A method for improving yogurt viscosity and beneficial life

Abstract

The present invention discloses a method for improving the viscosity and beneficial activity of yogurt, wherein the yogurt is fermented with Lactobacillus plantarum, wherein the Lactobacillus plantarum is a strain that overexpresses cyaA of Lactobacillus plantarum. The strain activates the synthesis of extracellular polysaccharides of Lactobacillus plantarum by forming a complex with cAMP through a new CRP analog, thereby improving the production of extracellular polysaccharides of Lactobacillus plantarum and increasing the viscosity of yogurt. The carbon source for fermentation of Lactobacillus plantarum is set to maltose. The present invention analyzes the polysaccharide biosynthesis cluster and identifies the transcriptional regulatory factors bound to the promoter to clarify the regulatory mechanism of maltose in increasing EPS production, and uses it to improve the texture of yogurt, thereby improving the viscosity and beneficial activity of yogurt without using or greatly reducing the use of additives, reducing production costs, simplifying the production process, and improving the safety of fermented milk.

Description

Technical Field

[0001] The invention relates to a method for improving the viscosity and beneficial life of yogurt, and belongs to the technical field of gene recombination. Background Art

[0002] The biosynthesis of exopolysaccharides (EPS) is very complex and can occur at different stages of bacterial growth, depending on the characteristics of the microbial strain and environmental conditions. Lactic acid bacteria (LAB) produce more EPS on their cell surface to adapt to environmental stress. Low pH, osmotic pressure, carbon dioxide pressure and certain culture medium components may promote EPS synthesis. Although many studies have demonstrated that environmental factors play an important role in regulating exopolysaccharide production, little is known about the underlying regulatory mechanisms. Even within the same species, strains vary greatly in their responses to changes in environmental factors.

[0003] Lactic acid bacteria such as Streptococcus thermophilus, Streptococcus macedonianus, Lactococcus lactis subsp. cremoris and Lactobacillus delbrueckii subsp. bulgaricus can synthesize EPS. The regulation of EPS synthesis depends on the first gene in the gene cluster, epsA, which has an LCP domain. This domain is regulated by members of the LytR family of transcriptional regulators. EpsR, a protein homologous to lytR, plays an important regulatory role as a regulatory protein of the espA promoter. The regulation of EPS levels by environmental factors may also be attributed to transcriptional regulators outside the eps gene cluster, such as CcpA or other sugar-specific regulators in LAB, which coordinate bacterial growth and carbohydrate metabolism at the whole-cell level. However, the mechanism of EPS biosynthesis regulated by transcriptional regulators remains poorly understood.

[0004] Lactic acid bacteria (LAB) are used as starter cultures to preserve and enhance the nutritional and sensory properties of fermented foods. Specific LAB are considered probiotics for their beneficial health effects. Vitamins, bioactive peptides, antimicrobial compounds, and polysaccharides produced by LAB confer functional activities to certain fermented foods. Lactobacillus plantarum exopolysaccharides, especially heteropolysaccharides, are involved in a variety of biological functions, such as phage uptake, adhesion to human cells or other bacteria, and immunomodulation. In addition, EPS may help protect LAB cells from harsh environmental conditions (drying, heat, or acid stress) and adverse compounds (antibiotics, human gastric and pancreatic enzymes, and bile salts). In addition, as a safe food additive, EPS can significantly improve the viscosity, texture, stability, and mouthfeel of fermented milk, and improve the texture and sensory properties of low-fat cheese. Therefore, improving EPS production by LAB has potential economic value in the food industry. Summary of the invention

[0005] In order to solve the above technical problems, the present invention discloses a method for improving the viscosity and beneficial activity of yogurt, wherein the yogurt is fermented by using Lactobacillus plantarum, wherein the Lactobacillus plantarum is a strain overexpressing cyaA.

[0006] Furthermore: the viscosity of yogurt is increased by increasing the production of extracellular polysaccharides of the cyaA overexpression strain of Lactobacillus plantarum.

[0007] Further: the DNA sequence of the Lactobacillus plantarum cyaA overexpression strain is shown in Seq_1, and the protein sequence is shown in Seq_2.

[0008] Further: the synthesis of Lactobacillus plantarum extracellular polysaccharide is activated by a CRP analogue, the DNA sequence of the CRP analogue is shown in Seq_3, and the protein sequence is shown in Seq_4.

[0009] Furthermore: the carbon source for the Lactobacillus plantarum fermentation is maltose.

[0010] Beneficial effects: The present invention analyzes the polysaccharide biosynthesis cluster and identifies the transcriptional regulatory factors bound to the promoter to clarify the regulatory mechanism of maltose in increasing EPS production, and uses it to improve the texture of yogurt. Without using or greatly reducing the use of additives, the viscosity and beneficial life of yogurt are improved, the production cost is reduced, the production process is simplified, and the safety of fermented milk is improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1a Schematic diagram of EPS production of Lactobacillus plantarum 163 using different carbon sources (20 g / L) in the embodiment of the present invention.

[0012] Figure 1b Schematic diagram of the gene cluster for EPS synthesis in the embodiment of the present invention,

[0013] Figure 1c is a schematic diagram of the effect of maltose on the transcription of promoters 1, 2 and 3 in the embodiment of the present invention,

[0014] Figure 2a This is a schematic diagram of the changes in mRNA and protein levels of energy metabolism-related enzymes after adding 20 g / L maltose in the embodiment of the present invention, measured by transcriptome and proteome,

[0015] Figure 2b Schematic diagram of ATP, cAMP and cGMP contents of Lactobacillus plantarum 163 under 20 g / L glucose or maltose in an embodiment of the present invention,

[0016] Figure 3a is a schematic diagram of the binding of CRP-like protein to a promoter in an embodiment of the present invention,

[0017] Figure 3b is a schematic diagram of the evolutionary tree of CRP-like proteins in the embodiment of the present invention,

[0018] Figure 4a is a schematic diagram of EMSA binding of CRP (2 μg, soluble or refolded from inclusion bodies) and promoter 3 (100 ng) in the embodiment of the present invention,

[0019] Figure 4b is a schematic diagram of the consensus sequence of CRP family proteins aligned using the Clustal Omega method in the embodiment of the present invention,

[0020] Figure 5a is a schematic diagram of the changes in mRNA in promoter 3 when crp is overexpressed or knocked out in Lactobacillus plantarum 163 in an embodiment of the present invention,

[0021] Figure 5b is a schematic diagram showing changes in EPS when crp is overexpressed or knocked out in Lactobacillus plantarum 163 in an embodiment of the present invention,

[0022] Figure 6a is a schematic diagram of the change in promoter 3 mRNA level when cyaA is overexpressed or knocked out in Lactobacillus plantarum 163 in an embodiment of the present invention,

[0023] Figure 6b is a schematic diagram of the change in cAMP level when cyaA is overexpressed or knocked out in Lactobacillus plantarum 163 in an embodiment of the present invention,

[0024] Figure 6c is a schematic diagram of the change in EPS level when cyaA is overexpressed or knocked out in Lactobacillus plantarum 163 in an embodiment of the present invention,

[0025] Figure 7a Schematic diagram of the viscosity of yogurt prepared by using Lactobacillus plantarum 163 (containing glucose or maltose), Lactobacillus plantarum 163-cyaA, Streptococcus thermophilus and Lactobacillus delbrueckii subsp.

[0026] Figure 7b Schematic diagram of the hardness and adhesion of yogurt prepared with Lactobacillus plantarum 163 in an embodiment of the present invention,

[0027] Figure 7c Schematic diagram of the hardness and adhesion of yogurt prepared by Lactobacillus plantarum 163-cyaA in an embodiment of the present invention,

[0028] Figure 8a is a schematic diagram of polypeptide distribution in yogurt made from Lactobacillus plantarum 163 in an embodiment of the present invention,

[0029] Figure 8bSchematic diagram of polypeptide distribution in yogurt made from Lactobacillus plantarum 163-cyaA in an embodiment of the present invention,

[0030] Figure 9a Schematic diagram of DPPH clearance of yogurt-derived polypeptides prepared from Lactobacillus plantarum 163 and Lactobacillus plantarum 163-cyaA in an embodiment of the present invention,

[0031] Figure 9b : is a schematic diagram of the ACE inhibition rate of the yogurt-derived polypeptides prepared from Lactobacillus plantarum 163 and Lactobacillus plantarum 163-cyaA in the embodiments of the present invention,

[0032] Fig.9c is a schematic diagram of the number of Hep-G2 cells when cultured with yogurt-derived polypeptides in an embodiment of the present invention,

[0033] Figure 9d It is a schematic diagram of the survival rate of Hep-G2 cells incubated with the polypeptide for 1 hour in the embodiment of the present invention. DETAILED DESCRIPTION

[0034] The present invention is further explained below in conjunction with the accompanying drawings and specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art all fall within the scope defined by the claims attached to this application.

[0035] The invention discloses a method for improving the viscosity and beneficial activity of yogurt, wherein the yogurt is fermented by Lactobacillus plantarum, wherein the Lactobacillus plantarum is a Lactobacillus plantarum cyaA overexpression strain. The viscosity of the yogurt is increased by increasing the yield of extracellular polysaccharides of the Lactobacillus plantarum cyaA overexpression strain. The DNA sequence of the Lactobacillus plantarum cyaA overexpression strain is shown in Seq_1, and the protein sequence is shown in Seq_2. The synthesis of extracellular polysaccharides of Lactobacillus plantarum is activated by a new CRP analog, and the DNA sequence thereof is shown in Seq_3, and the protein sequence is shown in Seq_4. The carbon source for Lactobacillus plantarum fermentation is set to be maltose.

[0036] Materials and strains

[0037] The strains of Lactobacillus plantarum and Escherichia coli and the vectors used for genetic engineering are listed in Table 1. The Lactobacillus plantarum strain was cultured statically in MRS medium at 37°C. The Escherichia coli strain was inoculated in LB medium and cultured on a shaker at 37°C and 200 rpm.

[0038] EPS yield under different carbon sources

[0039] Lactobacillus plantarum 163 was cultured in MRS medium at 37°C for 24 hours as a control group. Then Lactobacillus plantarum 163 was cultured in a modified MRS medium in which glucose (20 g / L) was replaced by 20 g / L of sucrose, sorbitol, maltose, trehalose, fructose or lactose and cultured at 37°C for 24 hours. The EPS extraction method was based on the method of Dabour et al. Trichloroacetic acid was added to the cell-free supernatant at an addition amount of 12% (w / v) to remove protein. Then 1 volume of acetone was added to the supernatant to precipitate EPS. EPS was collected by centrifugation at 12,000 × g for 15 minutes, then dissolved in deionized water, dialyzed for 5 days and freeze-dried.

[0040] EPS biosynthesis gene cluster

[0041] The polysaccharide biosynthesis genes cps 1-4 of the model strain WCFS1 of Lactobacillus plantarum (accession number: NC_004567.2GI:380031102) were compared with the genome data of Lactobacillus plantarum 163 (SRA: SRR12825168). The gene annotation was analyzed using the BLAST method of the NCBI database.

[0042] Real-time reverse transcription polymerase chain reaction (RT-qPCR)

[0043] mRNA of Lactobacillus plantarum 163 or its mutants was extracted using an RNA extraction kit. Then, the mRNA was reverse transcribed into DNA, and the transcription level was determined by real-time PCR using SYBR green master mixes.

[0044] Transcriptome and proteome data analysis

[0045] In this study, transcriptomic and proteomic data of Lactobacillus plantarum 163 under glucose and maltose conditions were determined. Transcriptomic data were obtained from the NCBI database (SRA: SRR12831476), and proteomic data were obtained from the National Center for Protein Science (Beijing, China) (PXD022981). Gene and protein changes in glycolysis, pentose phosphate pathway, tricarboxylic acid cycle, and purine metabolism were analyzed.

[0046] Quantification of ATP, cAMP, and cGMP

[0047] Lactobacillus plantarum 163 strain was cultured in MRS medium at 37°C for 24 hours. Cells were collected by centrifugation, washed twice with PBS (pH 7.2), and resuspended in 1 volume of PBS (pH 7.2). Cells were then crushed by high pressure homogenization, and ATP, cAMP, and cGMP levels of the cell-free supernatant were determined using ELISA kits.

[0048] Protein expression and purification

[0049] The cAMP receptor protein gene crp was connected to pET30a and transformed into E. coli C43 (DE3) cells. The protein induced by 1.0 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was expressed at 16 ° C for 24 hours. The cells were then crushed by high-pressure homogenization in PBS (pH 7.2). The supernatant was loaded onto a Ni-NTA column and washed with 200 mM imidazole, and then a 3 kDa ultrafiltration tube was used to remove the imidazole and concentrate the protein.

[0050] Overexpressed target genes in Lactobacillus plantarum 163

[0051] The expression vector pLP02 was used to overexpress crp and cyaA in Lactobacillus plantarum 163. pLP02 contains the replication origins of RepA and RepB from pMG36e, the erythromycin resistance gene EmR from pMG36e, the ColE1 replication origin and ampicillin resistance gene from pUC19, and the P23 promoter and terminator of Lactococcus lactis MG1363.

[0052] Gene knockout in Lactobacillus plantarum 163

[0053] The CRISPR–Cas9 toolbox assisted by RecE / T was used to knock out the lactobacillus gene. The N20 sequence and upstream and downstream homology arms of CRP were connected to pHSP02 containing Cas9 and gRNA scaffolds. It was then transformed into Lactobacillus plantarum 163 (containing the RecE / T recombination auxiliary vector pLH01). The knockout of the CRP gene was detected by antibiotic resistance and PCR technology, and positive transformants were screened.

[0054] Electrophoretic mobility shift assay (EMSA)

[0055] Promoter P3 was amplified and purified using a DNA probe. In addition, in binding buffer (10 mM Hepes buffer, pH 7.9, containing 0.4 mM MgCl 2, 0.4 mM DTT, 50 mM NaCl, 0.1 mM ZnCl 2, 0.1 mM spermidine and 4% (v / v) glycerol), with or without cAMP (1.0 μM), maintained at 37° C. for 30 minutes. Mobility shifts were measured by electrophoresis at 100 V for 60 minutes on a 6% polyacrylamide gel.

[0056] Consensus sequence analysis

[0057] The Clustal omega method was used to align the binding sequences of CRP family proteins such as CopZ, CadA, Dps, FlpA and CRP of Lactobacillus plantarum 163 to identify the consensus sequence.

[0058] Yogurt texture and composition

[0059] The lactic acid bacteria strains were cultured in MRS medium at 37°C for 12 hours. Thermophilic Streptococcus (0.5×10 8 CFU and Lactobacillus delbrueckii subsp. bulgaricus (0.5×10 8 CFU), Lactobacillus plantarum 163 (10 9 CFU) or Lactobacillus plantarum 163-cyaA (10 9 CFU) were added to 100 mL of pasteurized milk containing 10 g / L glucose or maltose and cultured at 37°C for 12 h.

[0060] The viscosity of the yogurt was determined using a rotational viscometer, with viscosity measured every 10 seconds. The texture of the yogurt samples was measured using a texture analyzer (TA.XT Express, Stable Micro System, UK) with a 5 kg load cell and a cylindrical probe (25.4 mm diameter) with a texture index program. T-texture profile analysis was performed by compressing 3 times using a probe with a 10 mm penetration at a speed of 5 mm / s. Firmness and adhesion were measured in triplicate for each sample.

[0061] The yogurt samples were stirred using a glass rod and the pH value was checked using a pH meter. The protein content was determined by the Kjeldahl method (GB5009.5-2016, China Food Safety National Standard, Determination of Protein in Food), and the total fat content was determined by alkaline hydrolysis (GB5009.6-2016, Determination of Fat in Food). Ammonia (2.0 mL) was added to 10.0 g of yogurt and incubated at 65 ° C for 20 minutes. Then 10.0 mL of ethanol, 25 mL of ether, and 25 mL of petroleum ether were added to extract fatty acids, and the mixture was repeated three times. The organic phase was separated by centrifugation and the organic solvent was removed by distillation. Therefore, the weight of fat was measured after drying at 100 ° C for 1 hour. In addition, according to the China Food Safety National Standard "Determination of Sucrose in Food" (GB 5009.8-2016), carbohydrates were detected by high performance liquid chromatography. Water (50 mL) was added to 5 g of yogurt, and 5.0 mL of zinc acetate and potassium ferrocyanide were slowly added. After adding water to make the volume to 100 ml, stir magnetically for 30 min and then detect by HPLC.

[0062] Yogurt peptide detection

[0063] Methanol (400 mL) was added to 50 mL of yogurt precipitated protein and removed by centrifugation at 12,000 × g for 10 min. The supernatant was dried by rotary evaporation (Hei-VAP Ultimate, Heidolph, Germany) and reconstituted with saline to obtain peptide extracts. Peptide concentrations were determined using the Coomassie brilliant blue method. Peptide sequences were identified by mass spectrometry according to the method described previously.

[0064] Antioxidant activity

[0065] The antioxidant activity of the peptides was measured by calculating their 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging activity. Ascorbic acid (10 mM) was used as a positive control, while phosphate buffer solution was used as a negative control. The scavenging rate (%) of DPPH was calculated as (A Sample -A negative ) / (A positive -A negative )×100, where A Sample , A negative and A positiv e is the absorbance of the sample (517 nm, UV2600, Shimadzu, Japan).

[0066] ACE activity assay

[0067] First, 25 μL of peptide (0, 10, 50, 100, 150, and 200 μg / mL) was added to 225 μL of borate buffer (100 mM, pH 8.3, containing 5 mM Hip-His-Leu and 300 mM sodium chloride) and incubated at 37 ° C for 5 minutes. Then, 50 μL of ACE (4 mU / mL) was added and incubated at 37 ° C for another 30 minutes. The reaction was terminated by adding 1.5 mL of 3% 2,4,6-trichloro-s-triazine in dioxane and 3 mL of phosphate buffer (200 mM, pH 8.3). After centrifugation at 10,000 × g for 10 minutes, the enzyme activity was determined in the supernatant using a spectrophotometer (382 nm). ACE inhibition (%) was calculated as (A control -A sample ) / A control ×100, where A sample and A control are the absorbance of the sample and phosphate buffer, respectively (382 nm, UV2600, Shimadzu, Japan).

[0068] Cell viability assay

[0069] The cytotoxicity of the peptides was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. Hep-G2 cells (1×104 Cells were seeded in 96-well plates and cultured in α-MEM medium containing 10% fetal bovine serum at 37°C in 5% CO2 for 24 hours. The medium was then discarded, washed with PBS buffer (10mM, pH 7.2), in 90μL α-MEM and 10μL peptide (0, 0.5, 2 and 4mg / mL), and then treated with MTT solution (0.5mg / mL in PBS). After 4h, the medium was removed, 150μL dimethyl sulfoxide (DMSO) was added, and shaken for 10min. The absorbance was measured at 490nm using a microplate reader (Multiskan Sky, GE, USA).

[0070] Statistical methods

[0071] The experiment adopted a randomized design with 5 treatments and 5 replicates per treatment, and the mean value of each point was calculated. One-way analysis of variance (ANOVA) was used for significance analysis, and post hoc comparisons were performed using Tukey's multiple comparison test in SPSS (IBM, version 17.0). Differences were considered statistically significant at p < 0.05.

[0072] Table 1 Bacteria and vectors used in this experiment

[0073]

[0074]

[0075] Table 2 Genes with mRNA changes of more than 100 times

[0076]

[0077] Table 3 Proteins binding to promoter P3

[0078]

[0079] Table 4 Physicochemical properties of yogurt

[0080]

[0081] Table 5. Yogurt peptides

[0082]

[0083] CSN1S1: α-S1-casein, CSN1S2: α-S2-casein, CSN2: β-casein, CSN3: κ-casein, β-LG: β-lactoglobulin.

[0084] Experimental results analysis

[0085] Genomics-based gene cluster analysis of EPS synthesis

[0086] Carbon source plays an important role in EPS synthesis. In this experiment, the EPS production of Lactobacillus plantarum 163 was determined when it was cultured with different carbon sources. Figure 1a As shown in Figure 2, sucrose, sorbitol, trehalose, fructose, and lactose had limited effects on EPS production, while maltose increased EPS production to 3.0 g / L, which was 6.5 times that of glucose. In order to study the regulatory mechanism of maltose in EPS synthesis, the gene clusters of polysaccharide synthesis were analyzed based on the genome data of Lactobacillus plantarum 163, and two gene clusters were found, such as Figure 1b As shown: Cluster 1 (990-997) and Cluster 2 (1787-1794) belong to the cps 3 and cps 4 clusters identified in Lactobacillus plantarum WCFS1. In addition, the transcription levels of both clusters were determined after the addition of maltose. This showed that maltose increased the transcription of promoter 3 (cluster 2), which may lead to the increase in EPS production ( Figure 1c ).

[0087] Maltose enhances the energy metabolism of Lactobacillus plantarum

[0088] Compared with glucose, maltose can regulate EPS synthesis by changing cellular metabolism. Transcriptomic and proteomic data showed that maltose significantly (p < 0.05) enhanced glycolysis, pentose phosphate pathway, and purine metabolism pathway ( Figure 2a ). Due to the lack of a complete tricarboxylic acid cycle pathway in Lactobacillus plantarum 163, pyruvate and acetyl-CoA produced by glycolysis enter the amino acid and fatty acid synthesis pathways. In addition, genes with mRNA changes of more than 100 times were concentrated in purine metabolism and maltose metabolism (Table 2), indicating that energy enters purine metabolism through the PPP pathway to synthesize DNA and various signaling molecules such as dAMP, dGMP, cAMP, and cGMP. Therefore, we speculate that the synthesis of EPS may be related to the supply of ATP and the content of signaling molecules. Maltose increased ATP supply by 25% and the contents of cAMP and cGMP by 58% and 44%, respectively, which may promote EPS synthesis ( Figure 2b ).

[0089] CRP-like protein binding to promoter 3

[0090] Although transcriptomic and proteomic data suggest that maltose may regulate EPS synthesis via cAMP or cGMP, direct evidence is lacking. Therefore, DNA-protein pull-down techniques were used to search for regulatory proteins that directly bind to P3. Thus, transcription-related proteins (RNA polymerase, DNA topoisomerase, and sigma factor), translation-related proteins (ribosomal proteins, elongation factors, and molecular chaperones), and Crp / Fnr family transcriptional regulators were identified (Table 3, Figure 3a). Usually, transcription- and translation-related proteins do not directly regulate the expression of target genes. Therefore, the Crp / Fnr family transcriptional regulator CRP may regulate EPS synthesis in L. plantarum 163. In addition, the evolutionary tree of CRP showed that it belongs to the cAMP receptor protein family and is commonly found in lactic acid bacteria, such as Lactobacillus, Lactobacillus, Lactobacillus, Lactobacillus, and Limosilactobacillus ( Figure 3b ).

[0091] cAMP is required for CRP to bind to promoter 3

[0092] The CRP-cAMP complex is a global regulator that controls target promoters, usually by activating transcription. CRP-cAMP is a proximal activator that responds to carbohydrate metabolism. The CRP-like protein of Lactobacillus plantarum 163 was expressed as a soluble protein and inclusion bodies. EMSA results showed that soluble CRP bound to the promoter P3, while the refolded CRP in the inclusion body could not bind to P3 ( Figure 4a ). However, additional cAMP promoted the binding between refolded CRP and P3. This indicates that cAMP is necessary for the binding of CRP to P3. Binding site alignment of lactic acid bacteria CRP homologous proteins, the consensus sequence is a palindromic sequence (AACTTGATG----ATCAAGTT)( Figure 4b ). In addition, the predicted binding sequence (ACAATAATGTCAATCGTTTAATAAAAGTCAGTCAAGAA) was synthesized, but both single-stranded and double-stranded DNA were formed. CRP-cAMP bound to dsDNA but not ssDNA.

[0093] Increasing CRP-cAMP concentration significantly increased EPS production

[0094] Due to the expected regulatory effect of CRP-cAMP, crp was overexpressed in Lactobacillus plantarum 163. As a result, the mRNA level of crp increased 11-fold, while the change in EPS production was not significant (p>0.05) (Figure 5). However, the knockout of crp resulted in a 5.1-fold decrease in mRNA levels and a 43% decrease in EPS production (Figure 5). This shows that CRP is essential for EPS synthesis and that CRP concentrations are sufficient under normal conditions. Subsequently, cyaA, an adenylate cyclase encoding the synthetic cAMP, was overexpressed or knocked out in Lactobacillus plantarum 163. The results showed that the mRNA level, intracellular cAMP content, and EPS production of P3 increased by 5.9, 4.5, and 2.2 times when cyaA was overexpressed. In addition, if cyaA was knocked out, the P3 mRNA level, intracellular cAMP content, and EPS production all decreased significantly (p<0.05) (Figure 6). These results indicate that the increase in the CRP-cAMP complex promotes EPS synthesis.

[0095] EPS significantly improves the texture of yogurt

[0096] Viscosity is an important sensory indicator that directly affects the palatability of yogurt. In addition, viscosity affects satiety because of its role in gastric emptying and intestinal motility. Lactobacillus bulgaricus (ST+LB), Lactobacillus plantarum 163, and Lactobacillus plantarum 163-cyaA were evaluated for yogurt viscosity. Commercial plain yogurt and Greek yogurt were used as controls. The yogurt viscosity of Lactobacillus plantarum 163 was between that of regular yogurt and Greek yogurt, while the viscosity of yogurt produced by Lactobacillus plantarum 163-cyaA was similar to that of Greek yogurt. In addition, compared with glucose, maltose significantly (p<0.05) increased the viscosity of Lactobacillus plantarum 163 ( Figure 7a Overexpression of cyaA increased the firmness and viscosity of yogurt ( Figure 7b and 7c ). The pH value and the contents of protein, fat, and carbohydrates were determined, indicating that the pH value of the yogurt made with Lactobacillus plantarum 163-cyaA was lower than that of the yogurt made with ST+LB. However, there was no significant difference in the protein, fat, and carbohydrate contents between the two yogurts (p>0.05) (Table 4).

[0097] Yogurt made with Lactobacillus plantarum 163-cyaA has better biological functions

[0098] In addition to sensory indicators, yogurt has received increasing attention due to its functionality. The biological function of yogurt is closely related to the content and type of peptides in yogurt, which are released from milk proteins by proteases. Yogurt made with lp163-cyaA had a wider variety of peptides and higher peptide concentrations than yogurt made with ST+LB (Table 5). In addition, the peptides of the two yogurt samples showed significant differences in distribution. For CSN1S2, lp163-cyaA hydrolyzed milk peptides were distributed at positions 100-140 and 160-220, while ST+LB hydrolyzed milk peptides were distributed at positions 160-220 (Figure 8).

[0099] The difference in peptide types leads to differences in their biological functions. As the peptide concentration increases, its antioxidant and ACE inhibitory activities gradually increase. The clearance rates of 50 μg / mL peptide (lp163-cyaA) were 45% and 79%, respectively, which were significantly higher than those of peptide (ST+LB) ( Figure 9a and 9b )(p<0.05). In addition, the peptide inhibited the growth of Hep-G2 cells and significantly (p<0.05) reduced the survival rate of Hep-G2 cells at high concentrations. In addition, the effect of peptide (lp163-cyaA) was better than that of peptide (ST+LB) ( Fig.9c and 9d These results indicate that lp163-cyaA has the potential to produce functional yogurt.

[0100] in conclusion

[0101] Lactobacillus plantarum EPS significantly improved the texture properties of yogurt, including viscosity, hardness, and adhesion. In addition, analyzing the synthesis mechanism of EPS is a theoretical basis for improving its yield. The well-characterized Lactobacillus plantarum WCFS1 genome contains four gene clusters (cps1A-I, cps2A-J, cps3A-J, and cps4A-J) related to surface polysaccharide synthesis. In addition, Lactobacillus plantarum SF2A35B and Lp90 contain cps2, cps3, and cps4, and cps2 is involved in EPS synthesis. Lactobacillus plantarum strains ZJ316, ST-III, and ATCC 14917 have cps3 and cps4, while JDM1 only carries the cps4 cluster. Some researchers summarized the gene clusters for EPS synthesis in 43 strains of Lactobacillus plantarum and divided them into 4 types (type1-4), containing 4, 3, 2, and 1 gene clusters, respectively. In the Lactobacillus plantarum WCFS1 strain, cps1 is responsible for EPS molecular weight and monosaccharide composition. Cps2 mainly affects the monosaccharide composition by being responsible for galactose in EPS. Although cps3 and cps4 do not affect the monosaccharide composition of EPS, Cps2, 3 and 4 jointly control EPS production. Lactobacillus plantarum 163 used in the present application contains cps3 and cps4, similar to Lactobacillus plantarum strains ZJ316, ST-III and ATCC 14917.

[0102] The composition of the medium and the culture conditions strongly affected the level of EPS production in LAB, indicating that environmental factors play an important role in directly or indirectly regulating EPS biosynthesis. For example, EPS synthesis in Streptococcus thermophilus LY03 varied with the carbon / nitrogen ratio in the medium, and EPS synthesis was increased by 4.2 times by optimizing the medium composition and culture conditions. When the carbon source was maltose, the EPS production in Lactobacillus plantarum increased by 6.5 times. In addition, maltose increased the concentration of CRP-cAMP, which in turn controlled the synthesis of polysaccharides. Similar phenomena were observed in Lactobacillus plantarum WCFS1 and CcpA, concluding that maltose is a global regulator that controls the expression of the three cps clusters. .

[0103] EPS from LAB can be used to produce a variety of fermented products to improve the rheology, texture and mouthfeel of fermented food formulations. In addition, in the manufacture of fermented milk and beverages, EPS increases the viscosity of fermented milk by reducing the amount of added milk solids to improve the viscosity, texture, stability and mouthfeel of the final product and avoiding syneresis. EPS from Streptococcus thermophilus S-3 strain increased the viscosity, syneresis capacity, water holding capacity and rheological properties of yogurt compared to Lactobacillus bulgaricus. Lactobacillus plantarum 163, as a single strain, can be used to prepare yogurt with a higher viscosity than plain yogurt. In addition, the viscosity of yogurt made with lp163-cyaA was similar to that of commercial Greek yogurt without thickeners (hydroxypropyl distarch phosphate, pectin, agar and gellan gum).

[0104] Some lactic acid bacteria in yogurt have been shown to have immunomodulatory and anti-inflammatory properties. Lactic acid bacteria have a complete proteolytic system, which enables them to grow effectively in milk and release a large number of potential bioactive peptides. The peptide (lp163-cyaA) derived from yogurt has multiple biological functions, such as antioxidant, ACE inhibition and anticancer activity. Therefore, in addition to the classic yogurt strain ST+LB, lp163-cyaA can also be used alone to prepare yogurt, and the viscosity, hardness and bioactivity of the prepared yogurt are better than those of the classic ST+LB.

[0105] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0106] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A method for improving the viscosity and beneficial life of yogurt, characterized in that: The yogurt is fermented by using Lactobacillus plantarum, wherein the Lactobacillus plantarum is a strain of Lactobacillus plantarum cyaA overexpression, and the carbon source of the fermentation is maltose.

2. The method for improving the viscosity and beneficial life of yogurt according to claim 1, characterized in that: The viscosity of yogurt is increased by increasing the production of extracellular polysaccharides of a cyaA overexpression strain of Lactobacillus plantarum. The cyaA gene DNA sequence of the cyaA overexpression strain of Lactobacillus plantarum is shown in Seq_1, and the protein sequence is shown in Seq_2.

3. The method for improving the viscosity and beneficial life of yogurt according to claim 2, characterized in that: The synthesis of Lactobacillus plantarum exopolysaccharide is activated by a CRP analog, the DNA sequence of the CRP analog is shown in Seq_3, and the protein sequence is shown in Seq_4.

Images