A method for enhancing resistance of tomatoes to root-knot nematodes

Abstract

The invention discloses a method for enhancing the resistance of tomatoes to root-knot nematodes, and relates to the field of biotechnology. By knocking out the MED25 gene or the ERF1 gene in tomatoes, the number of root knots is significantly reduced compared with wild-type plants, and the expression of the defense gene PDF1.2a / b is restricted, indicating that ERF1 or MED25 positively regulates the resistance of tomatoes to southern root-knot nematodes.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for enhancing the resistance of tomatoes to root-knot nematodes. Background Art

[0002] Jasmonic acid (JA) is a major defense phytohormone that plays a key role in regulating plant defense responses to mechanical wounding, insect attack, and pathogen infection. JA biosynthesis is rapidly initiated upon mechanical wounding or insect / pathogen attack. Bioactive jasmonoyl-L-isoleucine (JA Ile) is sensed by the COI1-jasmonate ZIM domain (JAZ) complex, leading to degradation of the JAZ repressor protein via the 26S proteasome and release of downstream transcription factors to turn on various JA-responsive genes. The JA signaling pathway consists of two branches; the basic helix-loop-helix (bHLH) protein (MYC) branch, which is associated with wounding and defense against insect herbivores, and the ethylene response factor (ERF) branch, which is associated with enhancing resistance to necrotrophic pathogens. As a core transcription factor in the JA signaling pathway, MYC2 either interacts with the transcriptional repressor JAZ to exert its transcriptional repression function or with the transcriptional activator mediator 25 (MED25) to achieve its transcriptional activation function. In addition to MYC2, ERFs are also key players in the JA signaling pathway and are involved in the transcriptional regulation of various biological processes in plant stress responses. JA and ethylene are often produced simultaneously during pathogen infection and synergistically regulate resistance defense signaling pathways.

[0003] Previous studies have found that ERFs can specifically bind to GCC-box and DRE / CRT cis-acting elements to regulate downstream gene expression, such as the expression of ethylene (ET)-induced PR genes and abiotic stress-induced genes. In recent years, it has been found that ERFs can also bind to Coupling Element 1 (CE1: TGCCACCG), hypoxia-responsive promoter element (HRPE) and ATCTA. However, there are few reports on the relationship between ERF1 and root-knot nematodes, and its regulatory mechanism is still unclear. Although ERFs have been found in many plants, many tomato ERFs have not been reported, especially in root-knot nematode resistance, and the underlying mechanisms of these functions in tomatoes are still poorly understood.

[0004] Root-knot nematodes (RKNs, Meloidogyne spp.) are plant-parasitic nematodes, such as peanut root-knot nematode (M. arenaria), Java nematode (M. javanica), southern root-knot nematode (M. incognita), and northern root-knot nematode (M. hapla), with a wide host range and cause huge economic losses to crops. In response to nematode invasion, plants have evolved various defense strategies to induce immune responses. Notably, recent studies have found that JA-dependent signaling pathways play key roles in pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) against nematodes and necrotrophic pathogens. In tomato, previous studies reported that JA-dependent signaling is not involved in Mi-1-mediated defense, while an intact JA signaling pathway is required for tomato sensitivity to RKNs. In rice (Oryza sativa), exogenous ethephon (ET) and methyl jasmonate (MeJA) upregulated the expression of OsPR1a and OsPR1b genes at the early stage of grass infection, thereby actively regulating the rice systemic defense against nematode parasitism. In addition, JA-responsive genes such as plant defensin 1.2 (PDF1.2) and proteinase inhibitor (PI) are involved in JA-induced RKN resistance. Although the JA signaling pathway occupies a key position in plant RKN resistance, its regulatory mechanism is largely unknown. Summary of the invention

[0005] The applicant found several genes with high homology to Arabidopsis in tomatoes, and screened and determined that the gene ERF1 with a DELLA structure, which interacts with MED25 and participates in pathogen defense, can be induced by RKN; and its mutant can enhance the resistance of tomatoes to root-knot nematodes, which reveals a new mechanism for ET in tomatoes to participate in resistance to southern root-knot nematodes, and provides an important basis for accelerating the research on the resistance mechanism of root-knot nematodes and the discovery of resistance genes, which has very important scientific and practical significance. Studies have found that ethylene plays a key role in the response of plants to necrotic pathogens and herbivorous insects. The present invention discovered the Arabidopsis homologous gene ERF1 (Solyc09g089930) in tomatoes, and determined through yeast interaction screening that it can interact with MED25 to participate in pathogen defense, and can be rapidly induced to express by RKN. Accordingly, the present invention provides an application of tomato MED25 or ERF1 to regulate the sensitivity of root-knot nematodes.

[0006] The specific technical solutions are as follows:

[0007] The invention provides application of a tomato gene in enhancing resistance of tomatoes to root-knot nematodes. The tomato gene is a MED25 gene or an ERF1 gene.

[0008] Specifically, the number of root knots is reduced and the resistance to root-knot nematodes is enhanced. The lower the expression of the ERF1 gene in the plant, the fewer the number of root knots the plant has when infected by root-knot nematodes, and the stronger the resistance to root-knot nematodes.

[0009] The nucleotide sequence of the MED25 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the ERF1 gene is shown in SEQ ID NO.2.

[0010] The present invention also provides the use of a protein encoded by a tomato gene in enhancing the resistance of tomatoes to root-knot nematodes, wherein the tomato gene is a protein encoded by a MED25 gene or a protein encoded by an ERF1 gene.

[0011] The amino acid sequence of the protein encoded by the tomato MED25 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the ERF1 gene is shown in SEQ ID NO.4.

[0012] The present invention also provides a method for enhancing the resistance of tomatoes to root-knot nematodes, wherein the MED25 gene or the ERF1 gene in tomatoes is silenced or knocked out. The nucleotide sequence of the MED25 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the ERF1 gene is shown in SEQ ID NO.2.

[0013] The method for enhancing the resistance of tomatoes to root-knot nematodes comprises the following steps:

[0014] (1) Constructing a vector for knocking out or silencing the MED25 gene or the ERF1 gene;

[0015] (2) The vector for knocking out or silencing the MED25 gene or the ERF1 gene constructed in step (1) is introduced into rice cells to silence or knock out the MED25 gene with a nucleotide sequence such as SEQ ID NO.1 or the ERF1 gene with a nucleotide sequence such as SEQ ID NO.2, and transgenic plants are obtained after cultivation.

[0016] Specifically, in step (1), the vector is pCAMBIA1301.

[0017] Specifically, in step (2), the vector for silencing or knocking out the MED25 gene or the ERF1 gene is transferred into the genetically engineered Agrobacterium, and then infects the rice cells. The genetically engineered Agrobacterium is the Agrobacterium EHA105 strain.

[0018] Beneficial effects of the present invention:

[0019] The invention knocks out the MED25 gene or the ERF1 gene in tomatoes, and compared with wild-type plants, the number of root knots is significantly reduced, and the expression of the defense gene PDF1.2a / b is restricted, indicating that ERF1 or MED25 positively regulates the resistance of tomatoes to southern root-knot nematodes. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is an amino acid sequence alignment of AtERF1, AtORA59 in Arabidopsis and ERF1 in tomato.

[0021] Figure 2 This is an analysis chart of the expression level of ERF1 in wild-type tomato Ailsa Craig at different time points of 0h, 24h, 48h, and 72h after inoculation with root-knot nematodes.

[0022] Figure 3 3A is the result of the interaction between ERF1 and MED25; 3A is the result of yeast, and 3B is the result of bimolecular fluorescence complementation.

[0023] Figure 4 Figure 2 shows the sequencing results of erf1 (A) and med25 (B) mutants generated using CRISPR / Cas9.

[0024] Figure 5 The gene expression diagram of PDF1.2a / b in wild type, erf1 mutant and med25 mutant.

[0025] Figure 6 This is a root-knot nematode phenotype observation diagram of tomato plants 5 weeks after inoculation with root-knot nematodes; A is a representative acid fuchsin staining result of the plant roots, scale bar = 1 cm; B is the statistical result of the number of root knots in A. DETAILED DESCRIPTION

[0026] Example 1

[0027] Total RNA extraction and gene expression analysis.

[0028] 1. Extraction of Total RNA from Tomato

[0029] Tomato (Ailsa Craig) can be purchased from the UCDavis seed bank (website link: https: / / tgrc.ucdavis.edu / ) and obtained by contacting the UCDavis seed bank. The total RNA of tomato roots was extracted using the Tiangen Plant total RNA extraction kit:

[0030] (1) Grind 0.1 g of root sample in liquid nitrogen, add 1 mL of lysis buffer RZ, and vortex to mix;

[0031] (2) Centrifuge at 12,000 rpm for 5 min at 4°C and remove the supernatant;

[0032] (3) Add 200 μL of chloroform, shake vigorously for 15 seconds, and leave at room temperature for 3 minutes;

[0033] (4) Centrifuge at 4°C, 12,000 rpm for 10 min. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. Transfer the aqueous phase to a new tube and proceed to the next step.

[0034] (5) Add 0.5 times the volume of anhydrous ethanol, mix well, transfer to adsorption column CR3, centrifuge at 12000 rpm at 4°C for 30 s, and discard the waste liquid in the collection tube;

[0035] (6) Add 500 μL of deproteinized solution RD to the adsorption column CR3, centrifuge at 12,000 rpm for 30 s at 4°C, and discard the waste liquid;

[0036] (7) Add 600 μL of rinse solution RW to the adsorption column CR3, let stand at room temperature for 2 min, centrifuge at 4°C, 12000 rpm for 30 s, and discard the waste liquid;

[0037] (8) Repeat step (8);

[0038] (9) Place the adsorption column in a 2 mL collection tube and centrifuge at 12,000 rpm for 2 min at 4 °C to remove the residual waste liquid;

[0039] (10) After the adsorption column was dried in a clean bench for 5 min, it was transferred to a new RNase-free centrifuge tube and 50 μL RNase-Free ddHO was added. 2 O, placed at room temperature for 2 min, centrifuged at 12000 rpm for 2 min at 4 °C;

[0040] (11) Determine OD using a UV spectrophotometer 260 / OD 280 Check the RNA sample content and purity.

[0041] 2. Real-time quantitative PCR (qRT-PCR)

[0042] use 480 II Real-Time PCR detection system (Roche, Swiss), and SYBR Green PCR Master Mix (Takara, RR420A) were used. The PCR reaction conditions were: 95°C for 3 min; 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 30 s, and 40 cycles. Fluorescence data were collected at the end of the extension of each cycle. Tomato Actin and Ubiquitin3 genes were used as internal references, and gene-specific primers were designed according to the sequence of cDNA. The sequences of each primer are shown in the table below. The relative expression of genes was calculated using the method of Livak and Schmittgen (2001).

[0043] MYC2 and ERF are two core switches that play antagonistic roles in JA-mediated resistance to different biotic stresses. MED25 is a subunit of the Mediator transcriptional coactivator complex that physically interacts with MYC2 and ERF to form a functional transcriptional complex to regulate JA-responsive gene expression. In a previous study, the applicants found that MYC2 negatively affects tomato RKN defense. Therefore, we hypothesized that JA may regulate RKN resistance through the ERF pathway. Through sequence alignment, we found that tomato ERF1 (Solyc09g089930) is a homologous protein to Arabidopsis ORA59 ( Figure 1 ), and found that root-knot nematode infection induced the expression of ERF1 ( Figure 2 ), indicating that ERF1 may be involved in the regulation of root-knot nematodes.

[0044] Table 1 Real-time fluorescence quantitative PCR primers

[0045] Gene name Forward primer (5'-3') Reverse primer (5'-3') Actin TGTCCCTATTTACGAGGGTTATGC CAGTTAAATCACGACCAGCAAGAT Ubiquitin3 GCCGACTACAACATCCAGAAGG TGCAACACAGCGAGCTTAACC PDF1.2a ATTTGCAAAGCACCAAGCCAAAC CATCATAATCTCTTCTTCAAGCA PDF1.2b ACTTATGGTCTTGGCAATGGTGCT AGTTTGCTACAATGTCCACCTGTA ERF1 GTGCGTCAAGGAGATCAACA ACAGCACTCTGGCTTCTTCT

[0046] Example 2

[0047] 1. Yeast two-hybrid assay to verify the interaction between ERF1 and MED25

[0048] Specific primers were designed according to the full length of CDS of MED25 and ERF1 genes (see Table 2), and PCR amplification was performed using tomato cDNA as a template. The PCR product was digested with EcoRI and SalI and connected to the yeast expression vector pGBKT7 (BD-MED25). The PCR product was digested with BamHI and SacI and connected to the yeast expression vector pGADT7 (AD-ERF1). The BD-MED25 and AD-ERF1 vectors were co-transformed into the yeast strain Y2H. After transformation, 50 μL was spotted on SD-Leu-Trp (SD-L / T) and SD-Leu-Trp-Ade-His (SD-L / T / A / H) plates, respectively, and placed in a 28°C incubator for 2-4 days, and the yeast growth was recorded ( Figure 3 A).

[0049] Table 2 Yeast two-hybrid vector primers

[0050] Carrier sequence AD-ERF1-F atggccatggaggccgaattcATGGATTCTTCTTCTTCTTCATCTCA AD-ERF1-R ccgctgcaggtcgacggatccCCATGGACTAAAATAAGTTGCATCA BD-MED25-F atggccatggaggccgaattcATGGTGGACAAACTGATCGTCG BD-MED25-R ccgctgcaggtcgacggatccATTCATAAACCCGCCTCCTGG

[0051] 2. Bimolecular fluorescence complementation (BiFC) technology verifies the interaction between ERF1 and MED25

[0052] For BiFC assay, specific primers were designed based on the full-length CDS of MED25 and ERF1 genes, and PCR amplification was performed using tomato cDNA as a template. The PCR products were digested with PacI and SpeI to construct ERF1-cYFP and MED25-nYFP vectors (specific primers are shown in Table 3), and bimolecular fluorescence complementation experiments were performed using Agrobacterium-infected tobacco. After 48 hours of infiltration, the subcellular localization of YFP or mCherry signals in leaves was determined using a Zeiss LSM 780 confocal microscope, with an excitation / emission wavelength of 514 nm / 520-560 nm for YFP and an excitation / emission wavelength of 561 nm / 580-620 nm for mCherry. Figure 3 As shown, MED25 was fused to the N-terminus of yellow fluorescent protein (YFP), and ERF1 was fused to the C-terminus of yellow fluorescent protein (YFP). When the fused ERF1-cYFP and MED25-nYFP were co-injected into tobacco leaves for expression, BiFC signals were detected in the transformed tobacco cells, indicating that ERF1 interacted with MED25.

[0053] Table 3 Bimolecular fluorescence complementation vector primers

[0054] Carrier sequence ERF1-cYFP-F atttacgaacgatagttaattaacATGGATTCTTCTTCTTCTTCATCTCA ERF1-cYFP-R actgccacctcctccactagtCCATGGACTAAAATAAGTTGCATCA MED25-nYFP-F atttacgaacgatagttaattaacATGGTGGACAAACTGATCGTCG MED25-nYFP-R actgccacctcctccactagtATTCATAAACCCGCCTCCTGG

[0055] Example 3

[0056] Construction of med25 mutant and erf1 mutant plants.

[0057] First, total RNA was extracted from young roots of wild-type tomatoes; the obtained tomato total RNA was reverse transcribed into cDNA; the sgRNA sequences were designed using the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) as follows (ERF1-sgRNA: TCCGAAGAGATGCTTCTCTT; MED25-sgRNA1: ATAGTGCTTGCCTGGTTCAG; MED25-sgRNA2: ACATGGATACCTTTTTGCAG). The synthesized sequences were annealed and inserted into the BbsI site of the AtU6-sgRNA-AtOBQ-Cas9 vector, and the AtU6-sgRNA-AtoBQ-Cas9box was inserted into the HindIII and KpnI sites of the pCAMBIA1301 binary vector. All the plasmids obtained above were transformed into the Agrobacterium tumefaciens EHA105 strain and infected into the AC cotyledons. Transformed plants were selected based on hygromycin resistance, and knockouts were identified by sequencing the PCR amplicons of the target loci. The PCR products were sequenced by Hangzhou Youkang Biotechnology Co., Ltd., and the sequencing results were as follows Figure 4 As shown, the sequence was aligned using BioXM software (V2.7), the target vector was transformed into the tomato cotyledons through Agrobacterium-mediated infection, and the candidate plants were preliminarily screened using hygromycin. The forward primer and reverse primer (M13F: tgtaaaacgacggccagt; M36-R: ggtattggtttatctcatcggaactgca) of the hygromycin gene sequence were paired to screen independent med25 mutants and erf1 mutants for experiments. At the same time, the applicant found that tomato plants with co-knockout of med25 and erf1 genes could not survive.

[0058] 1) Cultivation of sterile seedlings

[0059] Tomato seeds were shaken in a 28℃ shaker at 200r / min for 6-8h, then sterilized with 75% alcohol for 30s, then sterilized in 10% NaClO for 15min, rinsed with sterile distilled water 3 times and transferred to a sterilized container, inoculated in 1 / 2MS medium, cultured in the dark at 25℃ until white, and then transferred to light culture.

[0060] 2) Prepare explants and culture Agrobacterium

[0061] When the cotyledons are stretched out but true leaves have not yet grown, cut the cotyledons into two pieces with a new scalpel and spread them flat on the nursing medium for pre-culture for 24 hours (protected from light). Pick a single colony of Agrobacterium on the LB plate containing antibiotics, inoculate it in 30 mL of LB containing antibiotics, and culture it overnight at 28°C and 200 r / min until the mid-logarithmic phase (OD600≈1.0, about 16-24 hours).

[0062] 3) Transformation and regeneration

[0063] After the Agrobacterium tumefaciens engineering bacteria containing the target vector plasmid was activated on a YEB plate containing antibiotics, a single Agrobacterium colony was picked and inoculated into 2 mL of YEB containing antibiotics, and cultured overnight at 28°C and 200 rpm. Then, the culture was expanded and shaken at a ratio of 1:100 until the OD 600 =0.8~1.0. Infect the pre-cultured cotyledon explants in the dark for 2~3min, then dry the remaining bacterial solution, transfer to sterile filter paper to dry the remaining bacterial solution, and lay it back to the original care medium with the reverse side facing up, and co-culture at 22℃ in the dark for 48h. After co-culture, transfer the explants to 2Z medium with the front side facing up, and replace the fresh 2Z medium every two weeks. After differentiation and budding, remove the brown explants, and transfer the differentiated buds to 0.2Z medium for selective culture.

[0064] 4) Rooting culture and transplanting

[0065] When the regenerated shoots grow to about 1cm, they are placed in rooting medium for rooting. After 2 weeks, the transformed seedlings are hardened and transplanted to obtain tomato med25 mutant and erf1 mutant plants.

[0066] Example 5

[0067] Resistance assays were performed on med25 and erf1 mutants.

[0068] The obtained tomato med25 mutant and erf1 mutant plants were inoculated with root-knot nematodes.

[0069] The wild-type WT, med25 mutant and erf1 mutant plants were divided into two groups, one as a control group (not treated with root-knot nematodes) and the other as an experimental group (inoculated with root-knot nematodes).

[0070] When tomatoes grew to five leaves and one heart, the experimental group was inoculated with nematodes, with about 1,000 J2 nematodes per plant, and watered normally during the period.

[0071] Plants were grown in plastic cups filled with sterilized river sand and watered with Hoagland nutrient solution. Growth conditions were: day / night temperature 23°C / 20°C, 14 h photoperiod, and 600 μmol m -2 s -1 Light intensity. The nematode treatment time was 5 weeks. Sampling was carried out at the end of the experiment and relevant indicators were measured.

[0072] The method for observing the number of root knots is as follows:

[0073] Acid fuchsin staining was used to observe the root phenotype infected by root-knot nematodes:

[0074] (1) Rinse the tomato roots infected by root-knot nematodes with tap water, then bleach them with 1% sodium hypochlorite solution for 5 minutes, and then rinse them repeatedly with tap water until there is no pungent smell;

[0075] (2) Dry the roots with absorbent paper, soak them in 3.5% acid fuchsin solution, heat to boil, and then cool to room temperature;

[0076] (3) Rinse the roots with tap water to remove excess fuchsin liquid on the surface;

[0077] (4) Preserving the root system in acidic glycerol at room temperature;

[0078] (5) Take photos and count the number of root nodes after 24 hours.

[0079] To verify whether MED25 or ERF1 is involved in tomato resistance to RKN, tomato med25 mutant and erf1 mutant plants were generated by CRISPR-Cas9 system. The med25 mutant and erf1 mutant as well as wild-type WT control plants were used as experimental materials. Each tomato plant was inoculated with 1000 hatched J2 larvae. The expression of defense genes was detected and it was found that root-knot nematodes induced the expression of PDF1.2a / b in the wild type, but it was restricted in med25 mutant and erf1 mutant ( Figure 5 ). At the same time, after 5 weeks of cultivation, it was found that the number of root nodes of the med25 mutant and the erf1 mutant was significantly reduced compared with the wild type, and the difference can be clearly seen from the results of root fuchsin staining ( Figure 6 ). Therefore, these findings suggest that both ERF1 and MED25 positively regulate tomato resistance to southern root-knot nematodes.

Claims

1. Silence or Knockout MED25 The use of genes to enhance resistance of tomatoes to root-knot nematodes; Said MED25 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Reduce MED25 Application of gene-encoded protein expression in enhancing tomato resistance to root-knot nematodes; Said MED25 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

3. A method for enhancing resistance of tomatoes to root-knot nematodes, It is characterized in that The tomatoes MED25 Gene silencing or knockout; Said MED25 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. The method for enhancing the resistance of tomatoes to root-knot nematodes as claimed in claim 3, It is characterized in that The following steps are involved: (1) Construction for knockout or silencing MED25 Gene carrier; (2) Use the gene constructed in step (1) for knockout or silencing MED25 The gene vector is introduced into tomato cells, and the nucleotide sequence shown in SEQ ID NO.1 MED25 Gene silencing or knockout is performed, and transgenic plants are obtained after cultivation.

5. The method for enhancing the resistance of tomatoes to root-knot nematodes as claimed in claim 4, It is characterized in that In step (1), the vector is pCAMBIA1301.

6. The method for enhancing the resistance of tomatoes to root-knot nematodes as claimed in claim 4, It is characterized in that In step (2), MED25 After the gene silencing or knockout vector is transferred into the genetically engineered Agrobacterium, it infects tomato cells.

7. The method for enhancing the resistance of tomatoes to root-knot nematodes according to claim 6, It is characterized in that The Agrobacterium genetic engineering bacteria is Agrobacterium EHA105 strain.

Images