Method for obtaining tobacco with leaf shape change and low nicotine content by knocking out tobacco NtLNP1 gene and application thereof

By knocking out the NtLNP1 gene in tobacco using the CRISPR/Cas9 system, the problem of insufficient research on the nicotine metabolism pathway in tobacco was solved, and new tobacco varieties with altered leaf shape and low nicotine content were obtained, providing genetic resources and theoretical basis.

CN116217685BActive Publication Date: 2026-02-24CHINA TOBACCO YUNNAN IND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310004217.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-03
Publication Date
2026-02-24
Estimated Expiration
2043-01-03

AI Technical Summary

Technical Problem

In the current technology, the study of tobacco nicotine metabolism pathways has not been fully explored. In particular, common tobacco is a polyploid plant with multiple homologous genes for each gene, making it difficult to effectively regulate nicotine content and leaf shape, and lacking genetic materials for targeted improvement.

Method used

The NtLNP1 gene in tobacco was knocked out using the CRISPR/Cas9 system. A CRISPR/Cas9 vector was constructed by designing an sgRNA guide sequence. Genetic transformation and self-pollination were then carried out to obtain new tobacco varieties with altered leaf shape and low nicotine content.

Benefits of technology

Significant changes in tobacco leaf shape and a significant reduction in nicotine content were achieved, providing genetic resources and theoretical basis for the targeted improvement of new tobacco varieties, and providing new tobacco varieties with low nicotine content and specific leaf shapes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116217685B_ABST
    Figure CN116217685B_ABST
Patent Text Reader

Abstract

The application discloses a method for knocking out a tobacco NtLNP1 gene to obtain tobacco with changed leaf shape and low nicotine content and application thereof. A gene related to tobacco nicotine synthesis metabolism and leaf shape regulation is an NtLNP1 gene. Through a CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 editing vector for knocking out the NtLNP1 gene is constructed, and after editing material creation and molecular detection and identification, an editing plant with the NtLNP1 gene knocked out is obtained. The editing plant has an oval leaf shape, which is obviously changed compared with a control leaf shape. It is found through gas chromatography-mass spectrometry detection that the nicotine content of the leaf of the editing plant with the NtLNP1 gene knocked out at a budding stage is significantly lower than that of the control plant. The application provides genetic materials and a theoretical basis for research on functions of tobacco nicotine metabolism genes and directional improvement of new tobacco varieties with controllable nicotine content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a method and application for obtaining tobacco with altered leaf shape and low nicotine content by knocking out the NtLNP1 gene in tobacco. Background Technology

[0002] In recent years, several important genes related to nicotine synthesis, transport, and transformation have been cloned, significantly advancing research on the mechanisms of nicotine biosynthesis and tobacco genetics and breeding. Since the 1930s, it was discovered in 1969 that nicotine levels are controlled by two unlinked gene loci, designated Nic1 and Nic2 after 1994. Subsequent studies have demonstrated that these loci control the expression of genes related to nicotine biosynthesis. Research on the condensation reactions of the pyrrolidine and pyridine rings in nicotine has shown that the isoflavone reductase gene A622, a member of the PIP family of NADPH-dependent reductases, and its homologs are involved in this process, as is the BBL gene, a member of the berberine bridging enzyme family. Nicotine synthesis is regulated by multiple factors. The plant hormones known to be involved in nicotine metabolism regulation include jasmonic acid, auxin, and ethylene. Auxin and ethylene are negative regulators of nicotine synthesis, and current research mainly focuses on the regulation via the jasmonic acid signaling pathway. The jasmonic acid pathway regulators COI1 and JAZ protein in tobacco have been shown to be nicotine synthesis regulators. Currently, some transcription factors that regulate nicotine synthesis have also been identified, such as homologs of ERF transcription factor family members JAP1, ERF32 and ORC1, and bHLH transcription factor family members bHLH1 / 2 and MYC. At the same time, these transcription factors can also affect the nicotine metabolism process through mutual regulation.

[0003] Although the nicotine metabolism pathway in tobacco is largely understood and some functional genes for most metabolic steps have been isolated and identified, the homologous genes of these functional genes in tobacco have not been fully discovered. In particular, since common tobacco is a polyploid plant, each gene has about 5 homologous genes. Therefore, much work still needs to be done in the study of functional genes in nicotine metabolism. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a method and application for obtaining tobacco with altered leaf shape and low nicotine content by knocking out the NtLNP1 gene in tobacco, which provides germplasm resources for studying the function of tobacco nicotine metabolism genes and for the targeted improvement of cultivated tobacco varieties.

[0005] The technical problem to be solved by the present invention is achieved through the following technical solution:

[0006] A gene related to tobacco nicotine synthesis and metabolism and leaf shape regulation, wherein the gene related to tobacco nicotine metabolism and leaf shape regulation is the NtLNP1 gene, the sequence of which is SEQ ID No.1.

[0007] Preferably, the sequence of the protein encoded by the NtLNP1 gene after translation is SEQ ID No.2.

[0008] A method for obtaining tobacco with altered leaf shape and low nicotine content by knocking out the NtLNP1 gene in tobacco, wherein the knockout is performed by knocking out the NtLNP1 gene in tobacco using a CRISPR / Cas9 system, and the method includes the following steps:

[0009] (1) Design of sgRNA guide sequence and construction of sgRNA expression vector;

[0010] (2) T0 generation editing materials were obtained through genetic transformation;

[0011] (3) Homozygous editing material was obtained from T0 generation plants through self-pollination;

[0012] (4) Plant homozygous unlabeled materials and observe their characteristics.

[0013] Preferably, in step (1), the sgRNA sequence used by the CRISPR / Cas9 system is ATATCCATCCATTCAAGCGATGG, and the primer sequence used for the sgRNA sequence is:

[0014] Upstream primer sgRNA-F: GATTGATATCCATCCATTCAAGCGA;

[0015] Downstream primer sgRNA-R: AAACCTCGCTTGAATGGATGGATAT.

[0016] Preferably, step (1) specifically includes:

[0017] The sgRNA guide sequence was designed, and the upstream primer sgRNA-F and the downstream primer sgRNA-R were annealed to form a double strand. The CRISPR / Cas9 vector pORE-Cas9 was digested with the restriction endonuclease BsaI-HF. The annealed double-stranded product was ligated to the digested vector backbone using T4 ligase. The ligation product was transformed into competent E. coli cells, positive clones were detected, and recombinant plasmids were extracted to obtain the CRISPR-Cas9 expression vector.

[0018] Preferably, step (2) specifically includes:

[0019] Tobacco leaf discs were infected by soaking Agrobacterium LBA4404 bacterial solution carrying the CRISPR / Cas9-sgRNA expression vector, and T0 generation plants were obtained. After target editing detection, plants with NtLNP1 gene editing were obtained, and T0 generation seeds were harvested.

[0020] Preferably, step (3) specifically includes:

[0021] T0 generation seeds were self-pollinated homozygous for propagation. After target editing detection, plants with homozygous NtLNP1 gene editing were obtained, and T1 generation seeds were harvested.

[0022] Application of a gene related to tobacco nicotine synthesis and metabolism and leaf shape regulation in the creation of new tobacco varieties with altered leaf shape and low nicotine content.

[0023] The application of a method for obtaining tobacco with altered leaf shape and low nicotine content by knocking out the NtLNP1 gene in the creation of new tobacco varieties with altered leaf shape and low nicotine content.

[0024] Preferably, the new tobacco variety created by knocking out the NtLNP1 gene has significantly shorter lateral leaves than the control plant, while the lateral leaves are wider than the control plant. The leaf shape changes from oblong to elliptical to elliptical, and the leaves are shorter and wider, with a lateral leaf length-to-width ratio smaller than that of the control plant. At the same time, the nicotine content in the leaves of the new NtLNP1 gene knockout plant is lower than that of the control plant 7 days after topping.

[0025] The above-described technical solution of the present invention has the following beneficial effects:

[0026] This invention utilizes CRISPR / Cas9-mediated gene editing technology to construct a CRISPR / Cas9 editing vector for knocking out the NtLNP1 gene. After the creation of editing materials and molecular detection and identification, NtLNP1 gene knockout edited plants of *Sedum rubrum* were obtained.

[0027] The present invention provides the tobacco nicotine metabolism-related gene NtLNP1. The leaves of plants edited by knocking out the NtLNP1 gene are elliptical, which is a significant change compared with the control leaves (oblong).

[0028] The tobacco nicotine metabolism-related gene NtLNP1 provided by this invention was detected by gas chromatography-mass spectrometry. The nicotine content in the leaves of plants with NtLNP1 gene knockout editing at the budding stage was found to be significantly lower than that in control plants.

[0029] In summary, the use of CRISPR / Cas9-mediated gene editing technology to knock out the NtLNP1 gene yielded edited material with reduced nicotine content and altered leaf shape. This provides genetic material and theoretical basis for the study of tobacco nicotine metabolism gene function and the targeted improvement of new tobacco varieties with controllable nicotine content. Attached Figure Description

[0030] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments of the invention and, together with their description, serve to explain the principles of the invention.

[0031] Figure 1 This invention compares the main agronomic traits of edited plants with those of the control (unedited).

[0032] Figure 2 This invention provides a comparison of leaf shape between edited plants and control (unedited) plants.

[0033] Figure 3 Edited KEGG annotations for differentially upregulated genes in plants and controls (unedited) for this invention.

[0034] Figure 4 Edited KEGG annotations for differentially downregulated genes in plants and controls (unedited) for this invention. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that, unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention.

[0036] Unless otherwise specified, all experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0037] Example 1: Obtaining the NtLNP1 gene

[0038] Using the entire cultivated tobacco cultivar 'Honghua Dajinyuan' as experimental material, total RNA was extracted from tobacco roots using an RNA extraction kit and reverse transcribed into cDNA for later use.

[0039] Total RNA was extracted from tobacco according to the instructions of the plant RNA extraction kit.

[0040] 1 μg of total RNA was extracted from the leaves for reverse transcription. The transcription system is as follows:

[0041] Total RNA 1μg;

[0042] Oligo(dT)(10μM) 1.5μL;

[0043] Add ddH2O up to 15μL.

[0044] After mixing the above system thoroughly, place it in a PCR incubator and incubate at 70°C for 5 minutes. Immediately after incubation, place it on ice for 5 minutes. Then, add the following reagents to the system:

[0045]

[0046] The above system was placed in a PCR instrument and incubated at 42℃ for 65 min, 65℃ for 10 min, and 4℃. After that, it was stored in a -20℃ refrigerator for use.

[0047] Using homology alignment, and referencing the sequences of Arabidopsis thaliana genes and known partial gene sequences of tobacco, the following amplification primer sequences were designed:

[0048] F: 5'-ATGACACTAAGCAAGTACTTTTAC-3' (SEQ ID No. 3);

[0049] R: 5'-TCAAAGACTTTGATAGAGTTCC-3' (SEQ ID No. 4).

[0050] Using the prepared cDNA as a template, PCR amplification was performed using the primers described above:

[0051] Amplification system (50 μL):

[0052]

[0053] After mixing and centrifuging, PCR amplification was performed. The PCR reaction conditions were: 95℃ for 10 sec, 52℃ for 30 sec, 72℃ for 2 min, for a total of 30 cycles; 72℃ for 10 min; 25℃ Hold.

[0054] The amplified product was purified and sequenced to obtain the NtLNP1 gene sequence related to tobacco nicotine metabolism, as shown in SEQ ID No. 1, which consists of 1263 bases. Translation of this gene sequence yielded the protein sequence shown in SEQ ID No. 2, which consists of 420 amino acid residues. Further comparative analysis showed that the protein contains highly homologous and conserved sequences.

[0055] Example 2: Construction of expression vector

[0056] Using the nicotinic metabolism-related gene NtLNP1 obtained in Example 1, this invention further constructed a CRISPR / Cas9 vector.

[0057] (1) Design and synthesis of the sgRNA sequence of the NtLNP1 gene:

[0058] The sgRNA guide sequence was designed using the online software CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / crispr / ), selecting a guide sequence with a high score and located at a suitable position in the NtLNP1 gene sequence. The sgRNA sequence selected in this application is: ATATCCATCCATTCAAGCGATGG (SEQ ID No. 5).

[0059] (2) Design forward and reverse primers for the sgRNA sequence and have them synthesized by the design company: forward primer sgRNA-F: GATTTGATATCCATCCATTCAAGCGA (SEQ ID No. 6) and reverse primer sgRNA-R: AAACCTCGCTTGAATGGATGGATAT (SEQ ID No. 7);

[0060] (3) Primer annealing: The synthesized target sequence primers (upstream and downstream primers) were diluted with sterile ddH2O to a concentration of 100 ng / μL. Then, 5 μL of each primer was added to a PCR tube and mixed evenly. The tube was then placed on a PCR instrument for annealing, so that the upstream and downstream Oligo single strands could be annealed to form double strands.

[0061] The annealing program for the PCR instrument was: 95℃ for 2 min, -0.1℃ for 8 s, anneal to 25℃, and the annealed product was diluted with 90 μL of sterile water to 10 ng / μL.

[0062] (4) Enzyme digestion and ligation

[0063] a. The CRISPR / Cas9 vector pORE-Cas9 (provided by Southwest University) was digested with the restriction endonuclease BsaI-HF.

[0064] Enzyme digestion system (50 μL):

[0065]

[0066] Enzyme digestion was performed overnight at 37°C. The target fragment band was cut by 1.5% agarose gel electrophoresis and the backbone fragment was recovered using a gel recovery kit.

[0067] b. Connection

[0068] The double-stranded product formed by annealing is linked to the enzyme-digested vector backbone.

[0069] Connection system (10 μL):

[0070]

[0071]

[0072] Connection conditions: 16℃ for 2 hours.

[0073] (5) Transformation of E. coli:

[0074] a. Remove Trans-T1 competent cells from -80℃, freeze-thaw them on ice, and divide them into 50μL portions;

[0075] b. After the competent cells have thawed, add 10 μL of the ligation product to the competent cells, mix gently, and incubate on ice for 10 min.

[0076] c. After the ice bath, place the competent state in a 42℃ water bath for 90 seconds for heat shock, and then quickly place it back on ice and let it stand for 2 minutes.

[0077] d. Spread 60 μL of the transformation product evenly on LB solid medium containing 16 mg / L kanamycin and incubate at 37°C for 12 hours.

[0078] (6) Screening for positive clones:

[0079] a. Once single colonies have grown on the plate, pick a single colony of E. coli and add it to LB liquid medium containing 50 mg / L kanamycin. Incubate overnight at 37°C with shaking.

[0080] b. Take a portion of the bacterial culture for bacterial PCR, and then detect whether it is a positive clone by nucleic acid electrophoresis;

[0081] c. Extract E. coli plasmids from the remaining portion of the bacterial culture that initially detected positive clones. Send the plasmids to Novogene for sequencing to confirm the correctness of the positive clones.

[0082] Example 3: Obtaining and Detecting T0 Generation Plants

[0083] (1) Transformation of Agrobacterium tumefaciens

[0084] Using the CRISPR / Cas9-NtLNP1 editing vector plasmid constructed in the previous step, taking safflower Dajinyuan as an example, genetic transformation and tissue culture were performed to obtain plants with NtLNP1 gene knockout edited in tobacco nicotine metabolism. The relevant experimental process is briefly introduced below.

[0085] After surface sterilization, tobacco seeds are sown on MS medium. Once they have grown to 4 cotyledons (15-20 days), they are transferred to culture flasks containing MS solid medium and cultured for 35-40 days at 25±1℃, light intensity of 30-50 μmol / (m2·s), and light duration of 16 h / d.

[0086] The specific steps for transforming the plasmid with the correct sequence into Agrobacterium are as follows:

[0087] ① Take out the LBA4404 electroporation competent Agrobacterium cells stored at -80℃ and freeze-thaw them on ice.

[0088] ②When the competent cells have just thawed, add 2μL of the CRISPR / Cas9-NtLNP1 editing vector plasmid, mix well, and place on ice.

[0089] ③ Transfer the mixed competent cells to a pre-cooled electroporation vessel, place the electroporation vessel in an electroporator for transformation, and after transformation, add 1 mL of YEB liquid medium to mix with the transformation solution, and then place it in a shaker at 28℃ and 200 rpm for 1.5-2 h.

[0090] ④ Centrifuge the culture medium at 8,000 rpm, discard the supernatant, then suspend the bacterial cells in 200 μL of YEB liquid medium, spread them on YEB solid medium containing 50 mg / L rifampicin, 50 mg / L streptomycin and 50 mg / L kanamycin, and incubate in the dark at 28°C for 2-3 days.

[0091] (2) Infection of callus tissue

[0092] ① In a clean bench, tobacco leaf discs were prepared into square discs with a side length of 1 cm. Agrobacterium colonies containing the CRISPR / Cas9-NtLNP1 editing vector were prepared into a suspension (OD) using MS liquid. 600 =0.6-0.8).

[0093] ② Soak tobacco leaf discs in suspended Agrobacterium tumefaciens solution for 10 minutes.

[0094] ③ Place the leaf discs on MS solid medium containing 2.0 mg / L NAA + 0.5 mg / L 6-BA and incubate at 28°C in the dark for 3 days.

[0095] ④ Perform subculture on MS solid medium containing 2.0 mg / L NAA + 0.5 mg / L 6-BA + 250 mg / L Cb + 50 mg / L Kan.

[0096] The culture conditions were as follows: 28℃ light for 16 h / d (light intensity 30-50 μmol / (m²·s), followed by 25℃ dark culture for 8 h / d, for 45-60 days until differentiated shoots formed. The culture medium was changed every 7-10 days, for a total of 3-4 changes. Once differentiated shoots had formed, the callus tissue with differentiated shoots was excised and cultured on MS medium containing 500 mg / L carbenicillin and 50 mg / L kanamycin. The culture was continued until the differentiated shoots on the callus tissue reached a height of 2-4 cm. The conditions were the same as those for differentiation culture, and the culture lasted for 8-14 days. For rooting culture of regenerated plants, the differentiated buds were cut off and inserted into MS medium containing 500 mg / L carbenicillin and 50 mg / L kanamycin for rooting culture. The culture conditions were the same as those for differentiation culture, and the culture lasted for 20-30 days. After regeneration, the plants were transplanted into flower pots and cultured. Leaf samples were then taken from the transformed plants and sent to BGI Genomics for molecular detection. The detection primers were: upstream primer NtLNP1-F: TGGCATCACGATCGTATCCAG (SEQ ID No. 8) and downstream primer NtLNP1-R: GCGTTGTTTCTTGGTGGAACTT (SEQ ID No. 9).

[0097] Example 4: Obtaining homozygous editing materials

[0098] T0 generation seeds were self-pollinated at a ratio of 23:1 for homozygous propagation. When the plants grew to 5-6 leaves, leaf samples were taken from individual plants and sent to BGI Genomics for molecular detection. The detection primers were: upstream primer NtLNP1-F: TGGCATCACGATCGTATCCAG (SEQ ID No. 8) and downstream primer NtLNP1-R: GCGTTGTTTCTTGGTGGAACTT (SEQ ID No. 9). Plants with homozygous NtLNP1 gene editing were identified, and then seeds were harvested to obtain T1 generation seeds with homozygous NtLNP1 gene editing.

[0099] Example 5: Planting and Characteristic Survey of Materials

[0100] Seeds from plants identified by molecular detection in Example 4 as homozygous knockout of the NtLNP1 gene were propagated in pots. Sixty plants were planted, and the tops were pinched off during the peak flowering period. Seven days after pinching off, plant height, lateral leaf length, lateral leaf width, stem circumference, internode distance, and other trait indicators were measured and analyzed in accordance with the "YCT 142-2010 Methods for Surveying and Measuring Agronomic Traits of Tobacco".

[0101] Seven days after topping, data on plant height, leaf length, leaf width, stem circumference, number of effective leaves, and internode distance were collected from 10 tobacco plants and statistically analyzed.

[0102] The results showed that plants homozygous knockout of the NtLNP1 gene exhibited significant differences in plant height, number of leaves, stem circumference, and internode distance compared to the control, *Hedyotis diffusa*. The length of the lower leaf was significantly shorter than the control, while the width was significantly wider. Another notable characteristic was a change in leaf shape, transforming from oblong to elliptical, exhibiting a shorter and wider profile, with a lower leaf length-to-width ratio of 2.07 (compared to 2.40 in the control). A comparison of the main traits of the control and NtLNP1 gene homozygous tobacco plants is provided. Figure 1 As shown, leaf shape comparison Figure 2 As shown.

[0103] Example 6 GC-MS detection

[0104] Using the edited plants grown in Example 5, the nicotine content of the leaves of the NtLNP1 gene homozygous knockout material was detected by GC-MS 7 days after topping.

[0105] Select tobacco plants 7 days after topping, collect samples from 5 control (unedited) tobacco plants, and collect leaves from the same leaf position; select tobacco plants 7 days after topping, collect samples from 5 tobacco plants with homozygous NtLNP1 gene editing; remove the main vein from the leaves, wrap them in tin foil, preserve and transport them in liquid nitrogen, preserve them in the laboratory at ultra-low temperature (-70℃), freeze-dry, grind into powder and sieve.

[0106] Weigh 0.2 g of sample into a 15 mL centrifuge tube, accurate to 0.1 mg, add 2.0 mL of 5% sodium hydroxide solution, then add 0.05 mL of internal standard solution A (dimethylquinoline solution, prepared in methanol and diluted with dichloromethane to 1.0 mg / mL) and internal standard solution B (2,2'-bipyridine-d2 solution, prepared in methanol and diluted with dichloromethane to 0.5 mg / mL), vortex to mix, let stand for 20 min, then add 10.0 mL of extraction solution (dichloromethane and methanol mixed at a volume ratio of 4:1), seal the tube, and place it in a vortex mixer. Extract by vortexing at 2000 r / min for 40 min, let stand for 1 h, centrifuge for 8 min, transfer the lower organic phase to a chromatographic bottle, and analyze by GC-MS.

[0107] The reference conditions for gas chromatography are as follows: Column: DB-35MS or equivalent capillary column, with dimensions of 30 mm (length) × 0.25 mm (inner diameter) × 0.25 m (film thickness); Injector temperature: 250℃; Column flow rate: 1.0 mL / min; Nicotine injection volume: 1.0 L, split injection, split ratio of 40:1; Other alkaloids injection volume: 2.0 L, split injection, split ratio of 10:1; Temperature program: Initial temperature 100℃, hold for 3 min; Increase to 260℃ at a rate of 8℃ / min, hold for 10 min.

[0108] Mass spectrometry reference conditions: transfer line temperature: 280℃; ionization method: electron impact source (EI); ionization energy: 70eV; ion source temperature: 230℃; solvent delay: 8min; measurement mode: selected ion monitoring (SIM) scan.

[0109] Comparison of nicotine content in leaves of tobacco plants (unedited) and those homozygous edited with the NtLNP1 gene 7 days after topping (results are shown in Table 1).

[0110] The results showed that, through gas chromatography-mass spectrometry (GC-MS), the nicotine content in the leaves of NtLNP1 gene knockout edited plants was significantly lower than that in the control plants 7 days after topping. This provides genetic materials and theoretical basis for the study of the function of genes regulating nicotine metabolism and leaf shape in tobacco, as well as for the breeding of new tobacco varieties.

[0111] Table 1 shows the alkaloid content (μg / g) of fresh tobacco leaves 7 days after topping in the edited plants and the control (unedited) of this invention.

[0112]

[0113] Example 7 Transcriptome Analysis

[0114] Fresh tobacco leaves at the 10th-13th leaf position, collected 7 days after topping, were flash-frozen in liquid nitrogen and sent to a sequencing company for RNA extraction, cDNA library construction, and sequencing. After sequencing, the data needed to be filtered, mainly to remove reads containing adapters, duplications, and low-quality reads, to obtain clean reads. High-quality clean reads are the foundation for downstream analysis. TopHat2 was used to align the clean reads with the cultivated tobacco reference genome (https: / / solgenomics.net / ) to obtain their positional information on the reference genome or genes, as well as sequence characteristics specific to the sequencing samples. TopHat2 is based on the alignment software Bowtie2, which aligns transcriptome sequencing reads to genes and identifies splicing sites between exons by analyzing the alignment results.

[0115] GO (Gene Ontology) functional enrichment analysis was performed on differentially expressed gene sets using clusterProfile software. GO is a comprehensive database describing gene function, which can be divided into three parts: biological process, cellular component, and molecular function. A padj value less than 0.05 was used as the threshold for significant GO enrichment. From the GO enrichment analysis results, the 30 most significant terms were selected to create a bar chart; if fewer than 30 terms were selected, all terms were plotted.

[0116] Transcriptome sequencing of the middle leaves 7 days after topping revealed 3319 differentially expressed genes (DEGs) in tobacco plants homozygous for NtLNP1 compared to the control, including 2516 upregulated genes and 803 downregulated genes. GO and KEGG functional enrichment analyses were performed on the upregulated and downregulated DEGs. In GO enrichment analysis, differentially expressed genes were significantly enriched in 52 GO terms, with "cell periphery," "cell wall," and "external encapsulating structure" showing the highest enrichment in the upregulated DEGs, while "nucleosome," "protein-DNA complex," and "DNA packaging complex" showed the highest enrichment in the downregulated DEGs. In KEGG analysis, "plant-pathogen interaction" was significantly enriched in the upregulated genes, while "Cutin, suberine, and wax biosynthesis," "MAPK signaling pathway-plant," and "Nitrogen metabolism" were significantly enriched in the downregulated genes. Enrichment analysis of DEGs suggests that NtLNP1 may reduce nicotine synthesis by decreasing the biosynthesis of keratin, suberin, and wax, weakening the MAPK cascade, and reducing nitrogen metabolism. Figure 3 , Figure 4 (As shown).

[0117] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various different choices and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention is defined by the claims and their equivalents.

Claims

1. A method for knocking out tobacco NtLNP1 A method for obtaining tobacco with altered leaf shape and low nicotine content through gene therapy, characterized in that... The NtLNP1 The gene sequence is SEQ ID No. 1, and the knockout was performed by knocking out tobacco using the CRISPR / Cas9 system. NtLNP1 The gene, specifically the leaf shape change, is NtLNP1 The root leaf length of the gene-knockout tobacco plant was significantly shorter than that of the control plant, while the root leaf width was wider. The leaf shape changed from oblong to elliptical, and the leaves were shorter and wider, with a smaller length-to-width ratio than the control plant. Simultaneously, the nicotine content in the leaves of the NtLNP1 gene-knockout tobacco plant was lower than that of the control plant 7 days after topping. The method includes the following steps: (1) Design of sgRNA guide sequence and construction of sgRNA expression vector; (2) T0 generation editing material was obtained through genetic transformation; (3) Homozygous editing material was obtained from T0 generation plants through self-pollination; (4) Plant the homozygous unlabeled materials and observe their characteristics.

2. The knockout tobacco according to claim 1 NtLNP1 A method for obtaining tobacco with altered leaf shape and low nicotine content through gene therapy, characterized in that... In step (1), the sgRNA sequence used by the CRISPR / Cas9 system is ATATCCATCCATTCAAGCGATGG, and the primer sequence used for the sgRNA sequence is: Upstream primer sgRNA-F: GATTGATATCCATCCATTCAAGCGA; Downstream primer sgRNA-R: AAACCTCGCTTGAATGGATGGATAT.

3. The tobacco knockout method according to claim 2 NtLNP1 A method for obtaining tobacco with altered leaf shape and low nicotine content through gene therapy, characterized in that... Step (1) is as follows: The sgRNA guide sequence was designed, and the upstream primer sgRNA-F and the downstream primer sgRNA-R were annealed to form a double strand. The CRISPR / Cas9 vector pORE-Cas9 was digested with the restriction endonuclease BsaI-HF. The annealed double-stranded product was ligated to the digested vector backbone using T4 ligase. The ligation product was transformed into competent E. coli cells, positive clones were detected, and recombinant plasmids were extracted to obtain the CRISPR / Cas9-sgRNA expression vector.

4. The knockout tobacco according to claim 1 NtLNP1 A method for obtaining tobacco with altered leaf shape and low nicotine content through gene therapy, characterized in that... Step (2) is as follows: Tobacco leaf discs were infected by soaking Agrobacterium LBA4404 bacterial culture carrying the CRISPR / Cas9-sgRNA expression vector, and T0 generation plants were obtained. Target editing detection yielded… NtLNP1 T0 generation seeds were obtained from the genetically edited plants.

5. The knockout tobacco according to claim 1 NtLNP1 A method for obtaining tobacco with altered leaf shape and low nicotine content through gene therapy, characterized in that... Step (3) is as follows: T0 generation seeds were self-pollinated homozygous and propagated. After target editing detection, the desired results were obtained. NtLNP1 Plants with homozygous gene editing yield T1 generation seeds.

6. A knockout tobacco according to any one of claims 1-5 NtLNP1 Application of genetic methods for obtaining tobacco with altered leaf shape and low nicotine content in the creation of new tobacco varieties with altered leaf shape and low nicotine content.