.

[0147] In the newly developed group of lines, selfing was performed again to obtain further recombinants. These recombinants were analyzed with the 13 markers present in this region (SL001–SL013 in Figure 4) and it was found that the population included plants with recombination on both sides of the Tom2a gene. Recombination between SL004 and SL005 separated the gene left by Solyc08g077220.3 from this region. Recombination between SL009 and SL010 separated Solyc08g077220.3 from Solyc08g 077230.3. These recombinants were phenotyped to determine whether the resistance phenotype was indeed associated with the presence of the Tom2a gene.

[0148] Figure 4 shows the marker map and phenotypic analysis scores of the recombinant strains. The indicator genes in this region are identified based on the annotations of the public ITAG3.2 reference, which can be found, for example, on the solgenomics website. If the gene cluster left by SL005 contains a causal gene, the phenotypes of all 12 recombinants, except 07, deviate from expectations. Therefore, these genes can be excluded. The phenotype of recombinant 07 meets the expectations of Solyc08g077220.3 (i.e., Tom2a), which is the causal gene for ToBRFV resistance. Through these observations, it is indeed confirmed that the alleles of the Tom2a gene in the resistant material lead to ToBRFV resistance in the tomato line.

[0149] Example 5

[0150] Virus titers of materials with QTL on chr 8 and QTL on chr 11

[0151] Isogenic strains were produced by breeding of BC2F3 populations. Strains containing Tom2a alleles conferring resistance, strains having QTLs of the present invention as described in WO2019110821 on chromosome 11, strains having a combination of QTLs on chromosomes 8 and 11, and strains having susceptible versions of QTLs on chromosomes 8 and 11 were inoculated and analyzed together with susceptible parents used to breed isogenic BC2F3 strains in hybridization. The QTL on chromosome 11 contains a CCA gene conferring resistance and / or an Albino3-like gene conferring resistance. After inoculation, qPCR analysis of viral titers was performed as described in Example 2.

[0152] The results are shown in Figure 7. It was found that the reduction in virus titer in the strains with the resistance-conferring Tom2a allele (4_IL_QTL08) combined with the QTL on chromosome 11 (5_IL_QTL08+11) was even further reduced. This is a very surprising effect, because the strains with only the QTL on chromosome 11 (3_IL_QTL11) had limited reduction in virus titer. The isogenic strain lacking both resistance QTLs (2_IL_wild type) had similar virus titers to the susceptible parent (1_original strain). Therefore, it can be concluded that by combining the QTLs on chromosomes 8 and 11, stronger and more durable resistance can be obtained in tomatoes. By combining the resistance-conferring Tom2a allele with the resistance-conferring CCA gene or with the resistance-conferring Albino3-like gene, stronger and more durable ToBRFV resistance can be obtained in particular.

Claims

1. Use of a QTL on chromosome 8 in preparing tomato (Solanum lycopersicum) plants, wherein the QTL on chromosome 8 is located between SEQ ID No. 1 and SEQ ID No. 42, and when the QTL is homozygous, it confers ToBRFV resistance, wherein the QTL is present in the genome of the tomato plant, and representative seeds of the tomato plant are deposited in NCIMB with the deposit number NCIMB 43637.

2. The use according to claim 1, wherein the QTL comprises a Tom2a allele that confers resistance, and the Tom2a allele that confers resistance comprises SEQ ID No.

45.

3. The use according to claim 1, wherein the presence of the QTL on chromosome 8 is genetically linked to at least one marker selected from the SNPs shown in SEQ ID No. 1 to 44.

4. The method according to claim 3, wherein the marker is selected from the SNPs shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 34, SEQ ID No. 42, SEQ ID No. 43 and SEQ ID No.

44.

5. The use according to any one of claims 1 to 4, wherein the QTL is introgressed into a tomato plant from NCIMB 43637 or a progeny plant thereof homozygously comprising the QTL.

6. Use according to claim 1, 2 or 3, wherein the QTL is introgressed into a tomato plant from a plant of the species Solanum impinellifolium or from a plant of another Solanum species that is sexually compatible with tomato.

7. Use of a QTL on chromosome 8 as defined in any one of claims 1 to 4 for the preparation of a cell of a tomato plant, said cell comprising in its genome the QTL on chromosome 8.

8. Use of a QTL on chromosome 8 as defined in any one of claims 1 to 4 for preparing tomato seeds, wherein the plant grown from the seeds is a plant as defined in any one of claims 1 to 6.

9. Use of the QTL on chromosome 8 as defined in any one of claims 1 to 4 in the preparation of propagation material suitable for producing a tomato plant as defined in any one of claims 1 to 6, wherein the propagation material is suitable for sexual reproduction; or the propagation material is suitable for vegetative reproduction, or the propagation material is suitable for tissue culture of regenerated cells; wherein the plant produced by the propagation material contains a QTL on chromosome 8, which causes ToBRFV resistance.

10. The use according to claim 9, wherein the propagation material suitable for sexual reproduction is selected from microspores, pollen, ovary, ovule, embryo sac and egg cell.

11. Use according to claim 9, wherein the propagation material suitable for vegetative propagation is selected from cuttings, roots, stems, cells and protoplasts.

12. The method of claim 9, wherein the propagation material suitable for tissue culture of the regenerated cells is selected from the group consisting of leaves, pollen, embryos, cotyledons, hypocotyls, meristem cells, root tips, anthers, flowers, seeds and stems.

13. The use according to claim 9, wherein the propagation material suitable for tissue culture of regenerating cells is a root.

14. A marker for identifying ToBRFV resistance in tomato plants, the marker being selected from the SNPs shown in SEQ ID No. 1 to 44, the SNP being genetically linked to a QTL on chromosome 8, the QTL being located between SEQ ID No. 1 and SEQ ID No. 42, and conferring ToBRFV resistance when the QTL is homozygous. The QTL is present in the genome of the tomato plant, and representative seeds of the tomato plant are deposited in NCIMB under the accession number NCIMB 43637.

15. A marker for identifying ToBRFV resistance in a tomato plant, or a plant of another Solanum species that is sexually compatible with tomato, the marker being selected from the SNPs shown in SEQ ID No. 1 to 44, the SNPs being genetically linked to a QTL on chromosome 8, the QTL being located between SEQ ID No. 1 and SEQ ID No. 42, and conferring ToBRFV resistance when the QTL is homozygously present, wherein the QTL is present in the genome of a tomato plant, representative seeds of the tomato plant being deposited in the NCIMB under the deposit number NCIMB 43637.

16. The marker according to claim 14 or 15, wherein the marker is selected from the SNPs shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 43 and SEQ ID No.

44.

17. A method for producing a ToBRFV-resistant tomato plant, the method comprising introgressing the QTL defined in any one of claims 1 to 4 into a tomato plant.

18. A method for selecting ToBRFV-resistant tomato plants, the method comprising identifying the presence of a QTL on chromosome 8 as defined in any one of claims 1 to 4, and selecting plants comprising said QTL as ToBRFV-resistant plants.

19. A method for selecting ToBRFV-resistant currant tomato plants, or plants of another Solanum species that are sexually compatible with tomato, the method comprising identifying the presence of a QTL on chromosome 8 as defined in any one of claims 1 to 4, and selecting plants comprising said QTL as ToBRFV-resistant plants.

20. The method according to claim 18 or 19, wherein the presence of the QTL on chromosome 8 is identified by using a marker selected from the SNPs shown in SEQ ID Nos. 1 to 44.

21. The method of claim 20, wherein the marker is selected from the SNPs shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 34, SEQ ID No. 42, SEQ ID No. 43 and SEQ ID No.

44.

22. A method for producing a tomato plant resistant to ToBRFV, the method comprising: a) crossing a plant comprising the QTL on chromosome 8 as defined in any one of claims 1 to 4 with another plant; b) selecting a plant comprising the QTL on chromosome 8 as defined in any one of claims 1 to 4 from the plants produced by the cross of step a), said plant being resistant to ToBRFV when said QTL is homozygously present.

23. The method according to claim 22, further comprising, after step a), performing one or more rounds of selfing and / or hybridization on the plants produced by hybridization in step a) to obtain a next generation population, and wherein the selection in step b) comprises selecting plants from the plants produced in step a) or from the next generation population.

24. The method according to claim 22, wherein the selection of plants comprising the QTL on chromosome 8 is performed by using a molecular marker genetically linked to the QTL, the marker being selected from the SNPs shown in SEQ ID No. 1 to 44.

25. The method of claim 24, wherein the marker is selected from the SNPs shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 34, SEQ ID No. 42, SEQ ID No. 43 and SEQ ID No.

44.

26. The method according to any one of claims 22-25, wherein plants resistant to ToBRFV are selected phenotypically.

27. The method of claim 26, wherein plants resistant to ToBRFV are selected by using a bioassay phenotype for ToBRFV resistance, or by using a qPCR test.

28. The method according to any one of claims 22-25, wherein the plant comprising the QTL on chromosome 8 as defined in any one of claims 1-4 is a plant grown from seeds deposited under NCIMB deposit number NCIMB 43637 or a progeny plant thereof homozygously comprising the QTL.

29. A method for producing tomato hybrid seeds, the method comprising hybridizing a first parent plant with a second parent plant and harvesting the resulting hybrid seeds, wherein the first parent plant and the second parent plant are ToBRFV-resistant plants, and the plants contain a QTL as defined in any one of claims 1 to 4 on chromosome 8, wherein the presence of the QTL causes the hybrid plant grown from the seeds to be resistant to ToBRFV.

30. Use of a QTL on chromosome 8 as defined in any one of claims 1 to 4 in the preparation of hybrid seeds produced according to the method of claim 29. The resistance-conferring Tom2a allele on the QTL on chromosome 31.8, whose sequence is shown in SEQ ID No. 45, and the QTL is located between SEQ ID No. 1 and SEQ ID No. 42, and confers ToBRFV resistance when the QTL is homozygous. The QTL is present in the genome of a tomato plant, and representative seeds of the tomato plant are deposited in NCIMB under the accession number NCIMB43637.

32. The Tom2a allele conferring resistance according to claim 31, which encodes the protein shown in SEQ ID No.

46.

33. A genome comprising a QTL on chromosome 8 as defined in any one of claims 1 to 4.

Images