Exosome and preparation method and application thereof

By preparing and screening exosomes and miRNA from peripheral blood mononuclear cells, the treatment problem of Alzheimer's disease has been solved, and the application of exosomes in the preparation of drugs has been realized, especially the inhibition of inflammatory factors and TNF signaling pathways, providing a new and effective way to treat Alzheimer's disease.

CN116200339BActive Publication Date: 2025-10-10SUN YAT SEN UNIVERSITY SHENZHEN +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310110337.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-30
Publication Date
2025-10-10
Estimated Expiration
2043-01-30

AI Technical Summary

Technical Problem

The relationship between exosomes and Alzheimer's disease has not been deeply studied in the existing technology, and there is a lack of effective exosome preparation methods for treating or preventing Alzheimer's disease.

Method used

By reprogramming peripheral blood mononuclear cells using Sendai-virus technology, human-derived induced neural progenitor cells were generated and differentiated into GABA-producing progenitor cells. Exosomes were collected from the culture medium and separated by gradient centrifugation to a particle size of 80-150 nm for the development of drugs for the treatment and prevention of Alzheimer's disease. Simultaneously, the miRNA hsa-miR-7-5p was screened to target TRAF5 and inhibit the TNF signaling pathway.

Benefits of technology

The prepared exosomes can effectively inhibit the secretion of inflammatory factors by astrocytes and PBMNCs, and have anti-inflammatory and anti-dementia effects. The miRNA hsa-miR-7-5p can target TRAF5 and inhibit the TNF signaling pathway, providing a new method for the treatment of Alzheimer's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0004076603250000011
    Figure HDA0004076603250000011
Patent Text Reader

Abstract

The application discloses exosomes and a preparation method and application thereof, and the preparation method comprises the following steps: being separated from a culture solution of human-derived induced neural precursor cells or a culture solution of gamma-aminobutyric acid precursor cells differentiated from the human-derived induced neural precursor cells; and the human-derived induced neural precursor cells are prepared by reprogramming of peripheral blood mononuclear cells (PBMNC) through Sendai-virus technology. The exosomes prepared by the scheme are separated from the culture solution of human-derived induced neural precursor cells or the culture solution of gamma-aminobutyric acid precursor cells differentiated from the human-derived induced neural precursor cells, can effectively inhibit secretion of inflammatory factors by astrocytes and PBMNC, and have anti-inflammatory and anti-dementia effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to exosomes and a preparation method and application thereof. Background Art

[0002] Exosomes are a type of extracellular vesicles approximately 30–150 nm in diameter, produced by the fusion of multivesicular bodies (MVBs) with the plasma membrane and released into the extracellular space. Virtually all cell types, both in vivo and in vitro, including those in the central nervous system, can secrete exosomes under physiological or pathological conditions. To date, exosomes have been isolated from various body fluids, such as blood, cerebrospinal fluid, and urine. Exosomes from different cells contain a complex and diverse array of proteins, miRNAs, and other substances. Therefore, exosomes can play a variety of physiological and pathological roles, including directly acting on receptor cells, transporting substances between cells, and transducing signals.

[0003] Alzheimer's disease is a progressive neurodegenerative disease with an insidious onset. Alzheimer's disease (AD) is a type of Alzheimer's disease, and its pathological characteristics are mainly senile plaques formed by abnormal extracellular aggregation of β-amyloid protein (β-Amyloid, Aβ) and neural tangles formed by excessive phosphorylation of Tau protein in cells.

[0004] Currently, the relationship between exosomes and Alzheimer's disease still needs further research. Summary of the Invention

[0005] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention provides a method for preparing exosomes, wherein the exosomes prepared by the method can be effectively used to treat or prevent Alzheimer's disease.

[0006] The present invention also provides the above-mentioned exosomes.

[0007] The present invention also provides an application of the exosomes.

[0008] The present invention also provides a miRNA.

[0009] The present invention also provides a biomaterial related to the miRNA.

[0010] The present invention also provides an application of miRNA or the above-mentioned biological material.

[0011] The present invention also provides a medicine for treating or preventing Alzheimer's disease.

[0012] According to a first aspect of the present application, a preparation method of exosomes is provided, comprising the following steps: A1. reprogramming peripheral blood mononuclear cells by Sendai-virus technology to prepare human induced neural precursor cells;

[0013] A2. isolating the exosomes from at least one of the following a) and b):

[0014] a) culture solution of the human induced neural precursor cells;

[0015] b) culture solution of GABAergic precursor cells differentiated from the human induced neural precursor cells.

[0016] In some embodiments of the present application, the culture solution is culture supernatant.

[0017] In some embodiments of the present application, the reprogramming inducing factors comprise at least one of OCT3 / 4, SOX2, KLF4, and c-MYC.

[0018] In some embodiments of the present application, the culture solution is collected when the cells are cultured to 70%-90% confluence.

[0019] In some embodiments of the present application, the isolation method adopts gradient centrifugation.

[0020] In some embodiments of the present application, the gradient centrifugation comprises sequentially centrifuging the culture solution at 700-800xg for 8-12min, 8000-12000xg for 30-50min, and 80000-120000xg for 50-70min.

[0021] According to a second aspect of the present application, an exosome is provided, which is prepared by the above method.

[0022] In some embodiments of the present application, the particle size of the exosomes is 80-150nm.

[0023] In some embodiments of the present application, the particle size of the exosomes of the human induced neural precursor cells is 120-150nm.

[0024] In some embodiments of the present application, the particle size of the exosomes of the GABAergic precursor cells is 80-100nm.

[0025] According to a third aspect of the present application, the exosomes of the above neural precursor cells or GABAergic precursor cells are provided for use in the preparation of a drug for treating and / or preventing senile dementia.

[0026] In some embodiments of the present invention, the application is application in the preparation of an IL-3 expression promoter.

[0027] In some embodiments of the present invention, the application is application in the preparation of a TGF-β1 expression promoter.

[0028] In some embodiments of the present invention, the application is application in the preparation of an IL-12 expression inhibitor.

[0029] In some embodiments of the present invention, the application is application in the preparation of a TNF-α expression inhibitor.

[0030] In some embodiments of the present invention, the application is application in the preparation of an IL-10 expression inhibitor.

[0031] In some embodiments of the present invention, the application is application in the preparation of a medicine for treating inflammation.

[0032] In some embodiments of the present invention, the application is application in the preparation of medicines for improving immunity.

[0033] In some embodiments of the present invention, the application is application in the preparation of a T cell activation inhibitor.

[0034] In some embodiments of the present invention, the application is application in the preparation of a TNF signaling pathway inhibitor.

[0035] In some embodiments of the present invention, the application is application in the preparation of neuron repair drugs.

[0036] In some embodiments of the present invention, the application is application in medicines for regulating neuronal neurite outgrowth.

[0037] In some embodiments of the present invention, the application is application in the preparation of a medicine for inhibiting astrocyte activity.

[0038] According to a fourth aspect of the present invention, a miRNA is provided, wherein the nucleic acid sequence of the miRNA is as shown in SEQ ID NO.1 or is a nucleic acid sequence obtained by modifying, replacing, deleting or adding at least one base of the nucleic acid sequence shown in SEQ ID NO.1.

[0039] In some embodiments of the present invention, the miRNA is isolated from exosomes.

[0040] According to a fifth aspect of the present invention, a biomaterial related to the above-mentioned miRNA is provided, wherein the biomaterial is any one of 1) to 4):

[0041] 1) The aforementioned miRNA precursors;

[0042] 2) the miRNA mimics as described above;

[0043] 3) a DNA molecule encoding the miRNA as described above or the miRNA precursor as described in 1);

[0044] 4) an expression cassette, a recombinant vector or a transgenic cell containing the DNA molecule as described in 3).

[0045] According to a sixth aspect of the present application, there is provided an application of the miRNA or the biological material as described above, the application being an application in a medicine for treating and / or preventing Alzheimer's disease.

[0046] In some embodiments of the present application, the application is an application in preparing a medicine for treating and / or preventing tumors.

[0047] In some embodiments of the present application, the application is an application in preparing an IL-1β expression inhibitor.

[0048] In some embodiments of the present application, the application is an application in preparing a TNF-α expression inhibitor.

[0049] In some embodiments of the present application, the application is an application in preparing an IL-6 expression inhibitor.

[0050] In some embodiments of the present application, the application is an application in preparing a medicine for treating inflammation.

[0051] In some embodiments of the present application, the application is an application in preparing a medicine for improving immunity.

[0052] In some embodiments of the present application, the application is an application in preparing a TNF signaling pathway inhibitor.

[0053] In some embodiments of the present application, the application is an application in preparing a TRAF5 expression inhibitor.

[0054] In some embodiments of the present application, the application is an application in preparing a NF-κB expression inhibitor.

[0055] In some embodiments of the present application, the application is an application in preparing an ERK1 expression promoter.

[0056] In some embodiments of the present application, the application is an application in preparing a CREB expression promoter.

[0057] In some embodiments of the present application, the application is an application in preparing a medicine for repairing neurons.

[0058] In some embodiments of the present invention, the application is application in medicines for regulating neuronal neurite outgrowth.

[0059] In some embodiments of the present invention, the application is application in the preparation of a medicine for inhibiting astrocyte activity.

[0060] In a seventh aspect, the present invention provides a drug for treating and / or preventing Alzheimer's disease, which comprises the above-mentioned exosomes, miRNA or the above-mentioned biomaterial.

[0061] In some embodiments of the present invention, the drug further comprises a drug carrier and / or a pharmaceutical excipient.

[0062] In some embodiments of the present invention, the pharmaceutical carrier includes at least one of a diluent, an excipient, a filler, a binder, a disintegrant, an absorption enhancer, a surfactant, an adsorption carrier, a lubricant, a sweetener, and a flavoring agent.

[0063] In some embodiments of the invention, the excipient comprises water.

[0064] In some embodiments of the present invention, the filler comprises at least one of starch and sucrose.

[0065] In some embodiments of the present invention, the binder comprises at least one of a cellulose derivative, alginate, gelatin, and polyvinyl pyrrolidone.

[0066] In some embodiments of the invention, the humectant comprises glycerin.

[0067] In some embodiments of the present invention, the disintegrant comprises at least one of agar, calcium carbonate and sodium bicarbonate.

[0068] In some embodiments of the present invention, the absorption enhancer comprises a quaternary ammonium compound.

[0069] In some embodiments of the invention, the surfactant comprises cetyl alcohol.

[0070] In some embodiments of the present invention, the adsorption carrier includes at least one of kaolin and bentonite.

[0071] In some embodiments of the present invention, the lubricant includes at least one of talc, calcium stearate, magnesium stearate and polyethylene glycol.

[0072] In some embodiments of the present invention, the dosage form of the drug is powder, ointment, drops, gel, lozenge, granules, suspension, syrup, patch, capsule, spray, tablet, pill, injection, gel or oral solution.

[0073] In some embodiments of the present application, the powder includes a powder for dispersion and a lyophilized powder.

[0074] In some embodiments of the present application, the cream includes a cream and a paste.

[0075] According to some embodiments of the present application, at least the following advantages are achieved: the exosomes prepared by the present application are isolated from the culture solution of human-derived induced neural precursor cells or the culture solution of gamma-aminobutyric precursor cells differentiated from human-derived induced neural precursor cells, can effectively inhibit the secretion of inflammatory factors by astrocytes and PBMNC, and have anti-inflammatory and anti-dementia effects; meanwhile, the miRNA hsa-miR-7-5p isolated from the exosomes can target tumor necrosis factor-related factor 5 (TRAF5) to inhibit the TNF signal pathway, can be effectively used for anti-tumor and treatment of senile dementia, and provides a new possibility for drugs for treating senile dementia. BRIEF DESCRIPTION OF DRAWINGS

[0076] The present application will be further described below in combination with the drawings and examples, in which:

[0077] Figure 1 Figure 1 is a vector map of the pcdh-cmv-app(NM_0004844)*flag-ef1-gfp-t2a-puro vector in the embodiments of the present application;

[0078] Figure 2 Figure 2 is a vector structure diagram of the APP gene overexpression lentiviral vector pCDH-CMV-APP in the embodiments of the present application;

[0079] Figure 3 Figure 3 is a detection result diagram of the relative expression amount of APP protein in hiNPCs and APP hiNPCs cells in the embodiments of the present application, in which "**" represents p<0.01;

[0080] Figure 4 Figure 4 is a detection result diagram of the relative expression amount of APP mRNA in hiNPCs and APP hiNPCs cells in the embodiments of the present application, in which "**" represents p<0.01;

[0081] Figure 5 Figure 5 is a Western blot detection result diagram of the APP protein expression in hiNPCs and APP hiNPCs cells in the embodiments of the present application;

[0082] Figure 6A heat map of differentially expressed miRNAs (DEmis) for comparison between the hiMGEs-EXO group and the APP hiMGEs-EXO group in the embodiments of the present application, wherein 1, 2, 3 are respectively 3 samples of the hiMGEs-EXO group; 4, 5, 6 are respectively 3 samples of the APP hiMGEs-EXO group;

[0083] Figure 7 A Reactom enrichment bubble chart for predicting target genes of DEmis in the embodiments of the present application;

[0084] Figure 8 A morphology chart of exosomes of different sources detected by a transmission electron microscope in the test examples of the present application, wherein the scale is 60 nm;

[0085] Figure 9 A particle size distribution chart of exosomes in the test examples of the present application;

[0086] Figure 10 A Western blot detection result chart of exosomes expressing cell membrane markers Alix, CD9 and TSG101 in the test examples of the present application, wherein 1 is the hiNPCs-EXO group; 2 is the hiMGEs-EXO group; 3 is the APP hiNPCs-EXO group; 4 is the APP hiMGEs-EXO group;

[0087] Figure 11 A result chart of ELISA detection of IL-3 levels of stimulated PBMNCs in the test examples of the present application, wherein "*" is p<0.05, "**" is p<0.01, and "****" is p<0.001;

[0088] Figure 12 A result chart of ELISA detection of IL-12 levels of stimulated PBMNCs in the test examples of the present application, wherein "**" is p<0.01, "***" is p<0.005, and "****" is p<0.001;

[0089] Figure 13 A result chart of ELISA detection of TNF-α levels of stimulated PBMNCs in the test examples of the present application, wherein "**" is p<0.01, "***" is p<0.005, and "****" is p<0.001;

[0090] Figure 14 A result chart of ELISA detection of TGF-β1 levels of stimulated PBMNCs in the test examples of the present application, wherein "**" is p<0.01, "***" is p<0.005, and "****" is p<0.001;

[0091] Figure 15Figure showing the results of the ELISA test for measuring the IL-10 level of the stimulated PBMNCs in the test example of the present application, wherein "***" means p<0.005 and "****" means p<0.001;

[0092] Figure 16 Figure showing the results of the RT-PCR test for measuring the IL-12 mRNA content of the PBMNCs in the test example of the present application, wherein "*" means p<0.05, "**" means p<0.01 and "****" means p<0.001;

[0093] Figure 17 Figure showing the results of the RT-PCR test for measuring the TGF-β1 mRNA content of the PBMNCs in the test example of the present application, wherein "**" means p<0.01;

[0094] Figure 18 Figure showing the results of the RT-PCR test for measuring the IL-10 mRNA content of the PBMNCs in the test example of the present application, wherein "*" means p<0.05, "**" means p<0.01 and "***" means p<0.005;

[0095] Figure 19 Figure showing the results of the ELISA test for measuring the IL-3 level of the stimulated astrocytes in the test example of the present application, wherein "*" means p<0.05 and "**" means p<0.01;

[0096] Figure 20 Figure showing the results of the ELISA test for measuring the IL-12 level of the stimulated astrocytes in the test example of the present application, wherein "***" means p<0.005 and "****" means p<0.001;

[0097] Figure 21 Figure showing the results of the ELISA test for measuring the TNF-α level of the stimulated astrocytes in the test example of the present application, wherein "**" means p<0.01 and "***" means p<0.005;

[0098] Figure 22 Figure showing the results of the ELISA test for measuring the TGF-β1 level of the stimulated astrocytes in the test example of the present application, wherein "**" means p<0.01, "***" means p<0.005 and "****" means p<0.001;

[0099] Figure 23 Figure showing the results of the ELISA test for measuring the IL-10 level of the stimulated astrocytes in the test example of the present application, wherein "**" means p<0.01 and "****" means p<0.001;

[0100] Figure 24Figure showing the results of RT-PCR assay for representative astrocyte IL-12 mRNA content in the test examples of the present application, wherein "**" means p<0.01 and "****" means p<0.001;

[0101] Figure 25 Figure showing the results of RT-PCR assay for representative astrocyte TGF-β1 mRNA content in the test examples of the present application, wherein "*" means p<0.05 and "**" means p<0.01;

[0102] Figure 26 Figure showing the results of RT-PCR assay for representative astrocyte IL-10 mRNA content in the test examples of the present application, wherein "*" means p<0.05 and "**" means p<0.01;

[0103] Figure 27 Figure showing the results of CFSE proliferation assay in the test examples of the present application;

[0104] Figure 28 Figure showing the results of PBMNCs cell proliferation rate assay in the test examples of the present application, wherein "**" means p<0.01, "***" means p<0.005 and "****" means p<0.001;

[0105] Figure 29 Figure showing the results of CFSE-labeled CD3+ T cell proliferation assay in the test examples of the present application;

[0106] Figure 30 Figure showing the results of CD3 + T cell proliferation rate assay in the test examples of the present application, wherein "**" means p<0.01, "***" means p<0.005 and "****" means p<0.001;

[0107] Figure 31 Figure showing the results of scratch assay in the test examples of the present application;

[0108] Figure 32 Figure showing the results of scratch assay migration rate assay in the test examples of the present application, wherein "*" means p<0.05 and "**" means p<0.01;

[0109] Figure 33Figure 1 is a graph showing the fluorescence labeling detection results in the test examples of the present invention, wherein A is a graph showing the distribution of exosomes with green fluorescence labels in important organs in the body 24 hours after tail vein injection, and B is a representative immunofluorescence image of Dio-labeled exosomes in the brain, wherein 1 is the PBS group; 2 is the hiNPCs-EXO group; 3 is the hiMGEs-EXO group; 4 is the APP hiNPCs-EXO group; 5 is the APP hiMGEs-EXO group, and the scale bar is 40 μm;

[0110] Figure 34 Representative flow cytometry images of CD4+ T cells and CD4+CD25+ T cells in the test examples of the present invention;

[0111] Figure 35 CD4 in the test example of the present invention + T cell ratio detection results, where "*" means p < 0.05 and "**" means p < 0.01;

[0112] Figure 36 CD4 in the test example of the present invention + CD25 + Graph showing the results of cell ratio detection, where “*” means p < 0.05;

[0113] Figure 37 Graph showing the detection results of Foxp3 mRNA expression levels in the test examples of the present invention, where “*” indicates p<0.05;

[0114] Figure 38 Figures 1 and 2 are the test results of inflammatory factor indicators in the test examples of the present invention, wherein A is the test result of IL-10 and TGF-β1, and B is the test result of TNF-α and IL-12, wherein "*" represents p < 0.05, "**" represents p < 0.01, and "***" represents p < 0.005;

[0115] Figure 39 The figure shows the detection results of CD3 and GFAP staining by immunohistochemistry in the test example of the present invention, wherein "*" means p < 0.05, "**" means p < 0.01, "***" means p < 0.005, and "****" means p < 0.001;

[0116] Figure 40 CD3 + The expression results of T cells are shown in the figure, where “*” means p < 0.05, “**” means p < 0.01, “***” means p < 0.005, and “****” means p < 0.001;

[0117] Figure 41is the expression of GFAP-positive astrocytes in the hippocampus in the test example of the present invention, wherein, “*” means p<0.05, “**” means p<0.01, and “***” means p<0.005;

[0118] Figure 42 This is a statistical result graph of the first-level branches analyzed by the Simple NeuriteTracer plug-in of Fiji Image J using GOLGI staining of mouse neurons in the test example of the present invention;

[0119] Figure 43 This is a statistical result diagram of the secondary branches of GOLGI-stained mouse neurons analyzed using the Simple NeuriteTracer plug-in of Fiji Image J in the test example of the present invention; where "*" means p < 0.05 and "**" means p < 0.01;

[0120] Figure 44 This is a statistical graph showing the longest neuron (μm) in mice analyzed using the Simple NeuriteTracer plug-in of Fiji Image J for GOLGI staining of neurons in the test example of the present invention, where "*" indicates p < 0.05, "**" indicates p < 0.01, and "ns" indicates no significant difference.

[0121] Figure 45 The graphs show the pathological changes of the main organs in each group of the acute toxicity test in mice in the test examples of the present invention, where the scale bar is 40 μm;

[0122] Figure 46 Figures 1 and 2 are the results of tissue expression and targeting analysis of hsa-miR-7-5p in the test examples of the present invention, wherein A is the detection result of the expression level of hsa-miR-7-5p in the brain tissue of mice in different exosome groups, B is a schematic diagram of the interaction between hsa-miR-7-5p and TRAF5 predicted by miRDB, and C is a predicted map of the interaction sites between hsa-miR-7-5p and TRAF5;

[0123] Figure 47 Graphs showing the effect of the hsa-miR-7-5p mimic on the mRNA expression of TNF pathway regulators stimulated by PMA / PI in the test examples of the present invention, wherein A is a graph showing the relative mRNA level of TRAF5; B is a graph showing the relative mRNA level of NF-κB, wherein "**" indicates p < 0.01, and "****" indicates p < 0.001;

[0124] Figure 48Graphs showing the results of the detection of mRNA expression levels of TNF pathway regulators in PBMNCs stimulated with PMA / PI by the hsa-miR-7-5p mimic in the test examples of the present invention, wherein A is the detection result graph of the relative mRNA level of ERK1; B is the detection result graph of the relative mRNA level of CREB, wherein "*" indicates p < 0.05 and "**" indicates p < 0.01;

[0125] Figure 49 Graphs showing the detection results of the hsa-miR-7-5p mimic in the test examples of the present invention on the release of cytokines from PBMNCs stimulated with PMA / PI, wherein A is the detection result graph of IL-1β content, B is the detection result graph of IL-6 content, and C is the detection result graph of TNF-α content, wherein "*" indicates p < 0.05, "**" indicates p < 0.01, and "***" indicates p < 0.005;

[0126] Figure 50 Graphs showing the results of the detection of mRNA expression levels of TNF pathway regulators in LPS-stimulated Astrocytes by the hsa-miR-7-5p mimic in the test examples of the present invention, wherein A is a graph showing the detection results of the relative mRNA levels of TRAF5; B is a graph showing the detection results of the relative mRNA levels of NF-κB, wherein "**" indicates p < 0.01, "***" indicates p < 0.005, and "****" indicates p < 0.001;

[0127] Figure 51 Graphs showing the results of the detection of mRNA expression levels of TNF pathway regulators in LPS-stimulated astrocytes by the hsa-miR-7-5p mimic in the test examples of the present invention, wherein A is a graph showing the detection results of the relative mRNA levels of ERK1; B is a graph showing the detection results of the relative mRNA levels of CREB, wherein "*" indicates p < 0.05 and "**" indicates p < 0.01;

[0128] Figure 52 : This is a test result diagram of the effect of the hsa-miR-7-5p mimic in the test example of the present invention on the inflammatory factors of LPS-stimulated Astrocytes, wherein A is the test result diagram of IL-1β content, B is the test result diagram of IL-6 content, and C is the test result diagram of TNF-α content, wherein "**" means p < 0.01, and "***" means p < 0.005. DETAILED DESCRIPTION

[0129] The following will clearly and completely describe the concept of the present invention and the technical effects produced in conjunction with the embodiments, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention. The test methods used in the embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used, unless otherwise specified, can all be reagents and materials obtained from commercial channels.

[0130] Example 1 Acquisition of exosomes

[0131] 1. Construction of APP gene overexpression lentiviral system

[0132] Normal human peripheral blood mononuclear cells (PBMNC) were reprogrammed using Sendai virus technology (Sendai virus reprogramming kit purchased from Thermo Fisher Scientific, for specific steps, see the kit instructions) (containing OCT3 / 4, SOX2, KLF4, and c-MYC factors). The APP gene (NM_0004844) was inserted between the CMV promoter and the EF-1α promoter in the pCDH CMV lentiviral expression vector (the lentiviral overexpression vector is pcdh-cmv-mcs-ef1-gfp-t2a-puro), resulting in the vector pcdh-cmV-APP(NM_0004844)*flag-ef1-gfp-t2a-puro (vector map shown in 1, sequence shown in SEQ ID NO. 2). This vector contains the GFP fluorescent gene and the puromycin resistance gene (construction map shown in Figure 2 APP-pCDH-CMV lentiviral expression vector was co-cultured with hiNPCs at an MOI of 20 (10 μL titer was 1×10 8 TU / ml of virus was added to 5×10 4 After 24 hours, the cells were selected for stable expression with puromycin (0.1 mg / mL, 4.0 μL per well of a 24-well plate) for 2 weeks to construct an APP gene-overexpressing lentiviral system. Western blotting and RT-PCR were used to determine whether APP was successfully transfected into induced neural progenitor cells (hiNPCs). Specific assays are as follows:

[0133] (1) RT-PCR detection

[0134] Total RNA was extracted from APP hiNPCs and hiNPCs cells or tissues using an RNA Rapid Extraction Kit (ES Science, RN001). After reverse transcription (ES Science, RT001) and amplification (ES Science, QP002), the RNA was analyzed using a 7500 RT-PCR system (Applied Biosystems). The specific detection process was consistent with the kit instructions. Amplification primers for human APP were used, as shown in Table 1. The primer sequences are shown in Table 1:

[0135] Table 1 Primer list

[0136]

[0137] (2) Western blotting

[0138] APP hiNPCs and hiNPCs cells and exosomes were lysed using RIPA rapid cell lysis buffer (Solarbio, China). Next, 50 μg of protein samples were separated by 10% SDS-PAGE gel (EpiZyme, China), and the signals were transferred to PVDF membranes (Merck Millipore, Ireland) under cooling conditions. After blocking, the membranes were incubated with primary antibodies overnight at 4°C, followed by incubation with secondary antibodies for 1 hour and development using enhanced chemiluminescence (ECL, Affinity, USA). APP protein expression was detected using a dual-color infrared laser imaging system (Li Cor Odyssey Fc, USA), with GAPDH as the reference gene, and analyzed using Image Studio software.

[0139] Test results such as Figure 3-4 As shown in the figure, it can be seen that the APP gene is highly expressed in APP hiNPCs cells compared with the control group hiNPCs cells.

[0140] WB and PCR assays showed that the induced neural progenitor cells (hiNPCs) were successfully transfected with APP (APPhiNPCs).

[0141] 2. Obtaining APPhiMGEs Cells

[0142] Further differentiation of APP hiNPCs into APPhiMGEs:

[0143] (1) 0.5×10 5APP hiNPCs were seeded into 6-well plates covered with Matrigel gel, and NIM medium (DMEM / F12, 1×NEAA, 1×N2) and 1.5 μM Purmorphamine were added. The plates were incubated at 37°C in a 5% CO2 incubator. The medium was changed every other day for 6 days.

[0144] (2) On day 7, the culture medium was aspirated and replaced with NIM medium supplemented with purmorphamine (1.5 μM) and B27 (1×). The cells were incubated at 37°C in a 5% CO2 incubator. The medium was changed every other day for 10 days. At this point, the cells were APP hiMGEs.

[0145] 3. Obtaining hiMGEs

[0146] Further differentiation of hiNPCs into GABAergic precursor cells (hiMGEs):

[0147] (1) 0.5×10 5 HiNPCs were seeded at 100 μg / mL in 6-well plates covered with Matrigel. NIM medium and 1.5 μM Purmorphamine were added and the plates were incubated at 37°C in a 5% CO2 incubator. The medium was changed every other day for 6 days.

[0148] (2) On day 7, aspirate the culture medium and replace with NIM medium supplemented with purmorphamine (1.5 μM) and B27 (1×). Incubate at 37°C in a 5% CO2 incubator. Change the medium every other day for 10 days. At this point, the cells are hiMGEs.

[0149] 4. Extraction and purification of exosomes

[0150] Exosomes were collected and purified from the culture supernatants of hiNPCs-EXO, hiMGEs-EXO, APP hiNPCs-EXO, and APP hiMGEs-EXO cells using gradient centrifugation. Culture supernatants were collected when each cell culture reached 80% confluence and then centrifuged at 4°C in the following order: 600 × g for 10 minutes (ThermoScientific, Stratos, USA), 10,000 × g for 40 minutes (ThermoScientific, Stratos, USA), and 100,000 × g for 60 minutes (Beckman Coulter, Optima XE-100, USA). The pelleted exosomes were then resuspended in 100 μL of ice-cold PBS. Exosomes from hiNPCs-EXO, hiMGEs-EXO, APP hiNPCs-EXO, and APP hiMGEs-EXO cells were prepared.

[0151] Example 2 Acquisition of miRNA

[0152] Total RNA from the hiMGEs-EXO exosomes prepared in Example 1 was extracted using TRIzol (Invitrogen, USA) and reverse transcribed (ES Science, RT001). A 140–160 bp PCR product was selected to generate a cDNA library, which was sequenced using an Illumina HiSeqXten (Gene Denovo Biotechnology Co., China). MiRNAs were identified by alignment with miRNA databases (including GeneBank, Rfam, and Genome). Differentially expressed miRNAs (DEmis) were calculated using edge R software, with a fold difference ≥ 2 and a P value < 0.05 as screening criteria. Target genes were predicted based on the identified miRNA sequences. Functional analysis was performed using GO enrichment and pathway enrichment.

[0153] The results are as follows Figure 6-7 As shown in the figure, compared with the APP hiMGEs-EXO group, the hiMGEs-EXO group has 21 differential miRNAs. Reactome analysis suggests that the differential miRNAs are mainly enriched in CD4 +The Th1-mediated immune response includes MHC class II antigen processing, TLR flow and activation of the IL-12 pathway. Finally, a miRNA hsa-miR-7-5p that can target tumor necrosis factor-related factor 5 (TRAF5) to inhibit the TNF signaling pathway was screened, and the sequence is as follows: UGGAAGACUAGUGAUUUUGUUGUU (SEQ ID NO. 1).

[0154] Test Example

[0155] 1. Characteristic analysis of exosomes

[0156] (1) Concentration detection

[0157] The concentration of the exosomes of the hiNPCs-EXO, hiMGEs-EXO, APPhiNPCs-EXO and APP hiMGEs-EXO cells prepared in Example 1 was determined by bicinchoninic acid assay (BCA).

[0158] It was detected that the protein content of the exosomes resuspended in 1 mL of PBS per 1 small tube (corresponding to 38 mL of culture medium) fluctuated between 0.806-1.039 mg / mL.

[0159] (2) Morphological characteristic analysis

[0160] The morphology of the exosomes of the hiNPCs-EXO, hiMGEs-EXO, APP hiNPCs-EXO and APP hiMGEs-EXO prepared in Example 1 was photographed by transmission electron microscopy (Hitachi, HT-7700, Japan), and the size distribution and intensity were analyzed by Zetasizer Nano ZS (Malvern, U.K).

[0161] The detection results are shown in Figure 8-9 From Figure 8 it can be seen that the transmission electron microscopy showed that the four groups of exosomes were circular disc-shaped vesicles, and from Figure 9 it can be seen that the nanoparticle size analyzer measured that the average diameter of the exosomes was about 138 nm for hiNPCs-EXO and APPhiNPCs-EXO, and about 88 nm for hiMGEs-EXO and APP hiMGEs-EXO.

[0162] (3) Identification and analysis of neural precursor cell markers

[0163] The marker proteins Alix, CD9, and TSG101 of the exosomes of the hiNPCs-EXO, hiMGEs-EXO, APPhiNPCs-EXO, and APPhiMGEs-EXO cells prepared in Example 1 were determined by Western blotting. The detection method was the same as that in Example 1.

[0164] Test results such as Figure 10 As shown in the figure, it can be seen that the four groups of exosomes all express cell membrane markers Alix, CD9 and TSG101.

[0165] 2. In vitro immunomodulatory activity of hiMGEs-EXO

[0166] (1) ELISA test

[0167] Peripheral blood mononuclear cells (PBMNCs) were stimulated with PMA (10 nM) / PI (1 μM) for 24 hours to simulate cell activation.

[0168] In the experimental groups, exosomes (exosomes hiNPCs-EXO, hiMGEs-EXO, APP hiNPCs-EXO, and APP hiMGEs-EXO were added to each group, respectively) (final concentration of 100 μg / mL) were co-cultured with PMA / PI (10 nM / 1 μM)-activated PBMNCs for 2 days. The difference between Control Group 1 and Example 1 was that PBMNCs were not stimulated with PMA / PI (i.e., Ctrl-PBMNCs group). The difference between Control Group 2 and Example 1 was that only an equal volume of PBS was added without exosomes (i.e., PBS group). The levels of cytokines IL-3, IL-10, IL-12, TGF-β1, and TNF-α in the cell supernatant were detected by ELISA according to the instructions of the kit (Cusabio, China).

[0169] Test results such as Figure 11-15 As shown, from Figure 11-15 As can be seen, the four groups of exosomes were co-cultured with PMA / PI-stimulated peripheral blood mononuclear cells (PBMNCs), and it was found that hiMGEs-EXO significantly increased the content of IL-3 and TGF-β1 in the stimulated PBMNC culture medium, while reducing the content of IL-12, TNF-α and IL-10.

[0170] (2) RT-PCR detection

[0171] PBMNCs were stimulated with PMA (10 nM) / PI (1 μM) for 24 hours to simulate activated cells. The experimental groups were co-cultured with activated PBMNCs for 2 days with exosomes (exosomes hiNPCs-EXO, hiMGEs-EXO, APP hiNPCs-EXO, and APP hiMGEs-EXO were added to each group, respectively) at a final concentration of 100 μg / mL. The difference between Control Group 1 and Example 1 was that PBMNCs were not stimulated with PMA / PI (i.e., the Ctrl-PBMNCs group). The difference between Control Group 2 and Example 1 was that only an equal volume of PBS was added without exosomes (i.e., the PBS group). RT-PCR was used to measure the mRNA expression of IL-12, IL-10, and TGF-β1 in the cell supernatant. The primer sequences used for the detection are shown in Table 1 for Human IL-12, Human TGF-β1, and Human IL-10.

[0172] from Figure 16-18 As can be seen from the results of RT-PCR detection of IL-12, TGF-β1 and IL-10 mRNA expression levels, it was found that hiMGEs-EXO significantly increased the content of TGF-β1 in the culture medium of stimulated PBMNCs, while reducing the content of IL-12 and IL-10.

[0173] (3) Detection of inflammatory factor expression levels

[0174] Astrocytes differentiated from hiNPCs were stimulated with LPS (10 μg / mL) for 3 days to simulate activated cells. Exosomes (final concentration of 100 μg / mL) were co-cultured with activated astrocytes for 2 days to detect the mRNA expressions of IL-3, IL-12, TNF-α, TGF-β1, IL-10, and IL-12 in the cell supernatant.

[0175] Astrocyte activation and proliferation is a major pathophysiological characteristic of AD. In this experiment, LPS was used to stimulate astrocytes differentiated from hiMGEs to simulate the activation of AD in vivo. After co-culturing exosomes with LPS-stimulated astrocytes, the culture medium was collected and the levels of inflammatory factors were detected. Figure 19-26 As shown in the figure, it can be seen that the expression level changes of inflammatory factors IL-3, IL-12, TNF-α, TGF-β1, IL-10 and IL-12 are consistent with those of PBMNC. hiMGEs-EXO significantly increases the content of IL-3 and TGF-β1 in stimulated astrocytes, while reducing the content of IL-12, TNF-α and IL-10.

[0176] (4) CFSE proliferation assay

[0177] PBMNCs and CD3 were labeled with CFSE proliferation dye (Invitrogen, USA). + T cells were then incubated with anti-CD3 / CD28 Dyna beads (cell:beads, 1:1, Gibco, 11131D). After a 7-day activation period, exosomes (100 μg / mL) from four groups (i.e., hiNPCs EXO, hiMGEs EXO, APP hiNPCs EXO, and APP hiMGEs EXO) were co-cultured with activated PBMNs for 2 days. An equal volume of PBS was added to the PBS group, while the NC group remained untreated after CFSE dye treatment. The proliferation of PBMNCs was then assessed directly on a flow cytometer. Flow cytometric analysis (BD FACS Canto II, USA) of the proliferation of PBMNCs and CD3-positive T cells (APC anti-mouse CD3, Biolegend, USA) was then performed.

[0178] Effects of exosomes on PBMNCs and CD3 + The results of the test on the effect of T cell proliferation were as follows Figures 27-30 As shown, from Figure 27 As can be seen from the results, both hiNPCs-EXO and hiMGEs-EXO can inhibit the proliferation of CFSE-labeled PBMNCs. Figure 28 As can be seen from the results, both hiNPCs-EXO and hiMGEs-EXO can inhibit the proliferation of CFSE-labeled PBMNCs by 37.7% and 72.7%, respectively. Figures 29-30 As can be seen, hiNPCs-EXO and hiMGEs-EXO inhibit CD3 + The T cell proliferation efficiencies were 80.0% and 85.2%, respectively. The above results indicate that hiMGEs-EXO regulates immunity mainly by inhibiting T cell activation.

[0179] (5) Scratch test

[0180] Approximately 1 × 10 cells were seeded into each well of a PLO / laminin-coated 24-well plate. 5 HiMGEs were cultured in a 37°C, 5% CO2 incubator to approximately 70% confluence. A vertical scratch was made in the center of each well using a 100 μL pipette tip. The hiMGEs were then incubated with different groups of exosomes (hiNPCs EXO, hiMGEs EXO, APP hiNPCs EXO, and APP hiMGEs EXO) (final concentration 100 μg / mL) and an equal volume of PBS for 24 hours. Cells were incubated in an equal volume of PBS as a negative control. The scratch edges were analyzed using Image J software.

[0181] The results of the scratch assay to evaluate the effect of hiMGEs-EXO on hiMGEs growth are shown in Figure 2. Figures 31-32 As shown in the figure, it can be seen that both hiNPCs-EXO and hiMGEs-EXO can promote the growth of hiMGEs, and their migration rates are 21.8% and 30.8%, respectively.

[0182] The above results indicate that hiMGEs-EXO has immunomodulatory effects and can directly or indirectly inhibit and alleviate the inflammation of Astrocytes in vitro.

[0183] 3. Absorption and distribution of hiMGEs-EXO in vivo

[0184] (1) Fluorescent labeling of exosomes and animal administration

[0185] 50 μg of exosomes suspended in PBS were incubated with 10 μM Dio (Meilun Biotechnology, China) for 10 minutes. The mixture was then centrifuged at 100,000 × g for 1 hour at 4°C. To track exosome metabolism and deposition sites, labeled exosomes were injected into 12-month-old male APP / PS1 mice via the tail vein.

[0186] (2) Absorption and distribution in the body

[0187] The fluorescent distribution of labeled exosomes in the mouse organs heart, liver, spleen, lung and kidney was observed using IVIS Lumina system (PerkinElmer, USA). Figure 33 As shown, from Figure 33 As can be seen in Figure A, 24 hours after tail vein injection, the bioimaging instrument observed that hiNPCs-EXO and hiMGEs-EXO showed strong retention signals in the brain, and the spleen also had strong information. In contrast, APP hiNPCs-EXO and APP hiMGEs-EXO mainly stayed in the liver and kidney, and the signals in the brain and spleen were weaker than those of the hiNPCs-EXO and hiMGEs-EXO groups. Figure 33 As can be seen in Figure B, laser confocal microscopy showed that the density of labeled hiMGEs-EXO in the brain was higher than that in other groups. This result suggests that hiMGEs-EXO mainly exerts its effects through local effects on the brain and spleen.

[0188] 4. hiMGEs-EXO inhibits the activation of astrocytes in APP / PS1 mice and exerts a neuroprotective effect

[0189] The experimental groups were: 50 12-month-old APP / PS1 mice (purchased from Changzhou Cavens Laboratory Animal Co., Ltd., Animal Production License No.: SCXK(Su)2016-0010) were injected with exosomes (hiNPCs EXO, hiMGEs EXO, APP hiNPCsEXO, and APPhiMGEsEXO) at a dose of 7.5 mg / kg for a total of 5 times, once every two days, via the tail vein. The control group (APP / PS1 group) was different from the experimental group in that no exosomes were injected. Changes in the following indicators were observed.

[0190] (1) Spleen cell isolation and flow cytometry

[0191] Mice were sacrificed by cervical dislocation, and the spleens were rapidly removed, ground, and filtered through a 70 μm cell sieve. Red blood cells were lysed and centrifuged to prepare a splenocyte suspension. The following antibodies were added to the cells and reacted in the dark for 15 minutes: FITC anti-mouse CD3, APC anti-mouse CD4, PerCP / Cyanine 5.5 anti-mouse CD8a, PE anti-mouse CD25, and PE mouse IgG1 (all Biolegend USA). Labeled cells were detected using a flow cytometer (BD FACS Canto II, USA).

[0192] Flow cytometry was used to detect the splenocytes of APP / PS1 mice injected with exosomes (hiNPCs EXO, hiMGEs EXO, APPhiNPCsEXO and APP hiMGEsEXO). The test results are shown in Figures 34-36. Figures 34-36 As can be seen, hiNPCs-EXO and hiMGEs-EXO can reduce the CD4 + Increased CD4 T cell ratio + CD25 + The proportion of regulatory T cells; Foxp3 in mouse spleen was detected by fluorescent quantitative PCR, the primer set is shown in Mouse Foxp3 in Table 1, and the results are shown in Figure 37 As shown, from Figure 37 It can be seen that the mRNA expression level of spleen Foxp3 can be increased.

[0193] (2) Detection of inflammatory factors

[0194] The ELISA method was used to quantify the inflammatory factors IL-10, TGF-β1, TNF-α and IL-12 in the serum of APP / PS1 mice injected with exosomes (hiNPCs EXO, hiMGEs EXO, APP hiNPCs EXO and APP hiMGEs EXO, respectively).

[0195] The detection results are shown in Figure 38 , which show that hiMGEs-EXO can increase the serum IL-10 and TGF-β1 of APP / PS1 mice by 3.1 times and 3.5 times, respectively, while reducing the CD4 + Th1-related cytokines such as TNF-α and IL-12 by 69.3% and 46.2%, respectively.

[0196] (3) CD3 and GFAP immunohistochemistry of APP / PS1 mouse spleen

[0197] The mouse HIP (hippocampus) and mouse brain PFC samples were processed by the conventional histological procedure and cut into 4 pm thick sections. After xylene and descending gradient (100%-100%-95%-85%-75%) ethanol dewaxing, the sections were incubated in EDTA (Solarbio) for 5 minutes to repair antigens, and then blocked in 5% fetal bovine serum for 1 hour at room temperature. The specimens were incubated with the primary antibody (anti-CD3, Abeam) overnight at 4°C. After washing with PBS (0.1 mol / L) for three times, the sections were incubated with HRP-labeled mouse / rabbit IgG secondary antibody (Zhongshan Jingqiao, China) for 30 minutes at room temperature. Subsequently, the slides were incubated with diaminobenzidine (Zhongshan Jingqiao, China) for 10 minutes at room temperature, incubated with hematoxylin, dehydrated with ascending gradient ethanol, and mounted. An optical microscope (Olympus BX51, Germany) was used to capture the regions of interest. The Golgi staining procedure was performed according to the kit instructions (GMS80020.1, GENMED, USA).

[0198] CD3 and GFAP were stained by immunohistochemistry, and the results are shown in Figures 39-41 From the figure, it can be seen that hiNPCs-EXO treatment can significantly reduce the CD3 + T cells and reduce GFAP + Astrocytes in the spleen of APP / PS1 mice; from Figure 39 and Figures 42-44 , it can be seen that Golgi staining shows that hiNPCs-EXO treatment can restore the morphology of neurons in APP / PS1 mice, increase the primary branch, secondary branch and longest neurite of nerve territory, and has a neuroprotective effect.

[0199] 5. Safety evaluation of hiMGEs-EXO

[0200] Twelve-month-old APP / PS1 mice were divided into two groups and the exosomes of hiNPCs-EXO, hiMGEs-EXO, APP hiNPCs-EXO and APPhiMGEs-EXO cells were injected into the tail vein at a single dose of 75 mg / kg for a total of 5 times, once every two days, through the tail vein of 12-month-old APP / PS1 mice. The control group was injected with an equal volume of PBS to evaluate its safety.

[0201] (1) Biochemical indicators

[0202] Eyeballs of mice in each group were removed and blood was collected. Routine blood parameters were measured using a blood cell analyzer XN9000 (SYSMEX, Japan). The blood was centrifuged at 3500 × g at 4°C, and the supernatant was collected for analysis of blood biochemical parameters using a biochemical immunoassay system (Au5800 BECKMANCOULTER, USA).

[0203] The test results of biochemical indicators are shown in Table 2. It can be seen from the table that neither hiNPCs-EXO nor hiMGEs-EXO caused abnormal changes in hematological biochemical indicators.

[0204] Table 2

[0205]

[0206] Note: * Statistically significant (P<0.05) when compared to the PBSgroup.

[0207] (2) Pathological changes in major organs

[0208] HE staining was used to detect the pathological changes of the main organs of mice, including heart, liver, spleen, lung and kidney.

[0209] Test results such as Figure 45 As shown in the figure, it can be seen that neither hiNPCs-EXO nor hiMGEs-EXO caused pathological changes in major organs.

[0210] 6. hsa-miR-7-5p targets tumor necrosis factor-related factor 5 (TRAF5) to inhibit the TNF signaling pathway

[0211] (1) Performance analysis of hsa-miR-7-5p

[0212] Exosomes (hiNPCs EXO, hiMGEs EXO, APP hiNPCs EXO, and APP hiMGEs EXO) were injected into 12-month-old APP / PS1 mice via the tail vein at a dose of 7.5 mg / kg for five times, every two days. A control group (APP / PS1) received no exosomes. The expression of hsa-miR-7-5p in the different groups was determined by RT-PCR, using the U6 gene as a reference gene (primers shown in Table 1).

[0213] Test results such as Figure 46 As shown, from Figure 46 As shown in Figure A, the expression of hsa-miR-7-5p was significantly increased in both the hiNPCs-EXO group and the hiMGE-EXO group by RT-PCR. Figure 46 As shown in Figure B, miRDB predicts that hsa-miR-7-5p interacts with TRAF5; the specific binding sites are as follows Figure 46 As shown in Figure C.

[0214] (2) hsa-miR-7-5p targets tumor necrosis factor-related factor 5 (TRAF5) to inhibit the TNF signaling pathway

[0215] Astrocytes differentiated from hiNPCs were stimulated with LPS (10 μg / mL) for 3 days, while PBMNCs were stimulated with PMA (10 nM) / PI (1 μM) for 24 hours to simulate cell activation. The hsa-miR-7-5p mimic was mixed with lipofectamine 2000 (Thermofisher, USA) according to the manufacturer's instructions. After incubation for 5 minutes, the mimic was added to the culture medium of activated astrocytes or PBMNCs and cultured for 3 days. Unstimulated cells (Ctrl-PBMNCs or Ctrl-Astr) were used as controls. TRAF5, NF-κB, ERK1, and CREB mRNA expression in cells was measured by RT-PCR (primers shown in Table 1). IL-1β, IL-6, and TNF-α levels in the cell supernatants were measured by ELISA according to the kit instructions (Cusabio, China).

[0216] The results are as follows Figures 47-52 As shown, from Figures 47-48As can be seen from the data, TRAF5 is an upstream transcription factor of the TNF pathway, while NF-κB, ERK1, and CREB are important regulatory factors of the TNF signaling pathway, and IL-1β, IL-6, and TNF-α are pathway effectors. hsa-miR-7-5p mimic can reduce the mRNA expression of TRAF5 and NF-κB in PBMNCs stimulated by PMA / PI, while increasing the mRNA expression of ERK1 and CREB; Figure 49 It can be seen that hsa-miR-7-5p mimic can reduce the release of cytokines such as IL-1β, IL-6, and TNF-α; Figures 50-52 As can be seen in the figure, the effect trend of hsa-miR-7-5p mimic on LPS-stimulated astrocytes is consistent with that on PBMNCs. The experimental results indicate that hsa-miR-7-5p inhibits the TRAF5-mediated TNF signaling pathway.

[0217] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. A method for preparing exosomes, characterized in that: The preparation method comprises the following steps: A1. Using Sendai-virus technology to reprogram peripheral blood mononuclear cells to generate human-derived induced neural progenitor cells; A2. The exosomes are isolated by at least one of the following a) and b): a) a culture medium of the human-derived induced neural progenitor cells; b) a culture medium of γ-aminobutyric acid (GABA)-producing progenitor cells differentiated from the human-derived induced neural progenitor cells; The separation method adopts gradient centrifugation; the gradient centrifugation comprises centrifuging the culture solution at 700-800×g for 8-12 min, 8000-12000×g for 30-50 min, and 80000-120000×g for 50-70 min in sequence.

2. An exosome, characterized in that The method according to claim 1 is used to prepare the present invention.

3. The exosome according to claim 2, characterized in that The particle size of the exosomes is 80-150 nm.

4. Use of the exosomes according to claim 2 or 3 in the preparation of a medicament for treating and / or preventing Alzheimer's disease.

5. A drug for treating and / or preventing Alzheimer's disease, characterized in that: The medicine comprises the exosomes according to claim 2 or 3.

6. The medicine according to claim 5, characterized in that The medicine also includes a drug carrier and / or pharmaceutical excipients.

7. The medicine according to claim 5, characterized in that The dosage form of the medicine is powder, ointment, drops, gel, lozenge, granule, suspension, syrup, patch, capsule, spray, tablet, pill, injection, gel or oral solution.

Citation Information

Patent Citations

  • Improved sun-bonnet for horses

    US100000A

  • Non-coding small RNA molecular spectrum related to tumor lactic acid microenvironment and application thereof

    CN112941176A