An expression vector and its construction and application in DU145 cell line

Abstract

The present invention relates to the field of biotechnology, and particularly to an expression vector of recombinant human sterol O-acyltransferase 1, a method for constructing the vector, and an expression method. The present invention designed appropriate primers for sterol O-acyltransferase 1 and amplified the cDNA, and constructed a lentiviral vector containing the above cDNA by fusing the His6-strep-EGFP tag. Specifically, it includes obtaining the full length of the sterol O-acyltransferase 1 gene, constructing the pCDH-His6-strep-EGFP-sterol O-acyltransferase 1 plasmid, packaging the virus, infecting the cells with the virus, then screening with puromycin, and obtaining a stable overexpressing DU145 cell line of SOAT1 after amplification.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a recombinant human sterol O-acyltransferase 1 expression vector, a vector construction method and an expression method. Technical Background

[0002] Prostate cancer is one of the most common malignant tumors in men, with high morbidity and mortality, posing a serious threat to men's health. In my country, the annual incidence of prostate cancer is increasing year by year. Although early diagnosis and treatment measures have been improved, the prognosis of patients with advanced prostate cancer is still poor. Therefore, the exploration of the occurrence and development mechanism of prostate cancer has always been the focus of scientific researchers, which is of great significance for improving the diagnosis and treatment of tumors.

[0003] Cholesterol is an important molecule in animals. It is an important component of cell membranes and a precursor of many steroid hormones. It is also involved in many signaling pathways. Excessive free cholesterol in cells is harmful to cells, so mammalian cells have evolved a sophisticated mechanism to regulate the content of free cholesterol. Excess free cholesterol in cells will be acylated in the endoplasmic reticulum and stored in the form of hydrophobic cholesterol esters. This process is catalyzed by sterol O-acyltransferase (SOAT). In the human body, SAOT is encoded by two genes: SOAT1 and SOAT2. SOAT1 is widely expressed in various tissues, while SOAT2 is mainly expressed in the liver and digestive tract. A large amount of work suggests that SOAT is an important target for diseases such as atherosclerosis, Alzheimer's disease and certain cancers.

[0004] Sterol O-acyltransferase 1 (SOAT1) is located in the endoplasmic reticulum and is a 9-transmembrane protein with poor protein stability. Simply overexpressing sterol O-acyltransferase cannot stably express in cells. Cholesterol esters are commonly accumulated in prostate cancer tissues, so constructing a sterol O-acyltransferase 1 vector and expressing it in prostate cancer cells is of great significance for studying the occurrence and development mechanism of prostate cancer. Summary of the invention

[0005] The purpose of the present invention is to provide a recombinant human sterol O-acyltransferase 1 expression vector, a vector construction method and an expression method in view of the deficiencies in the prior art.

[0006] The present invention designs suitable primers for sterol O-acyltransferase 1 and amplifies and obtains cDNA, and then fuses His 6 -strep-EGFP tag was used to construct a lentiviral vector containing the above cDNA. 6-strep-EGFP-sterol O-acyltransferase 1 plasmid was constructed, virus was packaged, cells were infected with virus, and then puromycin was selected and amplified to obtain DU145 cell line with stable overexpression of SOAT1.

[0007] The advantages of the present invention are: (1) The present invention constructs an overexpression lentiviral vector for sterol O-acyltransferase 1, and the effect test confirms that the lentiviral vector of the present invention can significantly increase the expression of sterol O-acyltransferase 1 protein. In view of the fact that sterol O-acyltransferase 1 is a potential target for the treatment of prostate cancer, the sterol O-acyltransferase 1 expression vector and stable cell line constructed by the present invention are helpful for studying the mechanism of action of sterol O-acyltransferase 1 in the development of prostate cancer. (2) The present invention stably expresses sterol O-acyltransferase 1 in prostate cancer cells for the first time, and the stable cell line is conducive to further studying the occurrence and development mechanism of prostate cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 :The result of agarose gel electrophoresis after cDNA amplification by PCR;

[0009] Figure 2 :To fuse His 6 -Results of agarose gel electrophoresis after strep-EGFP fragment;

[0010] Figure 3 : is the eukaryotic expression vector pCDH-CMV-MCS-EF1-puro;

[0011] Figure 4 : Western blot results of the expression of sterol O-acyltransferase 1 in DU145 cells transfected with empty vector and sterol O-acyltransferase 1 expression plasmid;

[0012] Figure 5 : Western blot results of the expression of sterol O-acyltransferase 1 in DU145 cells infected with empty vector and sterol O-acyltransferase 1 expression vector virus;

[0013] Figure 6 : Immunofluorescence results of DU145 cells infected with sterol O-acyltransferase 1 expression vector virus. DETAILED DESCRIPTION

[0014] The present invention is further described with reference to examples, which are intended to illustrate the present invention but not to limit the present invention.

[0015] Example 1 Construction of recombinant human sterol O-acyltransferase 1 expression vector

[0016] (1) Obtain the cDNA sequence of human sterol O-acyltransferase 1 from NCBI; the CDS sequence of human sterol O-acyltransferase 1 is the nucleotide sequence shown in Sequence Table 1

[0017] (2) designing primers to amplify the cDNA, and recovering the target fragment after identification by gel electrophoresis;

[0018] Justice chain: ATGGTGGGTGAAGAGAAGAT

[0019] Antisense strand: TCAAAACACGTAACGACAAG

[0020] The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The total polymerase chain reaction system for amplifying cDNA sequences was as follows: 1 μl of cDNA from DU145 cells as template, 1 μl of sense strand, 1 μl of antisense strand, 2×ApexHF HS DNA Polymerase FL Master Mix 25 μl (#AG12207, Accurate Biotechnology), and ddH 2 O to 50μl. The reaction conditions were: 94℃ pre-denaturation for 1min; 98℃ denaturation for 10s, 60℃ annealing for 15s, 72℃ extension for 90s, 35 cycles; 72℃ extension for 5min. The polymerase chain reaction product was analyzed by 1% agarose gel electrophoresis, and the band of the target fragment at about 1653bp was cut and the target fragment was recovered using a gel recovery kit (#28704, Qiagen).

[0021] (3) Design primers to fuse His at the N-terminus 6 -strep-EGFP fragment

[0022] Justice Chain:

[0023] ATTCTAGAGCTAGCGAATTCGCCACCATGCATCATCACCATCACCATAG

[0024] Antisense strand:

[0025] GCCGCGGATCCGATTTAAATTCAAAACACGTAACGACAAG

[0026] According to the literature "Structural insights into the inhibition mechanism of humansterol O-acyltransferase 1 by a competitive inhibitor", adding His to the N-terminus of SOAT1 7-strep-GFP fragment can make SOAT1 stably expressed. Primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. Fusion tag fragment His 6 The -strep-EGFP sequence is shown in Sequence Table 2 (synthesized by Shanghai Shenggong Biotechnology Co., Ltd.), the fusion fragment sequence is shown in Appendix 3, and the total polymerase chain reaction system is: 1 μl of DNA recovered in (2), 1 μl of fusion tag fragment, 1 μl of sense strand, 1 μl of antisense strand, 2×ApexHF HS DNA Polymerase FL Master Mix 25 μl (#AG12207, Accurate Biotechnology), and ddH 2 O to 50μl. The reaction conditions were: 94℃ pre-denaturation for 1min; 98℃ denaturation for 10s, 60℃ annealing for 15s, 72℃ extension for 90s, 35 cycles; 72℃ extension for 5min. The polymerase chain reaction product was analyzed by 1% agarose gel electrophoresis, and the band of the target fragment at about 2500bp was cut and the target fragment was recovered using a gel recovery kit (#28704, Qiagen).

[0027] (4) Vector linearization

[0028] The pCDH-CMV-MCS-EF1-puro vector was digested with EcoRI (#FD0274, ThermoFisher) and Smil (#FD1244, ThermoFisher), and the linearized vector plasmid was recovered by gel electrophoresis. The restriction enzyme system is shown in Table 2:

[0029] pCDH-CMV-MCS-EF1-puro 1 μg EcoRI 1μl Smil 1μl 10X FD buffer 2μl Add ddH2O to 20 μl

[0030] After incubation at 37°C for 2 hours, the linearized vector was recovered using a gel recovery kit (#28704, Qiagen) and eluted with 50 μl of elution buffer.

[0031] (5) Recombination and transformation

[0032] The fusion fragments were recombined with the linearized vectors recovered by enzyme digestion using ClonExpress II One Step Cloning Kit (C112-01, Vazyme), and the system is shown in Table 3:

[0033]

[0034]

[0035] After incubation at 37°C for 30 minutes, add 50μl DH5α chemical competent cells (#11802ES80, YEASEN), ice bath for 30 minutes, heat shock at 42°C for 90 seconds, and then quickly ice bath for 2 minutes. Add LB medium to the centrifuge tube to 1ml, shake at 220rpm in a 37°C shaker for 1 hour, take 100μl of the transformed competent cells and evenly spread them on LB agarose medium containing 100μg / ml ampicillin (A8180, Solarbio), and invert and culture at 37°C for 12-16 hours. Select 2 single clones and inoculate them in 3ml LB medium for culture. Take 1ml of bacterial liquid from each and send it to Sangon Biotech Co., Ltd. for sequencing to verify the correctness of the inserted sequence. The sequencing primer is CMV-F, and the sequence is as follows: CGC AAA TGG GCG GTA GGC GTG. Results: Figure 1 This is the result of agarose gel electrophoresis after cDNA amplification by PCR; Figure 2 To fuse His 6 -Results of agarose gel electrophoresis after strep-EGFP fragment; Figure 3 The eukaryotic expression vector pCDH-CMV-MCS-EF1-puro

[0036] Example 2 Efficiency verification and virus packaging of pCDH-CMV-MCS-EF1-SOAT1

[0037] (1) DU145 cells were inoculated in a 6 cm dish. When the cell confluence reached 30%, the original culture medium was discarded and 2 ml of 10% FBS DMEM (#C11885500BT, Invitrogen) culture medium was added. The dish was then placed at 37°C and 5% CO. 2in an air incubator. Take out four 1.5ml ep tubes, add 0.25ml OPTI-MEM (#31985070, Invitrogen) culture medium to each, and then mix the transfection system. Add 4μg of pCDH-CMV-MCS-EF1-puro or pCDH-CMV-MCS-EF1-SOAT1 to two tubes respectively, and add 8μl of transfection reagent Lipofectamine2000 to the other two tubes, and let stand for 5 minutes. Add the mixed plasmid to Lipofectamine2000 and mix well. After standing at room temperature for 20 minutes, add it dropwise to the cells. After 6 hours of transfection, replace the culture medium with 2ml of DMEM culture medium containing 10% FBS by volume. After 48 hours of culture, extract the protein according to the literature "BRD4 Promotes Gastric Cancer Progression and Metastasis through Acetylation-Dependent Stabilization of Snail", and use Western-blot to verify the expression efficiency.

[0038] (2) HEK-293T cells were inoculated into 6-well plates. When the cell confluence reached 70-80%, the original culture medium was discarded and 2 ml of 10% FBS DMEM (#C11885500BT, Invitrogen) culture medium was added. The plates were then placed at 37°C and 5% CO. 2 in an air incubator. Take out four 1.5ml ep tubes, add 0.125ml OPTI-MEM (#31985070, Invitrogen) culture medium to each, and then mix the transfection system. Add 11μg of pCDH-CMV-MCS-EF1-puro or pCDH-CMV-MCS-EF1-SOAT to two of the tubes, add 0.75μg of packaging plasmid psPAX2 (#VT1444, youbio), add 0.25μg of packaging plasmid pMD2.G (#VT1443, youbio), and add 5μl of transfection reagent Lipofectamine2000 to the other two tubes and let stand for 5 minutes. Add the mixed plasmid to Lipofectamine2000 and mix well. After leaving it at room temperature for 20 minutes, add it dropwise to the cells. After 6h of transfection, replace the culture medium with 2ml of DMEM culture medium containing 10% FBS. The virus solution was collected 24 hours and 48 hours after transfection, filtered with a 0.45 μm filter membrane to remove impurities and bacteria, and stored at -80°C for future use.

[0039] result, Figure 4Western blot of the expression of sterol O-acyltransferase 1 in DU145 cells transfected with empty vector and sterol O-acyltransferase 1 expression plasmid.

[0040] Example 3 pCDH-CMV-MCS-EF1-SOAT1 virus infects DU145 cells

[0041] DU145 cells were plated in a six-well plate one day in advance. When the cell fusion rate was 30%, the original culture medium was discarded and 1 ml of 10% FBS DMEM culture medium (#C11885500BT, Invitrogen) and 1 ml of virus solution were added. 1 ml of 10% DMEM culture medium was added 24 hours after infection. After 48 hours of infection, the culture medium containing puromycin (ant-pr-1, InvivoGen) was replaced for screening. The concentration of puromycin was 2 μg / ml. The DU145 cell lines stably expressing SOAT1 (pCDH-CMV-MCS-EF1-SOAT1) and the control group (pCDH-CMV-MCS-EF1-puro) were obtained after continuous screening until all wild-type cells were killed. Proteins were extracted according to the method in Example 2, and the expression efficiency was verified by Western-blot. At the same time, DU145 cells stably expressing SOAT1 were inoculated onto cell slides, stained with 1 μg / ml DAPI (#C1002, Beyotime) at room temperature for 5 minutes, and sealed with anti-fluorescence quenching sealing solution (#P0126, Beyotime).

[0042] result, Figure 5 Western blot of sterol O-acyltransferase 1 expression in DU145 cells infected with empty vector and sterol O-acyltransferase 1 expression vector virus; Figure 6 This is the immunofluorescence result of DU145 cells infected with sterol O-acyltransferase 1 expression vector virus.

[0043] Sequence Listing

[0044] Sequence Listing 1

[0045] Sequence characteristics

[0046] *Length: 1653 bp

[0047] *Type: cDNA

[0048] *Chain type: Single chain

[0049] SOAT1 CDS sequence

[0050]

[0051] Sequence Listing 2

[0052] Sequence characteristics

[0053] *Length: 818 bp

[0054] *Type: cDNA

[0055] *Chain type: Single chain

[0056] Fusion Tag His 6 -strep-EGFP sequence

[0057] CATCATCACCATCACCATAGCAGCGGCTGGAGCCACCCGCAGTTCGAGAAAGGTTCTGGTTCTGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGGGGTGGAGGCTCTATGGTGGGTGAAGAGAAGAT

[0058] Sequence Listing III

[0059] Sequence Features

[0060] * Length: 2500 bp

[0061] * Type: cDNA

[0062] * Strand: Single-stranded

[0063] Fusion sequence

[0064] Sequence Listing <110> Dalian Institute of Chemical Physics, Chinese Academy of Sciences <120> An expression vector and its construction and application in DU145 cell line <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1653 <212> DNA <213> Artificial Sequence <400> 1 atggtgggtg aagagaagat gtctctaaga aaccggctgt caaagtccag ggaaaatcct 60 gaggaagatg aagaccagag aaaccctgca aaggagtccc tagagacacc tagtaatggt 120 cgaattgaca taaaacagtt gatagcaaag aagataaagt tgacagcaga ggcagaggaa 180 ttgaagccat tttttatgaa ggaagttggc agtcactttg atgattttgt gaccaatctc 240 attgaaaagt cagcatcatt agataatggt gggtgcgctc tcacaacctt ttctgttctt 300 gaaggagaga aaaacaacca tagagcgaag gatttgagag cacctccaga acaaggaaag 360 atttttattg caaggcgctc tctcttagat gaactgcttg aagtggacca catcagaaca 420 atatatcaca tgtttatattgc cctcctcatt ctctttatcc tcagcacact tgtagtagat 480 tacattgatg aaggaaggct ggtgcttgag ttcagcctcc tgtcttatgc ttttggcaaa 540 tttcctaccg ttgtttggac ctggtggatc atgttcctgt ctacattttc agttccctat 600 tttctgtttc aacattgggc cactggctat agcaagagtt ctcatccgct gatccgttct 660 ctcttccatg gctttcttt catgatcttc cagattggag ttctaggttt tggaccaaca 720 tatgttgtgt tagcatatac actgccacca gcttccccggt tcatcattat attcgagcag 780 attcgttttg taatgaaggc ccactcattt gtcagagaga acgtgcctcg ggtactaaat 840 tcagctaagg agaaatcaag cactgttcca atacctacag tcaaccagta tttgtcttc 900 ttatttgctc ctacccttat ctaccgtgac agctatccca ggaatcccac tgtaagatgg 960 ggttatgtcg ctatgaagtt tgcacaggtc tttggttgct tttctatgt gtactacatc 1020 tttgaaaggc tttgtgcccc cttgtttcgg aatatcaaac aggagccctt cagcgctcgt 1080 gttctggtcc tatgtgtatt taactccatc ttgccaggtg tgctgattct cttccttact 1140 ttttttgcct ttttgcactg ctggctcaat gcctttgctg agatgttacg ctttggtgac 1200 aggatgttct ataaggattg gtggaactcc acgtcatact ccaactatta tagaacctgg aatgtggtgg tccatgactg gctatattac tatgcttaca aggactttct ctggttttc tccaagagat tcaaatctgc tgccatgtta gctgtctttg ctgtatctgc tgtagtacac 1380 gaatatgcct tggctgtttg cttgagcttt ttctatcccg tgctcttcgt gctcttcatg ttctttgga tggctttcaa cttcattgtc aatgatagtc ggaaaaagcc gatttggat gttctgatgt ggacttctct tttcttgggc aatggagtct tactctgctt ttattctcaa gaatggtatg cacgtcagca ctgtcctctg aaaaatccca catttttgga ttatgtccgg ccacgttcct ggacttgtcg ttacgtgttt tag 1653 <210> 2 <211> 818 <212> DNA <213> Artificial Sequence <400> 2 catcatcacc atcaccatag cagcggctgg agccacccgc agttcgagaa aggttctggt tctggcatgg tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag 120 ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc 180 acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg 240 cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac 300 atgaagcagc acgacttctt caagtccgcc atgcccgag gctacgtcca ggagcgcacc 360 atcttcttca aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac 420 accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacaacagc cacaacgtct atatcatggc cgacaagcag aagaacggca tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag 660. ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct gctgcccgac aaccactacc tgagcaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc gggatcactc tcggcatgga cgagctgtac 780 aaggggggtg gaggctctat ggtgggtga gagagat <210> 3 <211> 2500 <212> DNA <213> Artificial Sequence <400> 3 attctagagc tagcgaattc gccaccatgc atcatcacca tcaccatagc agcggctgga 60 gccacccgca gttcgagaaa ggttctggtt ctggcatggt gagcaagggc gaggagctgt 120 tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc cacaagttca 180 gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg aagttcatct 240 gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg acctacggcg 300 tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc aagtccgcca 360 tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc aactacaaga 420 cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca 480 tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac tacaacagcc 540 acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac ttcaagatcc 600 gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag aacaccccca 660 tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag tccgccctga 720 gcaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg accgccgccg 780 ggatcactct cggcatggac gagctgtaca aggggggtgg aggctctg gtgggtgaag 840 agaagatgtc tctaagaaac cggctgtcaa agtccaggga aaatcctgag gaagatgaag 900 accagagaaa ccctgcaaag gagtccctag agacacctag taatggtcga attgacataa 960 aacagttgat agcaaagaag aaagttga cagcagaggc agaggattg aagccatttt 1020 ttatgaagga agttggcagt cactttgatg atttgtgac caatctcatt gaaagtcag 1080 catcattaga taatggtggg tgcgctca caaccttttc tgttcttgaa ggagagaaaa 1140 acaccatag frequency tttattgcac ctccaacca frequency tttattgca 1200 ggcgctctct cttagatgaa ctgcttgaag tggaccat cagaacaata tatcacatgt 1260 ttattgccct cctcattctc tttatcctca gcacacttgt agtagattac attgatgaag 1320 gaaggctggt gcttgagttc agcctcctgt cttatgctt tggcaattt cctaccgttg 1380 tttggacctg gtgatcatg tctgtcta cattttcag tcctattt ctgttcac 1440 attgggccac tggctatagc aagagttctc atccgctgat ccgttctctc ttccatggct 1500 ttcttttcat gatcttccag attggagttc taggttttgg accaacatat gttgtgttag 1560 catatacact gccaccagct tcccggttca tcattatatt cgagcagatt cgttttgtaa 1620 tgaaggccca ctcatttgtc agagagaacg tgcctcgggt actaaattca gctaaggaga 1680 aatcaagcac tgttccaata cctacagtca accagtattt gtacttctta tttgctccta 1740 cccttatcta ccgtgacagc tatcccagga atcccactgt aagatggggt tatgcgcta 1800 tgaagtttgc acaggtcttt ggttgcttt tctatgtgta ctacatcttt gaaaggcttt 1860 gtgccccct gttcggaat atcaaacagg agcccttcag cgctcgtgtt ctggtcctat 1920 gtgtatttaa ctccatcttg ccaggtgtgc tgattctctt ccttacttttt tttgcctttt 1980 tgcactgctg gctcaatgcc tttgctgaga tgttacgctt tggtgacagg atgttctata 2040 aggattggtg gaactccacg tcatactcca actattatag aacctggaat gtggtggtcc 2100 atgactggct atattactat gcttacaagg actttctctg gttttctcc aagagattca 2160 aatctgctgc catgttagct gtctttgctg tatctgctgt agtacacgaa tatgccttgg 2220 ctgtttgctt gagctttttc tatcccgtgc tcttcgtgct cttcatgttc tttggaatgg 2280 ctttcaactt cattgtcaat gatagtcgga aaaagccgat ttggaatgtt ctgatgtgga 2340 cttctctttt cttgggcaat ggagtcttac tctgctttta ttctcaagaa tggtatgcac 2400 gtcagcactg tcctctgaaa aatcccacat ttttggatta tgtccggcca cgttcctgga 2460 cttgtcgtta cgtgttttag atttaaatcg gatccgcggc 2500

Claims

1. A DU145 cell line stably and highly expressing sterol O-acyltransferase 1, characterized in that: The invention comprises a eukaryotic expression vector pCDH-CMV-MCS-EF1-puro carrying a recombinant human sterol O-acyltransferase 1 sequence; The recombinant human sterol O-acyltransferase 1 expression vector comprises a plasmid selected from the nucleotide sequence shown in Sequence Table 1 or the nucleotide sequence shown in Sequence Table 3; The construction of the recombinant human sterol O-acyltransferase 1 expression vector comprises the following steps: Step 1: design primers, use cDNA of DU145 cells as template, amplify the CDS sequence of human sterol O-acyltransferase 1, and recover the target fragment SOAT1; the CDS sequence of human sterol O-acyltransferase 1 is shown in the nucleotide sequence shown in Sequence Table 1; Step 2: synthesize the His6-strep-EGFP fragment, design primers and obtain the His6-strep-EGFP-SOAT1 fragment by PCR; Step 3: homologously recombining the target fragment His6-strep-EGFP-SOAT1 with the pCDH-CMV-MCS-EF1-Puro plasmid to obtain a recombinant human sterol O-acyltransferase 1 expression vector.

2. The DU145 cell line stably and highly expressing sterol O-acyltransferase 1 according to claim 1, characterized in that: The recombinant human sterol O-acyltransferase 1 expression vector is a plasmid obtained by double digesting the pCDH-CMV-MCS-EF1-Puro plasmid with the first restriction endonuclease EcoRI and the second restriction endonuclease Smil and then inserting the nucleotide sequence shown in Sequence Table 3.

3. The DU145 cell line stably and highly expressing sterol O-acyltransferase 1 according to claim 1, characterized in that: The step 3 is specifically as follows: The pCDH-CMV-MCS-EF1-Puro plasmid was digested with the first and second restriction endonucleases and then treated at 36.7-37 degrees Celsius for 100-120 minutes; The pCDH-CMV-MCS-EF1-Puro plasmid digested with restriction endonuclease and the target fragment were homologously recombined to obtain a recombinant human sterol O-acyltransferase 1 expression vector; The first restriction endonuclease is EcoRI, and the second restriction endonuclease is Smil.

Images