A heparinase mutant, its recombinant expression method and applications
By performing two rounds of error-prone PCR mutations on the heparinase gene of Raoultella sp.NX-TZ-3-15, a heparinase mutant with an activity increase of 150% was obtained, which solved the problem of insufficient heparinase activity and stability in the prior art, and significantly improved the expression and activity of the enzyme.
Patent Information
- Application Number
- CN202211357794.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-01
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2042-11-01
AI Technical Summary
In the prior art, the production level of heparinase is low, and the obtained heparinase has poor solubility, stability and activity, which limits the technological development of enzymatic preparation of low molecular weight heparin.
By combining CepPCR and Megawhop PCR technology, two rounds of error-prone PCR mutations were performed on the heparinase gene sequence of Raoultella sp.NX-TZ-3-15, and the mutant strain H2-8 was obtained, and its heparinase activity was 150% higher than that of wild type.
The activity of the mutant heparinase is significantly improved, and the activity and expression amount of heparinase are significantly improved, which solves the shortcomings of heparinase activity and stability in the prior art.
Smart Images

Figure CN116218827B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering technology, and particularly relates to a heparinase mutant, a recombinant expression method thereof, and an application thereof. Background Art
[0002] Heparin is a sulfated glycosaminoglycan composed of iduronic acid and glucuronic acid, belonging to mucopolysaccharides, with a molecular weight of about 14,000 Da. It has functions such as anticoagulation and antithrombosis. Low-molecular-weight heparin has a smaller average molecular weight, about 5,000 Da, compared with unfractionated heparin. More importantly, its antithrombotic effect is better than that of heparin, and it has advantages such as good subcutaneous injection absorption, high bioavailability, long in vivo half-life, and low bleeding tendency. Existing methods for preparing low-molecular-weight heparin include chemical depolymerization method, physical preparation method, and biological enzyme method. Among them, the chemical depolymerization method mainly uses nitrite to break the heparin glycosidic bond; the physical preparation method mainly uses ultrasonic degradation. However, both the chemical method and the physical method generally have problems such as high preparation cost, low efficiency, high production cost, poor controllability in the degradation process, easy damage to heparin active functional groups, poor product homogeneity, and easy residue of reagents in the manufacturing process. Relatively speaking, the preparation of low-molecular-weight heparin by biological enzyme method can avoid environmental pollution problems and has a higher yield. Therefore, the enzymatic degradation technology using heparinase to prepare low-molecular-weight heparin is a current research hotspot in the field of preparing low-molecular-weight heparin.
[0003] Heparinase is a mucopolysaccharide lyase that can cleave heparin or heparan sulfate molecules into small molecules. Among the heparinase-producing bacteria studied currently, the most common one is Flavobacterium heparinum. In the past ten years or so, it has developed to include Bacteroides heparinolyticus, Corynebacterium sp., Bacillus circulans, Bacteroides eggerthii, Sphingobacterium sp., Bacteroides stercoris HJ-15, and Sphingomonas sanguinis. However, in the prior art, there are still problems with the production of heparinase, such as relatively low production level, and the obtained heparinase generally has poor solubility, stability, and activity, which greatly limits the development of the technology for preparing low-molecular-weight heparin by enzymatic method. Summary of the Invention
[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a heparinase mutant with high heparinase activity.
[0005] The present invention provides a heparinase mutant, which is obtained by mutating the heparinase based on the nucleotide sequence of Raoultella sp. NX-TZ-3-15 shown in SEQ ID NO.1, and the mutation sites are P10R, V45A, V101I, I108V, I138T, S142P, I153T, L160P, G180S, A195T.
[0006] The present invention also provides a gene encoding the above mutant, and the nucleotide sequence of the gene is SEQ ID NO: 2.
[0007] The present invention also provides a recombinant expression vector of the above gene.
[0008] Preferably, the vector plasmid includes pEAS-1b and PRHis-MBP.
[0009] The present invention also provides a genetically engineered bacterium containing the above gene or the above recombinant expression vector.
[0010] Preferably, the host cell of the genetically engineered bacterium includes Escherichia coli BL21.
[0011] The present invention also provides a method for producing heparinase, using the above genetically engineered bacterium as a production strain to induce fermentation for producing heparinase.
[0012] Preferably, IPTG with a concentration of 0.4 - 0.6 mM is added to the production strain culture with an OD 600 of 0.6 - 0.8.
[0013] Preferably, the induction fermentation temperature is 25 - 35 °C, and the induction fermentation time is 11 - 13 h.
[0014] The present invention also provides the application of the above heparinase mutant in the chemical industry or pharmaceutical field.
[0015] Compared with the prior art, the beneficial effects of the technical solution of the present invention are as follows:
[0016] By combining CepPCR and Megawhop PCR techniques, the present invention performs two rounds of error-prone PCR mutations on the wild-type heparinase gene sequence, obtaining two mutant strains with determined mutant sequences, namely H 1-6 and H 2-8 . The heparinase expressed by the mutant strains H 1-6 and H 2-8 after mutation both have an increased number of amino acid residues binding to the active site, improving the enzyme activity. Among them, the heparinase of the mutant strain H 2-8 after mutation has an enzyme activity 150% higher than that of the wild-type heparinase.
[0017] The mutant gene of the mutant strain H 2-8 obtained by directed evolution can be ligated with a vector to construct an E. coli BL21(DE3)PRHis-MBP-H 2-8 engineering bacterium. Through IPTG induction optimization experiments on the successfully constructed engineering bacterium, both the enzyme activity and the enzyme expression level of the induced Escherichia coli are significantly improved. Description of the Drawings
[0018] Figure 1 : Agarose gel electrophoresis imaging results of the first-round CepPCR products;
[0019] Figure 2 : Gel electrophoresis diagram of the first-round Megawhop PCR products;
[0020] Figure 3 : Agarose gel electrophoresis imaging results of the second-round CepPCR products;
[0021] Figure 4 : Gel electrophoresis diagram of the second-round Megawhop PCR products;
[0022] Figure 5 : Agarose gel electrophoresis diagram of the colony PCR products after the first-round mutation;
[0023] Figure 6 : Agarose gel electrophoresis diagram of the colony PCR products after the second-round mutation;
[0024] Figure 7 : Monoclonal colony diagram;
[0025] Figure 8 : Heparin standard curve;
[0026] Figure 9 : Repeated detection of enzyme activity of the first-round mutant strains;
[0027] Figure 10 : Repeated detection of enzyme activity of the second-round mutant strains;
[0028] Figure 11 : Three-dimensional model of heparinase and molecular docking active site diagram of the lowest binding energy;
[0029] Figure 12 : Gel electrophoresis diagram of the PCR of the PRHis-MBP-H 2-8 bacterial liquid;
[0030] Figure 13 : Gel electrophoresis diagram of the double digestion of the PRHis-MBP-H 2-8 plasmid;
[0031] Figure 14 : SDS-PAGE analysis diagram;
[0032] Figure 15 : Diagram of the relationship between the induction timing and enzyme activity;
[0033] Figure 16 : Diagram of the relationship between the concentration of inducer IPTG and enzyme activity;
[0034] Figure 17 : Diagram of the relationship between the induction temperature and enzyme activity;
[0035] Figure 18 : Relationship diagram between induction time and enzyme activity;
[0036] Figure 19 : SDS-PAGE diagram of induction time. Detailed implementation manners
[0037] The present invention provides a heparinase mutant, which is obtained by mutating on the basis of the heparinase with the nucleotide sequence of Raoultella sp. NX-TZ-3-15 shown in SEQ ID NO.1, and the mutation sites are P10R, V45A, V101I, I108V, I138T, S142P, I153T, L160P, G180S, A195T.
[0038] The heparinase gene sequence of Raoultella sp. NX-TZ-3-15 described in the present invention is shown in SEQ ID NO.1, and the heparinase amino acid sequence is shown in SEQ ID NO:16.
[0039] The present invention also provides a gene encoding the above mutant, and the nucleotide sequence of the gene is SEQ ID NO:2. The heparinase mutant (H 2-8 ) has an amino acid sequence shown in SEQ ID NO:18.
[0040] The mutant gene of the heparinase mutant in the present invention is obtained by performing two rounds of error-prone PCR mutagenesis on the heparinase gene sequence of Raoultella sp. NX-TZ-3-15 by combining CepPCR and Megawhop PCR technologies. By the first round of error-prone mutagenesis, a strain H 1-6 with higher enzyme activity is obtained. Using the heparinase gene sequence of strain H 1-6 as a template, a strain H 2-8 with even higher enzyme activity is obtained by the second round of error-prone mutagenesis. The heparinase mutant described in the present invention is the heparinase expressed by the mutated strain H 2-8 , and the mutant gene is the heparinase gene sequence of the mutated strain H 2-8 .
[0041] The present invention also provides a recombinant expression vector of the above gene. Preferably, the vector plasmid includes pEAS-1b, PRHis-MBP. The present invention ligates the mutated H 2-8 gene onto the vector plasmid for the construction of a genetically engineered bacterium with high heparinase activity.
[0042] The present invention also provides a genetically engineered bacterium of the above gene or the above recombinant expression vector. Preferably, the host cell of the genetically engineered bacterium includes Escherichia coli BL21.
[0043] The present invention also provides a method for producing heparinase, using the above-mentioned genetically engineered bacterium as the production strain, and inducing fermentation to produce heparinase. The genetically engineered bacterium of the present invention can be cultured in LB medium at 28-32 °C. The induced fermentation of the present invention is preferably: to the production strain culture with an OD 600 of 0.6-0.8, add 0.4-0.6 mM IPTG, and induce fermentation at 25-35 °C for 11-13 h. More preferably, the OD 600 is 0.7, the added concentration of IPTG is 0.5 mM, and the induced fermentation time is 12 h.
[0044] The present invention also provides the application of the above heparinase mutant in the chemical industry or pharmaceutical field. The application is preferably to prepare low-molecular-weight heparin.
[0045] Next, the technical solutions in the present invention will be clearly and completely described in conjunction with the embodiments in the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention.
[0046] Example 1
[0047] Using the Raoultella sp. NX-TZ-3-15 genome as a template, design primer pairs H1-SF-Sac I: TCGACGAGCTCGATGCGGATGAAGCAGTATTTG (as shown in SEQ ID NO: 3), H1-SR-Xba I: GCTGCTCTAGATTATCCATGACTAACCTTTGCT (as shown in SEQ ID NO: 4), perform PCR amplification, and introduce the restriction enzyme site sequences of Sac I and Xba I at both ends of the target gene H1 (as shown in SEQ ID NO: 1). Insert the obtained gene H1 into the middle of the two restriction enzyme sites of Sac I and Xba I of the pEAS-1b plasmid to obtain the recombinant plasmid pEAS-1b-H1.
[0048] Example 2
[0049] 1. One-round CepPCR
[0050] Using the plasmid pEAS-1b-H1 obtained in Example 1 as a template, primer pairs were designed according to the target gene H1. The target gene H1 was divided into three fragments, where the P1 fragment was 220 bp in length, the P2 fragment was 220 bp in length, and the P3 fragment was 244 bp in length. Primer pairs were designed according to the three gene fragments, and each group of primer pairs was subjected to CepPCR amplification to obtain mutant gene fragments. The primer sequences are shown in Table 1. The CepPCR amplification reaction system is shown in Table 2, and the CepPCR amplification reaction procedure is shown in Table 3.
[0051] Table 1 Primer Sequences
[0052]
[0053] The H1-F1 sequence is as shown in SEQ ID NO:5; the H1-R1 sequence is as shown in SEQ ID NO:6; the H1-F2 sequence is as shown in SEQ ID NO:7; the H1-R2 sequence is as shown in SEQ ID NO:8; the H1-F3 sequence is as shown in SEQ ID NO:9; the H1-R3 sequence is as shown in SEQ ID NO:10.
[0054] Table 2 CepPCR Amplification Reaction System
[0055]
[0056] Table 3 CepPCR Amplification Reaction Procedure
[0057]
[0058] The above CepPCR products were detected and analyzed by agarose gel electrophoresis. The specific operations are as follows:
[0059] (1) Weigh 0.5 g of agarose and add it to 50 mL of 1×TAE solution. Heat it in a microwave oven for 1 min to ensure that the agarose is fully dissolved to obtain a transparent and clear solution. After cooling to 50 - 60 °C at room temperature, add 5 μL of 10000×Gel Red nucleic acid stain, shake well, pour it into the gel plate, insert the comb, and remove any bubbles in time. Let it stand at room temperature until the gel solution is completely solidified.
[0060] (2) After the gel solidifies, gently pull out the comb, place the gel in an electrophoresis tank filled with 1×TAE solution, with the sample wells facing the negative electrode.
[0061] (3) Pipette and mix 5 μL of the sample with 1 μL of 6×Loading Buffer, and then pipette 5 μL of the mixed sample into the sample well. Adjust the voltage to 120 V and perform electrophoresis at room temperature for 20 min. After electrophoresis, place the gel block in a gel imaging system to observe, photograph, and image. The results are shown in Figure 1 .
[0062] Figure 1 Lanes 1 to 5 are the electrophoresis results of CepPCR products with template P1 added, lanes 6 to 10 are the results of CepPCR products with template P2 added, and lanes 11 to 5 are the results of CepPCR products with template P3 added. The three groups are divided into three groups according to the template added. The lanes in each group from left to right are the results of adding Mn 2+ The concentrations are 0.10, 0.30, 0.50, 0.70, and 0.90 (all in mM). The leftmost lane is the DNA marker. Figure 1 It can be seen that P1 adds Mn 2+ The concentration range should be 0.10~0.30mM, P2 adds Mn 2+ The concentration range should be 0.10~0.50mM, P3 adds Mn 2+ The concentration range should be 0.10-0.30 mM. In summary, 0.30 mM was selected as the final concentration of the CepPCR system.
[0063] The CepPCR product was recovered using TaKaRa MiniBEST DNA Fragment Purification Kit Ver.4.0. 2+ The CepPCR purified products with P1, P2, and P3 as templates at a concentration of 0.3 mM were used as large primers for Megawhop PCR amplification reactions. The reaction system is shown in Table 4, and the reaction procedure is shown in Table 5.
[0064] Table 4 Megawhop PCR reaction system
[0065]
[0066] Table 5 Megawhop PCR reaction program
[0067]
[0068] The annealing temperature of the P1 fragment was 72°C, the annealing temperature of the P2 fragment was 57.5°C, and the annealing temperature of the P3 fragment was 61.1°C. The obtained Megawhop PCR products were detected by agarose gel electrophoresis. The results are shown in Figure 2 .Depend on Figure 2 It can be seen that the DNA length of the amplified product is about 6000-7500 bp. It is known that the size of pEAS-1b-H1 is about 6000 bp, which is consistent with the size of the band in the figure. It is preliminarily judged that the amplification was successful.
[0069] 2. Second round of CepPCR mutation
[0070] Using the mutant plasmid in the Megawhop PCR product (named pEAS-1b-H 1-6 ) as a template, the error-prone gene sequence obtained was divided into two fragments, named P4 and P5 respectively (where the length of the P4 fragment is 440 bp, the length of the P5 fragment is 460 bp, and there is a 208-bp base repeat between the two), and primer pairs were designed at both ends of the two gene fragments, and CepPCR amplification was performed to obtain the mutant heparinase gene fragment. The primer pair sequences are shown in Table 6, the CepPCR amplification reaction system is shown in Table 7, and the CepPCR amplification reaction program is shown in Table 3.
[0071] Table 6 Primer Sequences
[0072]
[0073] The sequence of H1-F4 is as shown in SEQ ID NO:11; the sequence of H1-R4 is as shown in SEQ ID NO:12; the sequence of H1-F5 is as shown in SEQ ID NO:13; the sequence of H1-R5 is as shown in SEQ ID NO:14.
[0074] Table 7 CepPCR Amplification Reaction System
[0075]
[0076] The CepPCR product was detected and analyzed by agarose gel electrophoresis, and the results are shown in Figure 3 . Lane 1 shows the electrophoresis result of the CepPCR product with P4 as the template added, lane 2 shows the electrophoresis result of the CepPCR product with P5 as the template added, and the leftmost lane is the DNA marker. Figure 3 It shows that two genes of about 400 bp can be synthesized. The CepPCR product was used as a primer in the Megawhop PCR system for whole plasmid high-fidelity amplification. The reaction system is shown in Table 4, and the reaction program is shown in Table 5. The annealing temperature of the P4 and P5 fragments is 58°C. The Megawhop PCR product obtained was detected and analyzed by agarose gel electrophoresis, and the results are shown in Figure 4 .
[0077] From Figure 4 it can be seen that the DNA length of the amplification product is greater than 5000 bp. Given that the size of pEAS-1b-H1 is about 6000 bp, which is consistent with the band in the figure, so it is initially judged that the amplification was successful.
[0078] 3. Transformation of E. coli Top10 Competent Cells
[0079] Take the first-round Megawhop PCR products and the second-round Megawhop PCR products that passed the verification and perform DpnI digestion on them respectively. The digestion system is shown in Table 8:
[0080] Table 8 DpnI digestion system
[0081]
[0082] The DpnI digestion procedure is as follows: 37°C for 2.5 h, 85°C for 30 min, 4°C ∞. Take 1 μL of the digested product and transform it into E. coli Top10 competent cells by heat shock. The specific experimental operation is carried out according to the instruction manual of E. coli Top10 competent cells. Spread every 100 μL of the transformed bacterial liquid evenly on a solid LB medium containing ampicillin resistance, and culture it in a constant temperature biochemical incubator at 30°C for 12 - 17 h, and observe the colony growth situation.
[0083] Randomly select more than a dozen single colonies from the solid LB medium and suspend them in 20 μL of ultrapure water. Heat at 95°C for 5 min and centrifuge for 1 min. The supernatant contains the plasmids released by high-temperature lysis of the cells and can be used as the template for colony PCR. Use the pEAS-1b-H1 plasmid as the positive control to verify the positive transformation rate. The colony PCR system (10 μL) is shown in Table 9, and the colony PCR procedure is shown in Table 10:
[0084] Table 9 Colony PCR system
[0085]
[0086] Table 10 Colony PCR procedure
[0087]
[0088]
[0089] Detect and analyze the colony PCR products by agarose gel electrophoresis. The results of the first-round mutation are shown in Figure 5 The length of the positive control H1 gene fragment is 684 bp. In lanes 1 - 13 of the experimental group, there are 12 bands with the same length as that in lane 14 of the positive control, indicating that the heparinase mutant library was successfully constructed, and the positive rate is about 92.3%, meeting the requirements for library construction. The results of the second-round mutation are shown in Figure 6 The length of the positive control H1 gene fragment is 684 bp. In lanes 1 - 10 of the experimental group, there are 7 bands with the same length as that in lane 10 of the positive control, indicating that the heparinase mutant library was successfully constructed, and the positive rate is about 78%, meeting the requirements for library construction.
[0090] 4. Transform E. coli BL21 competent cells
[0091] In a laminar flow hood, the solid medium plate with colonies grown in step 3 was eluted with LB liquid medium (containing ampicillin resistance), and the eluate was collected in a sterilized centrifuge tube. The plasmid was extracted according to the method of the plasmid extraction kit. All the plasmids were transformed into E. coli BL21 competent cells. The transformation method was in accordance with the instruction manual of E. coli BL21 competent cells. Then the bacterial solution was spread on a solid LB medium containing ampicillin resistance and cultured in a constant temperature incubator at 30 °C for 12 - 17 hours. After a large number of single colonies of E. coli BL21-pEAS-1b-H1 mutants grew, the solid medium was stored in a 4 °C refrigerator waiting for subsequent picking and activation culture.
[0092] Figure 7 -A shows the colony growth of E. coli BL21 after the first-round mutation. Figure 7 -B shows the colony growth of E. coli BL21 after the second-round mutation. It can be seen that the number of monoclonal colonies obtained after the second-round mutation is less than that after the first-round mutation. Each single colony was picked from the solid culture dish with a sterilized toothpick and placed in a 96-deep well culture plate for activation culture.
[0093] 5. Mutant culture and induction expression
[0094] (1) Open the sterilized sealed 96-deep well plate in a sterile workbench. Add 1 mL of liquid LB medium with 100 μg / mL Amp resistance to each well. Pick about 1000 single colonies of E. coli BL21-pEAS-1b-H1 mutants with a sterilized toothpick into the liquid medium and seal it with a sterile sealing film. The culture temperature is 30 °C and the rotation speed is 700 rpm for overnight activation culture.
[0095] (2) Induction expression: Add 1 mL of liquid LB medium with 100 μg / mL Amp resistance to each 96-deep well plate. Inoculate the bacterial solution into a new 96-deep well plate at an inoculation amount of 2% in the same order. Place it in a constant temperature shaker and culture at 30 °C and 700 rpm. When its OD 600 value is 0.70 - 0.80, add IPTG to make the final concentration of IPTG in the system 0.25 mM, and continue the induction culture for 9 h.
[0096] (3) Preparation of crude enzyme solution: After the IPTG induction expression is completed, place the 96-deep well plate in a 37 °C water bath for cell autolysis reaction. After 0.5 h, the crude enzyme solution is obtained.
[0097] 6. Determination of enzyme activity for high-throughput screening
[0098] 100 μL of crude enzyme solution + 25 μL of heparin solution (dissolve 0.025 g of heparin sodium standard in 1 mL of 0.25 M sodium acetate - 0.0025 M calcium acetate buffer solution), mix well and incubate at 30 °C for 15 min. Add 1 mL of 0.002% Azure A to each well of a 96-deep well plate for standby. Immediately after the 15-min incubation of the crude enzyme solution with heparin, take 1 μL of the crude enzyme solution - heparin mixture and add it to 1 mL of 0.002% Azure A solution. After thoroughly pipetting and mixing, take 200 μL / well and add it to a 96-well microplate, and measure the absorbance values at 620 nm - 15 min. Select the data with larger absorbance values. After primary screening, there are about 20 mutant bacteria with potentially better enzyme activity than the wild-type strain in each round. Initially, 23 strains are selected for the first round of secondary screening, and 15 are selected for the second round of secondary screening.
[0099] 7. Enzyme Activity Detection of Mutant Strains with Excellent Enzyme Activity
[0100] (1) Cultivation and Induction Expression of Mutant Strains: In a laminar flow hood, add 10 mL of LB medium containing ampicillin resistance (100 μg / mL Amp resistance) to each sterilized conical flask, inoculate the screened mutant strains with excellent enzyme activity at an inoculation amount of 2%, place them in a constant temperature shaker, and culture at 30 °C and 200 rpm until the OD 600 value reaches 0.70 - 0.80, then add IPTG to make the final concentration of IPTG 0.25 mM, and place it back in the constant temperature incubator and induce culture at the same temperature and rotation speed for 9 h.
[0101] After the induction culture is completed, place the conical flask in a preheated 37 °C water bath for lysis reaction. After 0.5 h of reaction, crude enzyme solution is obtained by thermal self-lysis.
[0102] (2) Determination of Heparin Standard Curve: Dilute the 4.0% heparin sodium solution with ultrapure water to prepare 1 mL of heparin sodium standard solutions with concentrations of 0.10%, 0.20%, 0.30%, 0.40%, and 0.50% (w / v). Take 6 test tubes, add 5 mL of 0.002% Azure A solution to each of them. Add 5 μL of ultrapure water to one test tube as a blank control, and add 5 μL of 0.10 - 0.50% heparin sodium standard solutions to the other test tubes in sequence. After thoroughly pipetting and mixing, take 200 μL and add it to a 96-well microplate, and measure the absorbance values at 620 nm in an enzyme microplate reader (take the average value of 3 parallel samples). The standard curve is shown in Figure 8 .
[0103] (3) Determination of quasi-enzyme activity: 200 μL of crude enzyme solution + 50 μL of heparin solution (0.025 g of heparin sodium standard dissolved in 1 mL of 0.25 M sodium acetate - 0.0025 M calcium acetate buffer solution). After thorough mixing, incubate at 30 °C for 15 min. Then immediately take 5 μL of the crude enzyme solution and add it to 5 mL of 0.002% Azure A solution. After thorough mixing, take 200 μL / well and add it to a 96-well plate (make 3 parallel samples and take the average value). Measure the absorbance values at 620 nm - 0 min and 620 nm - 15 min, and calculate the enzyme activity.
[0104] Calculation formula for enzyme activity: From the standard curve, the heparin content (μg) at different times in the whole system can be obtained. The difference in heparin content at two different times is the heparin degradation amount during this period.
[0105] Enzyme activity (U / L) = [heparin degradation amount (μg) during a period of time × 10 -3 ÷ [time (h) × 200 (μL) × 10 -6
[0106] Figure 9 The following are the enzyme activity data of the excellent mutants selected after the preliminary screening of the error-prone PCR mutants in one round. 1-1 is the wild-type strain of heparinase. Among the crude enzyme solutions obtained by lysing seven randomly mutated strains, namely 1-4, 1-5, 1-6, 1-9, 1-11, 1-22, and 1-23, all have significantly higher enzyme activities than the original strain. Among them, the strain with the highest enzyme activity is 1-6, with an enzyme activity of 3726 U / L, which is strain H 1-6 , showing a 97.6% increase compared to the enzyme activity of the wild-type strain, which is 1886 U / L.
[0107] Figure 10 The following are the enzyme activity performance data of the excellent mutant strains after the second round of error-prone mutation. The enzyme activity of strain 2-8 is the highest, reaching 4747 U / L, which is strain H 2-8 , and the error-prone PCR template is strain H 1-6 with the highest enzyme activity among the mutant strains in the first round, showing an approximately 150% increase in enzyme activity compared to the wild-type strain.
[0108] 8. Amino acid alignment of mutants
[0109] Send the obtained strain H 1-6 and strain H 2-8 to Aike Biosequencing Company for sequencing to obtain the heparinase gene sequences of the mutant strains. The heparinase gene sequence of strain H 2-8 is shown as SEQ ID NO:2; the heparinase gene sequence of strain H 1-6 is shown as SEQ ID NO:15.
[0110] The gene sequence was converted into an amino acid sequence using Snapgene software, and then the original heparinase amino acid sequence was aligned using Clustal Omega software (http: / / www.ebi.ac.uk / Tools / msa / clustalo / ). The original heparinase amino acid sequence is shown in SEQ ID NO:16, H 1-6 The heparinase amino acid sequence of the strain is shown in SEQ ID NO:17, H 2-8 The heparinase amino acid sequence of the strain is shown in SEQ ID NO:18. H 1-6 Amino acid sequence mutation sites of heparin expressed by the mutant heparinase of the strain: V45A, L160P. H 2-8 The strain is in H 1-6 Based on the strain, 7 new mutation sites were added, and all the mutation sites are: P10R, V45A, V101I, I108V, I138T, S142P, I153T, L160P, G180S, A195T.
[0111] 9. Homology Modeling and Molecular Docking
[0112] After obtaining the target gene sequence of the mutant strain by sequencing, the protein structure models of wild-type heparinase and mutant heparinase were simulated using the online software Alphafold (https: / / alphafold.com / ). The binding energy between the heparinase protein and heparin molecule was calculated using AutoDock software (https: / / autodock.scripps.edu / ). Then, the hydrogen bonds connecting the heparinase protein and heparin molecule were drawn using Pymol software (https: / / pymol.org / 2 / ).
[0113] Figure 11 It is the conformational diagram with the smallest docking binding energy of each heparinase molecule and the substrate, Figure 11 -A is wild-type heparinase, the minimum docking binding energy is -5.7 kcal / mol, and its root mean square deviation is 0.83; Figure 11 -B is H 1-6 Heparinase, the minimum docking binding energy is -3.4 kcal / mol, and its root mean square deviation is 0.73; Figure 11 -C is H 2-8 Heparinase, the minimum docking binding energy is -5.2 kcal / mol, and its root mean square deviation is 0.69. A root mean square deviation value less than 2 can be considered an effective docking.
[0114] The AutoDock results show that the potential binding sites of all configurations are the heparinase of wild-type H1: SER14, ASP179, VAL182, SER202, ALA203. Mutant H1-6 : SER11, ASP38, GLY146, GLY149, ASP179, GLY181, VAL182, VAL199, GLY201, SER202. Mutant H 2-8 : SER14, GLY146, PHE147, GLY149, ASP179, SER180, GLY181, VAL199, GLY201, SER202, ALA203. It can be seen that the mutant heparinase protein has more potential amino acid residues for substrate binding compared to the wild-type heparinase protein. And the number of hydrogen bonds formed between amino acid residues and small molecules is an important factor in measuring the binding ability between the two.
[0115] For the mutant H with the highest enzyme activity 2-8 perform mutation site analysis:
[0116] Proline at position 10 → Arginine: The isoelectric point of arginine is 10, while that of proline is 6.
[0117] Valine at position 45 → Alanine: The differences in isoelectric point and hydrophilicity of the mutated amino acid are not very large, but there are significant differences in the spatial structure: the side chain group of the amino acid changes from methyl to isopropyl, and the volume of the side chain group increases a lot. The influence of steric effect is an important reason for the increase in enzyme activity after this amino acid mutation.
[0118] Valine at position 101 → Isoleucine: The side chain group of the amino acid changes from methyl to isopropyl, and the volume of the side chain group increases a lot. The influence of steric effect is an important reason for the increase in enzyme activity after this amino acid mutation.
[0119] Isoleucine at position 138 → Threonine, isoleucine at position 153 → Threonine, glycine at position 180 → Serine, alanine at position 195 → Threonine: The hydrophilicity of the amino acids increases after mutation.
[0120] Serine at position 142 → Proline; at position 160: leucine → proline: Proline is a secondary amino acid with a heterocyclic ring, and the Cα-N bond within the ring cannot rotate. If proline appears in the secondary structure of a protein, the α-helix will be interrupted, and the mutation at this site may largely change the protein structure.
[0121] Example 3
[0122] 1. Take the cryopreserved recombinant Escherichia coli E.coli BL21(DE3)-pEAS-1b-H obtained in step 4 of Example 2 from the -80 °C refrigerator 2-8The glycerol tube was thawed at room temperature in a laminar flow hood. A small amount of bacterial liquid was picked up with an inoculation loop and streaked on an LB plate containing 100 μg / mL Amp resistance, and then cultured overnight in an incubator at 30 °C. A single colony grown on the plate was picked and inoculated into 10 mL of LB medium containing 100 μg / mL Amp resistance, and cultured at 30 °C and 200 rpm for 16 - 18 h. 1.5 mL of the bacterial liquid was added to an EP tube and centrifuged at 10000 rpm for 1 min to remove the LB medium. The plasmid was extracted using Omega's Plasmid Mini Kit ID6943. The specific experimental operations refer to the instruction manual of Omega's Plasmid Mini Kit ID6943. The extracted plasmid was stored at -20 °C for future use.
[0123] 2. Introduce restriction enzyme sites
[0124] Restriction enzyme site sequences of Xho I and BamHI were introduced at both ends of the target gene H 2-8 . According to the design principle of PCR primers, primers H 2-8 -R-Xho I: CGCGGATCCATGCGGATGAAGCA GTATTTGATTGCCCTT (the sequence is shown in SEQ ID NO:19) and H 2-8 -F-BamH I: CCGCTCGAGTTATCCATGACTAACCTTTGC (the sequence is shown in SEQ ID NO:20) were designed.
[0125] The PCR reaction system is shown in Table 11. The whole experimental operation process was carried out on ice. First, ddH2O was added, and the template and Primer Start high-fidelity DNA polymerase were added last to prevent the polymerase from starting to react or inactivate. The PCR reaction program was: pre-denaturation at 98 °C for 1 min, denaturation at 98 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 10 s, total extension at 72 °C for 5 min, and finally cooled to 4 °C for storage, with a total of 30 cycles.
[0126] Table 11 PCR reaction system
[0127]
[0128] 3. Take the above PCR product and verify it by agarose gel electrophoresis. The specific method is the same as in Example 2. After successful verification, the remaining product was recovered using TaKaRa MiniBEST DNA Fragment Purification Kit Ver.4.0. The specific experimental operations refer to the instruction manual of the kit.
[0129] 4. Digest the purified PCR amplification product and the vector plasmid PRHis-MBP with the restriction endonucleases Xho I and BamH I. The double digestion reaction system is shown in Table 12, and incubate in a water bath at 37°C for 2 h.
[0130] Table 12 Double digestion reaction system
[0131]
[0132] Digest the target gene H 2-8 and the digested products of the vector plasmid by agarose gel electrophoresis in a large lane. Place it in an electrophoresis gel fluorescence analyzer, cut the gel with the DNA band with fluorescence at the corresponding position, and then use Omega's Gel Extraction Kit D2500 for gel extraction and recovery. The specific experimental operation can be found in the kit instruction manual.
[0133] 5. Ligate the target gene H 2-8 and the product recovered by gel extraction after digestion of the vector plasmid with T4 ligase. The ligation system is shown in Table 13, and the ligation condition is overnight ligation at 16°C, followed by inactivation of the enzyme at 85°C for 10 min.
[0134] Table 13 Composition table of ligation system
[0135]
[0136] 6. Transform the above ligation product into E. coli TOP 10 competent cells. The specific experimental operation can be found in the instruction manual of E. coli TOP 10 competent cells. Spread the transformed bacterial solution on a solid medium with ampicillin resistance and culture it in a constant temperature biochemical incubator at 37°C. Observe whether resistant colonies grow after about 16 h.
[0137] Pick 5 of the above transformed monoclonal colonies and inoculate them into 10 mL of LB liquid medium with ampicillin resistance. Culture overnight at 37°C and 200 rpm for 12 h, and observe whether the bacteria grow. Take 20 μL of the above bacterial solution, centrifuge and resuspend it with ddH2O, place it in a water bath at 95°C for heat lysis and use it as a template for PCR verification. The PCR system is shown in Table 14, and the PCR reaction conditions are the same as in step 2.
[0138] Table 14 PCR reaction system
[0139]
[0140]
[0141] Take 5 μL of the PCR product and run agarose gel electrophoresis. The results are shown in Figure 12 . Figure 12Colonies No. 1, 4, and 5 can amplify the heparinase target gene band at around 700 bp. Therefore, colonies No. 1, 4, and 5 were verified by double digestion. The plasmids of colonies No. 1, 4, and 5 were digested with restriction enzymes according to the system shown in Table 11. The results are shown in Figure 13 . It can be seen from Figure 13 that the plasmid of colony No. 1, PRHis-MBP-H 2-8 , can be double-digested with Xho I and BamHI to separate the target gene and the vector into two fragments. The vector size is about 2100 bp, and the target gene size is about 700 bp. This indicates that the cloning of colony No. 1 was successful, and the plasmid can be transferred into the competent cell E. coli BL21(DE3) with expression function.
[0142] 7. After the recombinant was successfully verified, the verified recombinant plasmid PRHis-MBP-H 2-8 was transformed into the competent cell E. coli BL21(DE3) according to the transformation method in step 4 of Example 2 to obtain the recombinant engineering bacterium E. coli BL21(DE3)PRHis-MBP-H 2-8 . A single colony with a larger diameter was picked and added to 10 mL of LB medium, and cultured overnight at 30 °C and 200 rpm. Subsequently, 200 μL of the overnight cultured seed liquid was aspirated with a pipette and added to 2 new 10 mL of LB medium, and the sample was taken for OD measurement with an enzyme-labeling instrument after culturing for 3 h at 37 °C and 200 rpm 600 at about 0.7, and IPTG with a final concentration of 0.25 mM was added, and induced to culture for 16 h at 30 °C and 200 rpm. The wild bacterium H1 and the mutant strain H 2-8 were used as controls. After the induction was completed, the supernatant was removed by centrifugation at 8000 rpm, an equal volume of calcium acetate buffer was added, and the cells were lysed using a cell ultrasonic disruptor (20%, 3 s on, 3 s off, 5 min) to obtain a relatively clear crude enzyme solution. After centrifugation at 7800 rpm, the supernatant was the crude enzyme solution.
[0143] Take 20 μL of the protein sample (crude enzyme solution) for loading and 5 μL of the protein loading buffer into a PCR tube, and mix well. Boil it in a water bath for 5 - 10 min to denature the protein, and perform SDS-PAGE verification on the recombinant plasmid. The specific experimental steps are shown in "Molecular Cloning Guide", and the results are shown in Figure 14 . (M: protein Marker; 1: H1 bacterial solution; 2: H1 supernatant; 3: H1 precipitate; 4: H 2-8 bacterial solution; 5: H 2-8 supernatant; 6: H 2-8 precipitate; 7: PRHis-MBP-H 2-8 supernatant; 8: PRHis-MBP-H2-8 Precipitation; 9: PRHis-MBP-H 2-8 bacterial solution). From Figure 14 it can be seen that the target protein H 2-8 is about 25KDa. From the SDS-PAGE protein gel, it can be seen that the expression protein amounts of the wild-type bacterial solution and the mutated bacterial solution are very small at 25KDa. After inserting the MBP soluble tag, the expression protein amount increases significantly, and most of them are in the supernatant after the bacterial solution is broken, indicating that MBP enhances the soluble expression of the heparinase gene. And for MBP-H 2-8 after inserting the MBP soluble tag, the expression protein amount is about 60KDa, and a small amount of protein is mainly expressed in the supernatant.
[0144] Example 4
[0145] E.coli BL21(DE3)PRHis-MBP-H 2-8 Optimization of the induction expression conditions of the recombinant engineering bacteria: For all experiments, 3 parallel samples were made for each experiment for data processing and analysis.
[0146] 1. Optimization of the induction timing: The overnight cultured bacterial solution was inoculated into LB medium (containing 100 μg / mL Amp resistance) at an inoculation amount of 2%, and cultured at 37°C and 200 rpm. IPTG was added to a final concentration of 0.25 mM when the OD 600 value of the bacterial solution reached about 0.5, 0.6, 0.7, 0.8, 0.9, and induced at 30°C and 200 rpm for 12 h, and then the enzyme activity was measured. The results are shown in Figure 15 .
[0147] From Figure 15 it can be seen that as the culture time of E.coli BL21(DE3)PRHis-MBP-H 2-8 recombinant engineering bacteria increases, the density of the bacterial solution also increases. When the OD 600 value of the bacterial solution reaches about 0.7 and IPTG is added, the highest heparinase enzyme activity is finally obtained. The reason may be that when the culture time is too short, the bacteria are in the initial logarithmic growth phase and the cell density is low. Adding the inducer IPTG at this time will inhibit the growth of the cells, thus affecting the expression level of the target protein in the later stage; while when the culture time is too long, the bacteria are in the stationary phase. Although they have a high biomass, the bacterial cells have already started to age at this time, resulting in a decrease in their ability to synthesize the target protein and a decrease in enzyme activity. Therefore, it is best to add the inducer when the OD 600 value is 0.7.
[0148] 2. Optimization of the inducer IPTG concentration: The overnight cultured bacterial solution was inoculated into LB medium (containing 100 μg / mL Amp resistance) at an inoculation amount of 2%, and cultured at 37°C and 200 rpm until the OD600 was about 0.7, and then IPTG was added to a final concentration of 0.10 mM, 0.25 mM, 0.50 mM, 0.75 mM, 1.0 mM respectively. After inducing culture at 30 °C and 200 rpm for 12 h, the enzyme activity was measured. The results are shown in Figure 16 .
[0149] It can be seen from Figure 16 that the induction expression ability of IPTG below 0.25 mM is insufficient. When it reaches 0.50 mM IPTG, the enzyme activity reaches the peak; then the enzyme activity decreases with the increase of IPTG concentration. The growth differences of bacteria under different concentrations of IPTG are not significant, and the OD 600 is about 1.55 in all cases. Therefore, 0.50 mM IPTG has the best induction effect on E. coli BL21(DE3)PRHis-MBP-H 2-8 . Too high or too low concentration of IPTG is not conducive to the active expression of heparinase.
[0150] 3. Optimization of induction temperature: The overnight cultured bacterial solution was inoculated into LB medium (containing 100 μg / mL Amp resistance) at an inoculation amount of 2%, and cultured at 37 °C and 200 rpm until the OD 600 was about 0.7. Then IPTG was added to a final concentration of 0.25 mM, and the induction culture was carried out at 15 °C, 20 °C, 25 °C, 30 °C and 200 rpm for 12 h, and then the enzyme activity was measured. The results are shown in Figure 17 .
[0151] It can be seen from Figure 17 that the higher the induction temperature, the higher the OD 600 of the bacterial solution and the heparinase enzyme activity. After reaching 35 °C, it reaches a plateau, indicating that within 15 - 30 °C, the higher the temperature, the more conducive to the growth and active expression of E. coli. After the temperature reaches 35 °C, the OD 600 of the bacterial solution and the heparinase enzyme activity also show a slow downward trend. Moreover, it can be clearly seen from the figure that the heparinase activity trend is similar to the growth density of the bacterial solution, indicating that when only the culture temperature is the only variable, the greater the growth density of the bacterial solution, the more likely it is an important reason for the greater enzyme activity shown by the heparinase in it.
[0152] 4. Optimization of induction time: The overnight cultured bacterial solution was inoculated into LB medium (containing 100 μg / mL Amp resistance) at an inoculation amount of 2%, and cultured at 37 °C and 200 rpm until the OD 600 was 0.7. Then IPTG was added to a final concentration of 0.25 mM, and the induction culture was carried out at 30 °C and 200 rpm for 8 h, 12 h, 16 h, 20 h, 24 h, and then the enzyme activity was measured. The results are shown in Figure 18 . The SDS-PAGE procedure was carried out according to the description in Example 3, and the results are shown in Figure 19。
[0153] It can be seen from Figure 18 that as the induction time becomes longer, the OD of the bacterial solution 600 also increases accordingly, indicating that Escherichia coli is still growing after the addition of IPTG, and the toxicity of IPTG has little effect. The enzyme activity of heparinase shows an increasing trend in the range of 8 - 12 h, and shows a downward trend after 12 h, which is opposite to the bacterial growth curve. Analysis of the reasons for this phenomenon in the enzyme activity curve: (1) The toxicological effect of IPTG on bacteria is not greatly affected during the process of bacterial division and proliferation, but is more affected in the internal protein expression of bacteria. (2) After the constant temperature culture at 30 °C exceeds 15 h, the temperature may cause the protein expressed by bacteria to be inactivated. Therefore, the optimal induction duration of E. coli BL21(DE3)PRHis-MBP-H 2-8 after the addition of IPTG is 12 h.
[0154] It can be seen from Figure 19 that the molecular weight of MBP-H 2-8 is about 60 KDa, and there are obvious protein bands in the range of 8 - 12 h in its expression level. However, the protein band at the 60 KDa position gradually becomes blurred after 12 h, indicating that the heparinase protein with the MBP tag may be easily degraded when placed at 30 °C for a long time. The molecular weight of H 2-8 is about 25 KDa. Within 8 - 20 h, as the culture time becomes longer and the bacterial solution concentration becomes larger, the expression level of the heparinase protein is higher; however, the protein expression level of heparinase slightly degrades after 24 h of induction culture.
[0155] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A heparinase mutant, characterized in that, The amino acid sequence of the heparinase mutant is shown in SEQ ID NO:
18.
2. Use of the heparinase mutant according to claim 1 in the chemical industry or the pharmaceutical field, characterized in that, The application is for the preparation of low molecular weight heparin.
Citation Information
Patent Citations
Heparinase mutant H1-6 as well as engineering strain and application thereof
CN115927277A