mutants of alpha-n-acetylglucosaminidase

Abstract

The present application relates to a mutant of human alpha-N-acetylglucosaminidase (hNAGLU), and more particularly, to a hNAGLU mutant capable of increasing the expression amount of hNAGLU in a host cell into which a gene encoding hNAGLU is introduced, as compared to when a gene encoding wild-type hNAGLU is introduced, by adding a mutation in the amino acid sequence of hNAGLU. The hNAGLU mutant is, for example, a mutant having the amino acid sequence shown in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 15, or SEQ ID NO: 19, or a mutant having an amino acid sequence in which a mutation is added in these amino acid sequences.

Description

TECHNICAL FIELD

[0001] The present application relates to a mutant of human α-N-acetylglucosaminidase (hNAGLU), and more particularly, to a novel hNAGLU mutant capable of increasing the expression amount of hNAGLU in a host cell into which a gene encoding hNAGLU is introduced, as compared with when a gene encoding wild-type hNAGLU is introduced, by adding a mutation in the amino acid sequence of hNAGLU. BACKGROUND

[0002] Mucopolysaccharidosis type IIIB (MPS-IIIB), which is also known as Sanfilippo syndrome type B, is a genetic disease accompanied by a gene abnormality of α-N-acetylglucosaminidase (NAGLU), an enzyme required for the decomposition of heparan sulfate (HS), one of glycosaminoglycans (GAG), in the lysosome, and is caused by a decrease or absence of enzyme activity. In the case of severe cases, HS is accumulated in various organs including the brain, and severe neurological disorders, tissue disorders, such as cognitive function decline, movement disorders, and the like are observed at around 2 to 6 years of age. In addition, severe mental retardation and motor disease accompanied by rapid progression of central nervous degenerative symptoms are observed, and language ability disappears at 7 to 8 years of age. At the age of the teens, sleep disorders, hepatosplenomegaly, convulsive seizures, and bedridden due to inability to move are observed, and most of them die in their twenties due to respiratory infections and the like.

[0003] In order to supplement the deficient or deficient enzyme in Sanfilippo syndrome type B patients, enzyme supplementation therapy is generally performed. Enzyme α-N-acetylglucosaminidase (NAGLU) has an action of catalyzing the hydrolysis reaction of the non-reducing terminal α-N-acetylglucosamine residue of heparan sulfate, and by being administered to a patient, it can decompose HS accumulated in the lysosome in the patient's body.

[0004] The gene encoding wild-type human NAGLU (hNAGLU) has been isolated in 1995 (Patent Document 1). hNAGLU for enzyme supplementation therapy is a recombinant hNAGLU produced using cells transformed with an expression vector into which a gene encoding the enzyme is integrated.

[0005] PRIOR ART DOCUMENTS

[0006] PATENT DOCUMENTS

[0007] Patent Document 1: Japanese Patent Application Laid-Open No. 2000-500972 SUMMARY

[0008] PROBLEMS TO BE SOLVED BY THE INVENTION

[0009] The present application has an object to provide a novel hNAGLU mutant which is capable of increasing the expression amount of hNAGLU in a host cell into which a gene encoding hNAGLU is introduced, as compared with when a gene encoding wild-type hNAGLU is introduced, by adding a mutation in the amino acid sequence of hNAGLU.

[0010] Method for solving the problem

[0011] In the research directed to the above object, the present inventors have repeatedly conducted intensive studies, and as a result, have found that a host cell into which a gene encoding a hNAGLU mutant which is obtained by changing the amino acid sequence of hNAGLU as described in detail in the present specification is introduced expresses more hNAGLU as compared with a host cell into which a gene encoding wild-type hNAGLU is introduced, thereby completing the present application. That is, the present application includes the following solutions.

[0012] 1. A mutant of human α-N-acetylglucosaminidase (hNAGLU) selected from the group consisting of (1) to (7) below:

[0013] (1) a mutant having the amino acid sequence shown in SEQ ID NO: 3 obtained by substituting lysine at position 36 with glutamic acid and substituting proline at position 37 with serine in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1;

[0014] (2) a mutant having the amino acid sequence shown in SEQ ID NO: 5 obtained by adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1;

[0015] (3) a mutant having the amino acid sequence shown in SEQ ID NO: 9 obtained by substituting glutamine at position 209 with arginine in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1;

[0016] (4) a mutant having the amino acid sequence shown in SEQ ID NO: 11 obtained by substituting glutamic acid at position 228 with lysine in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1;

[0017] (5) a mutant having the amino acid sequence shown in SEQ ID NO: 15 obtained by substituting threonine at position 320 with proline and substituting glutamic acid at position 321 with aspartic acid in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1;

[0018] (6) a mutant having the amino acid sequence shown in SEQ ID NO: 17, which is obtained by substituting serine at position 505 with alanine and isoleucine at position 506 with valine in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1; and

[0019] (7) a mutant having the amino acid sequence shown in SEQ ID NO: 19, which is obtained by substituting serine at position 526 with asparagine and alanine at position 528 with threonine in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1.

[0020] 2. A hNAGLU mutant, which is a mutant of the above-mentioned 1 having the amino acid sequence shown in SEQ ID NO: 3, in which glutamic acid at position 36 and serine at position 37 of the amino acid sequence are retained and a mutation is added, selected from the group consisting of (1'-a) to (1'-h) below:

[0021] (1'-a) an amino acid residue constituting the amino acid sequence is substituted with another amino acid residue, the number of substituted amino acid residues being 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0022] (1'-b) an amino acid residue constituting the amino acid sequence is deleted, the number of deleted amino acid residues being 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0023] (1'-c) the substitution of the above-mentioned 1'-a and the deletion of 1'-b are combined;

[0024] (1'-d) one or two or more amino acid residues are added to the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of added amino acid residues being 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0025] (1'-e) the substitution of the above-mentioned 1'-a and the addition of 1'-d are combined;

[0026] (1'-f) the deletion of the above-mentioned 1'-b and the addition of 1'-d are combined;

[0027] (1'-g) the substitution of the above-mentioned 1'-a, the deletion of 1'-b, and the addition of 1'-d are combined; and

[0028] (1'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0029] 3. An hNAGLU mutant which retains the serine at position 45 of the amino acid sequence shown in SEQ ID NO: 5 in the hNAGLU mutant (1) of the above 1 and is mutated, selected from the group consisting of (2'-a) to (2'-h) below:

[0030] (2'-a) an amino acid residue constituting the amino acid sequence is replaced with another amino acid residue, the number of the replaced amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0031] (2'-b) an amino acid residue constituting the amino acid sequence is deleted, the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0032] (2'-c) the replacement of the above 2'-a and the deletion of 2'-b are combined;

[0033] (2'-d) 1 or more amino acid residues are added in the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0034] (2'-e) the replacement of the above 2'-a and the addition of 2'-d are combined;

[0035] (2'-f) the deletion of the above 2'-b and the addition of 2'-d are combined;

[0036] (2'-g) the replacement of the above 2'-a, the deletion of 2'-b, and the addition of 2'-d are combined; and

[0037] (2'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0038] 4. An hNAGLU mutant which retains the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 in the hNAGLU mutant of the above 1 and is mutated, selected from the group consisting of (3'-a) to (3'-h) below:

[0039] (3'-a) an amino acid residue constituting the amino acid sequence is replaced with another amino acid residue, the number of the replaced amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0040] (3'-b) the amino acid residues constituting the amino acid sequence are deleted, and the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0041] (3'-c) the substitution of the above 3'-a and the deletion of the above 3'-b are combined;

[0042] (3'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, and the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0043] (3'-e) the substitution of the above 3'-a and the addition of the above 3'-d are combined;

[0044] (3'-f) the deletion of the above 3'-b and the addition of the above 3'-d are combined;

[0045] (3'-g) the substitution of the above 3'-a, the deletion of the above 3'-b, and the addition of the above 3'-d are combined; and

[0046] (3'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0047] 5. An hNAGLU mutant which retains the lysine at position 228 of the amino acid sequence shown in SEQ ID NO: 11 in the hNAGLU mutant of the above 1 and has a mutation, and is selected from the group consisting of (4'-a) to (4'-h) below:

[0048] (4'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, and the number of the substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0049] (4'-b) the amino acid residues constituting the amino acid sequence are deleted, and the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0050] (4'-c) the substitution of the above 4'-a and the deletion of the above 4'-b are combined;

[0051] (4'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, and the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0052] (4'-e) combines the substitution of the above 4'-a and the addition of 4'-d;

[0053] (4'-f) combines the deletion of the above 4'-b and the addition of 4'-d;

[0054] (4'-g) combines the substitution of the above 4'-a, the deletion of 4'-b and the addition of 4'-d; and

[0055] (4'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0056] 6. An hNAGLU mutant which retains the proline at position 320 and the aspartic acid at position 321 of the amino acid sequence shown in SEQ ID NO: 15 in the hNAGLU mutant of the above 1 and adds a mutation, selected from the group consisting of (5'-a) to (5'-h) below:

[0057] (5'-a) an amino acid residue constituting the amino acid sequence is substituted with another amino acid residue, the number of the substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0058] (5'-b) an amino acid residue constituting the amino acid sequence is deleted, the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0059] (5'-c) combines the substitution of the above 5'-a and the deletion of 5'-b;

[0060] (5'-d) 1 or 2 or more amino acid residues are added in the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0061] (5'-e) combines the substitution of the above 5'-a and the addition of 5'-d;

[0062] (5'-f) combines the deletion of the above 5'-b and the addition of 5'-d;

[0063] (5'-g) combines the substitution of the above 5'-a, the deletion of 5'-b and the addition of 5'-d; and

[0064] (5'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0065] 7. An hNAGLU mutant which retains alanine at position 505 and valine at position 506 of the amino acid sequence shown in SEQ ID NO: 17 in the hNAGLU mutant of the above 1 and is added with a mutation, selected from the group consisting of (6'-a) to (6'-h) below:

[0066] (6'-a) amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0067] (6'-b) amino acid residues constituting the amino acid sequence are deleted, the number of deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0068] (6'-c) the substitution of the above 6'-a and the deletion of 6'-b are combined;

[0069] (6'-d) 1 or more amino acid residues are added in the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0070] (6'-e) the substitution of the above 6'-a and the addition of 6'-d are combined;

[0071] (6'-f) the deletion of the above 6'-b and the addition of 6'-d are combined;

[0072] (6'-g) the substitution of the above 6'-a, the deletion of 6'-b, and the addition of 6'-d are combined; and

[0073] (6'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0074] 8. An hNAGLU mutant which retains asparagine at position 526 and threonine at position 528 of the amino acid sequence shown in SEQ ID NO: 19 in the hNAGLU mutant of the above 1 and is added with a mutation, selected from the group consisting of (7'-a) to (7'-h) below:

[0075] (7'-a) amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0076] (7'-b) the amino acid residues constituting the amino acid sequence are deleted by 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0077] (7'-c) the substitution of the above 7'-a and the deletion of the above 7'-b are combined;

[0078] (7'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of the added amino acid residues being 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0079] (7'-e) the substitution of the above 7'-a and the addition of the above 7'-d are combined;

[0080] (7'-f) the deletion of the above 7'-b and the addition of the above 7'-d are combined;

[0081] (7'-g) the substitution of the above 7'-a, the deletion of the above 7'-b, and the addition of the above 7'-d are combined; and

[0082] (7'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0083] 9. The hNAGLU mutant according to the above 4, which is selected from the group consisting of (8) to (15) below:

[0084] (8) a hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and a mutation is added, which has the amino acid sequence shown in SEQ ID NO: 25 obtained by substituting the lysine at position 36 with glutamic acid and substituting the proline at position 37 with serine;

[0085] (9) a hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and a mutation is added, which has the amino acid sequence shown in SEQ ID NO: 27 obtained by adding a serine between the leucine at position 44 and the glycine at position 45;

[0086] (10) a hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and a mutation is added, which has the amino acid sequence shown in SEQ ID NO: 29 obtained by substituting the threonine at position 320 with proline and substituting the glutamic acid at position 321 with aspartic acid;

[0087] (11) an hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and a mutation is added, which has the amino acid sequence shown in SEQ ID NO: 31 in which the lysine at position 36 is substituted with glutamic acid, the proline at position 37 is substituted with serine, and a serine is added between the leucine at position 44 and the glycine at position 45;

[0088] (12) an hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and a mutation is added, which has the amino acid sequence shown in SEQ ID NO: 33 in which the valine at position 54 is substituted with isoleucine and the arginine at position 620 is substituted with lysine;

[0089] (13) an hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and a mutation is added, which has the amino acid sequence shown in SEQ ID NO: 35 in which the valine at position 54 is substituted with isoleucine and a serine is added between the leucine at position 44 and the glycine at position 45;

[0090] (14) an hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and a mutation is added, which has the amino acid sequence shown in SEQ ID NO: 37 in which the arginine at position 620 is substituted with lysine and a serine is added between the leucine at position 44 and the glycine at position 45; and

[0091] (15) an hNAGLU mutant in which the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9 is retained and has the amino acid sequence shown in SEQ ID NO: 39 in which the valine at position 54 is substituted with isoleucine, the arginine at position 620 is substituted with lysine, and a serine is added between the leucine at position 44 and the glycine at position 45.

[0092] 10. An hNAGLU mutant in which the arginine at position 209, the glutamic acid at position 36, and the serine at position 37 of the amino acid sequence shown in SEQ ID NO: 25 are retained and a mutation is added to the above-mentioned hNAGLU mutant having the amino acid sequence shown in SEQ ID NO: 9, which is selected from the group consisting of (8'-a) to (8'-h) below:

[0093] (8'-a) one or two of the amino acid residues constituting the amino acid sequence is / are substituted with another amino acid residue(s), the number of the substituted amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0094] (8'-b) one or two of the amino acid residues constituting the amino acid sequence is / are deleted, the number of the deleted amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0095] (8'-c) the substitution of 8'-a and the deletion of 8'-b are combined;

[0096] (8'-d) one or two or more amino acid residues are added to the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0097] (8'-e) the substitution of 8'-a and the addition of 8'-d are combined;

[0098] (8'-f) the deletion of 8'-b and the addition of 8'-d are combined;

[0099] (8'-g) the substitution of 8'-a, the deletion of 8'-b and the addition of 8'-d are combined;

[0100] (8'-h) the amino acid sequence shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more or 99% identity to the amino acid sequence.

[0101] 11. A hNAGLU mutant which retains the arginine at position 210 and the serine at position 45 of the amino acid sequence shown in SEQ ID NO: 27 and incorporates a mutation in the hNAGLU mutant of the above 9, selected from the group consisting of (9'-a) to (9'-h) below:

[0102] (9'-a) one or two of the amino acid residues constituting the amino acid sequence is / are substituted with another amino acid residue(s), the number of the substituted amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0103] (9'-b) one or two of the amino acid residues constituting the amino acid sequence is / are deleted, the number of the deleted amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0104] (9'-c) the substitution of 9'-a and the deletion of 9'-b are combined;

[0105] (9'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0106] (9'-e) the substitution of the above 9'-a and the addition of 9'-d are combined;

[0107] (9'-f) the deletion of the above 9'-b and the addition of 9'-d are combined;

[0108] (9'-g) the substitution of the above 9'-a, the deletion of 9'-b, and the addition of 9'-d are combined;

[0109] (9'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0110] 12. An hNAGLU mutant which retains arginine at position 209, proline at position 320, and aspartic acid at position 321 of the amino acid sequence shown in SEQ ID NO: 29 in the hNAGLU mutant described in the above 9 and adds a mutation, selected from the group consisting of (10'-a) to (10'-h) below:

[0111] (10'-a) an amino acid residue constituting the amino acid sequence is substituted with another amino acid residue, the number of substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0112] (10'-b) an amino acid residue constituting the amino acid sequence is deleted, the number of deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0113] (10'-c) the substitution of the above 10'-a and the deletion of 10'-b are combined;

[0114] (10'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0115] (10'-e) the substitution of the above 10'-a and the addition of 10'-d are combined;

[0116] (10'-f) the deletion of the above 10'-b and the addition of 10'-d are combined;

[0117] (10'-g) a combination of the substitution of 10'-a, the deletion of 10'-b, and the addition of 10'-d described above;

[0118] (10'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0119] 13. An hNAGLU mutant which retains arginine at position 210, glutamic acid at position 36, serine at position 37, and serine at position 45 of the amino acid sequence shown in SEQ ID NO: 31 in the hNAGLU mutant described in the above 9 and adds a mutation selected from the group consisting of (11'-a) to (11'-h) below:

[0120] (11'-a) an amino acid residue constituting the amino acid sequence is substituted with another amino acid residue, the number of the substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0121] (11'-b) an amino acid residue constituting the amino acid sequence is deleted, the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0122] (11'-c) a combination of the substitution of 11'-a and the deletion of 11'-b described above;

[0123] (11'-d) 1 or 2 or more amino acid residues are added in the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0124] (11'-e) a combination of the substitution of 11'-a and the addition of 11'-d described above;

[0125] (11'-f) a combination of the deletion of 11'-b and the addition of 11'-d described above;

[0126] (11'-g) a combination of the substitution of 11'-a, the deletion of 11'-b, and the addition of 11'-d described above;

[0127] (11'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0128] 14. An hNAGLU mutant, which retains arginine at position 209, isoleucine at position 54, and lysine at position 620 of the above-described hNAGLU mutant having the amino acid sequence shown in sequence number 33, and adds a mutation selected from the group consisting of (12'-a) to (12'-h):

[0129] (12'-a) The amino acid residues constituting the amino acid sequence are replaced by other amino acid residues, and the number of replaced amino acid residues is 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0130] (12'-b) The amino acid residues that make up the amino acid sequence are deleted, and the number of deleted amino acid residues is 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0131] (12'-c) combines the above-mentioned substitution of 12'-a and the deletion of 12'-b;

[0132] (12'-d) One or more amino acid residues are added to the amino acid sequence or to the N-terminal or C-terminal side of the amino acid sequence, and the number of added amino acid residues is 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0133] (12'-e) combines the above-mentioned substitution of 12'-a and addition of 12'-d;

[0134] (12'-f) combines the deletion of 12'-b and the addition of 12'-d mentioned above;

[0135] (12'-g) combines the above-mentioned substitution of 12'-a, deletion of 12'-b, and addition of 12'-d;

[0136] (12'-h) shows more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% similarity to this amino acid sequence.

[0137] 15. An hNAGLU mutant, wherein the hNAGLU mutant described in 9 above, having the amino acid sequence shown in sequence number 35, retains arginine at position 210, isoleucine at position 55, and serine at position 45 of the amino acid sequence, and a mutation is added, selected from the group consisting of (13'-a) to (13'-h):

[0138] (13'-a) The amino acid residues constituting the amino acid sequence are replaced by other amino acid residues, and the number of replaced amino acid residues is 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0139] (13'-b) the amino acid residues constituting the amino acid sequence are deleted, and the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0140] (13'-c) the substitution of the above 13'-a and the deletion of the above 13'-b are combined;

[0141] (13'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, and the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0142] (13'-e) the substitution of the above 13'-a and the addition of the above 13'-d are combined;

[0143] (13'-f) the deletion of the above 13'-b and the addition of the above 13'-d are combined;

[0144] (13'-g) the substitution of the above 13'-a, the deletion of the above 13'-b, and the addition of the above 13'-d are combined;

[0145] (13'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0146] 16. A hNAGLU mutant which retains arginine at position 210, lysine at position 621, and serine at position 45 of the amino acid sequence shown in SEQ ID NO: 37 in the hNAGLU mutant described in the above 9 and adds a mutation, and is selected from the group consisting of (14'-a) to (14'-h) below:

[0147] (14'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, and the number of the substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0148] (14'-b) the amino acid residues constituting the amino acid sequence are deleted, and the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0149] (14'-c) the substitution of the above 14'-a and the deletion of the above 14'-b are combined;

[0150] (14'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0151] (14'-e) the substitution of the above 14'-a and the addition of 14'-d are combined;

[0152] (14'-f) the deletion of the above 14'-b and the addition of 14'-d are combined;

[0153] (14'-g) the substitution of the above 14'-a, the deletion of 14'-b, and the addition of 14'-d are combined;

[0154] (14'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0155] 17. An hNAGLU mutant which retains arginine at position 210, isoleucine at position 55, lysine at position 621, and serine at position 45 of the amino acid sequence shown in SEQ ID NO: 39 in the hNAGLU mutant described in the above 9 and adds a mutation, selected from the group consisting of (15'-a) to (15'-h) below:

[0156] (15'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0157] (15'-b) the amino acid residues constituting the amino acid sequence are deleted, the number of deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0158] (15'-c) the substitution of the above 15'-a and the deletion of 15'-b are combined;

[0159] (15'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0160] (15'-e) the substitution of the above 15'-a and the addition of 15'-d are combined;

[0161] (15'-f) the deletion of the above 15'-b and the addition of 15'-d are combined;

[0162] (15'-g) a combination of the substitution of 15'-a, the deletion of 15'-b, and the addition of 15'-d;

[0163] (15'-h) has 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0164] 18. A DNA containing a gene encoding the hNAGLU mutant of any one of the above 1 to 17.

[0165] 19. An expression vector containing the DNA of the above 18.

[0166] 20. A mammalian cell transformed with the expression vector of the above 19.

[0167] 21. A method of producing a hNAGLU mutant, comprising the step of culturing the mammalian cell of the above 20 in a serum-free medium.

[0168] 22. A fusion protein which is a fusion protein of the hNAGLU mutant of any one of the above 1 to 17 and an antibody, wherein the fusion protein is capable of passing through the blood-brain barrier (BBB) by binding of the antibody to a receptor on a brain vascular endothelial cell.

[0169] 23. The fusion protein according to the above 22, wherein the receptor on the brain vascular endothelial cell is selected from the group consisting of an insulin receptor, a transferrin receptor, a leptin receptor, a lipoprotein receptor, and an IGF receptor.

[0170] 24. The fusion protein according to the above 22, wherein the receptor on the brain vascular endothelial cell is a transferrin receptor.

[0171] 25. The fusion protein according to any one of the above 22 to 24, wherein the antibody is any one of a Fab antibody, a F(ab')2 antibody, a F(ab') antibody, a single domain antibody, a single chain antibody, or an Fc antibody.

[0172] 26. The fusion protein according to any one of the above 22 to 25, wherein the hNAGLU mutant is bound to either side of the C-terminal side or the N-terminal side of the light chain of the antibody.

[0173] 27. The fusion protein according to any one of the above 22 to 25, wherein the hNAGLU mutant is bound to either side of the C-terminal side or the N-terminal side of the heavy chain of the antibody.

[0174] 28. The fusion protein according to any one of 22 to 27 above, wherein the hNAGLU mutant binds to either the C-terminal or N-terminal side of the light chain or either the C-terminal or N-terminal side of the heavy chain of the antibody via a linker sequence.

[0175] 29. The fusion protein according to 28 above, wherein the linker sequence consists of 1 to 50 amino acid residues.

[0176] 30. The fusion protein according to 29 above, wherein the linker sequence comprises an amino acid sequence selected from the group consisting of 1 glycine, 1 serine, the amino acid sequence Gly-Ser, the amino acid sequence Ser-Ser, the amino acid sequence Gly-Gly-Ser, the amino acid sequence Gly-Gly-Gly-Gly-Ser shown in sequence number 58, the amino acid sequence Gly-Gly-Gly-Gly-Gly-Ser shown in sequence number 59, the amino acid sequence Ser-Gly-Gly-Gly-Gly shown in sequence number 60, and 1 to 10 amino acid sequences linked together.

[0177] 31. A DNA containing a gene encoding the fusion protein described in any one of 22 to 30 above.

[0178] 32. An expression vector containing the DNA described in 31 above.

[0179] 33. A mammalian cell transformed with the expression vector described in 32 above.

[0180] 34. A method for manufacturing a fusion protein of an hNAGLU mutant and an antibody, comprising culturing the mammalian cells described in 33 above in a serum-free culture medium.

[0181] Invention Effects

[0182] According to the present invention, hNAGLU, which can be administered in the form of enzyme replacement therapy, can be efficiently manufactured using gene recombination technology for the treatment of patients with mucopolysaccharidosis type IIIB. Attached Figure Description

[0183] Figure 1FIGS. 6A and 6B are graphs showing the results of the confirmation experiment based on the expression amount of the hNAGLU mutant according to the present application (Example 6). The vertical axis of the bar graph indicates the fluorescence intensity. (a) shows the pattern of the band corresponding to wild-type hNAGLU or the hNAGLU mutant in SDS-page, and (b) shows the pattern of the band corresponding to wild-type hNAGLU or the hNAGLU mutant in Western blotting. (1) indicates the data of the expression amount of the K36E / P37S hNAGLU mutant, (2) indicates the data of the expression amount of the L44_G45insS hNAGLU mutant, (3) indicates the data of the expression amount of the R129Q hNAGLU mutant, (4) indicates the data of the expression amount of the Q209R hNAGLU mutant, (5) indicates the data of the expression amount of the E228K hNAGLU mutant, (6) indicates the data of the expression amount of the T240V hNAGLU mutant, (7) indicates the data of the expression amount of the T320P / E321D hNAGLU mutant, (8) indicates the data of the expression amount of the S505A / I506V hNAGLU mutant, (9) indicates the data of the expression amount of the S526N / A528T hNAGLU mutant, (10) indicates the data of the expression amount of the D613Q hNAGLU mutant, (11) indicates the data of the expression amount of the H204K hNAGLU mutant, and (12) indicates the data of the expression amount of wild-type hNAGLU.

[0184] Figure 2 FIG. 10 is a graph showing the results of the confirmation experiment based on the expression amount of the hNAGLU mutant according to the present application (Example 10). The vertical axis of the bar graph indicates the amount of the enzyme activity of hNAGLU (nmol / h / 10 6 cells of each hNAGLU mutant. 6Data showing the expression amount of K36E / P37S hNAGLU mutant, (2) data showing the expression amount of L44_G45insShNAGLU mutant, (3) data showing the expression amount of R129Q hNAGLU mutant, (4) data showing the expression amount of Q209R hNAGLU mutant, (5) data showing the expression amount of E228K hNAGLU mutant, (6) data showing the expression amount of T240V hNAGLU mutant, (7) data showing the expression amount of T320P / E321D hNAGLU mutant, (8) data showing the expression amount of S505A / I506V hNAGLU mutant, (9) data showing the expression amount of S526N / A528ThNAGLU mutant, (10) data showing the expression amount of D613QhNAGLU mutant, (11) data showing the expression amount of H204K hNAGLU mutant, (12) data showing the expression amount of wild type hNAGLU. The determination in (1) to (4) was repeated 4 times, and the respective determination values are shown in the graph.

[0185] Figure 3 A graph showing the results of the confirmation experiment of the expression amount of the hNAGLU mutant based on transient expression (Example 16) is shown. The vertical axis of the bar graph indicates the fluorescence intensity. (a) shows the pattern of the band corresponding to wild type hNAGLU or hNAGLU mutant in SDS-page, (b) shows the pattern of the band corresponding to wild type hNAGLU or hNAGLU mutant in protein immunoblotting. (1) data showing the expression amount of wild type hNAGLU, (2) data showing the expression amount of Q209R hNAGLU mutant, (3) data showing the expression amount of K36E / P37S / Q209R hNAGLU mutant, (4) data showing the expression amount of L44_G45insS / Q209R hNAGLU mutant, (5) data showing the expression amount of Q209R / T320P / E321D hNAGLU mutant, (6) data showing the expression amount of K36E / P37S / L44_G45insS / Q209R hNAGLU mutant.

[0186] Figure 4A graph showing the results of the confirmation experiment of the expression amount of the hNAGLU mutant based on the transient expression (Example 16) is shown. The vertical axis of the bar graph indicates the fluorescence intensity. (a) shows the pattern of the band in the SDS-page corresponding to the wild-type hNAGLU or the hNAGLU mutant. (1) shows the data of the expression amount of the wild-type hNAGLU, (2) shows the data of the expression amount of the Q209R hNAGLU mutant, (3) shows the data of the expression amount of the L44_G45insS / Q209R hNAGLU mutant, (4) shows the data of the expression amount of the V54I / Q209R / R620K hNAGLU mutant, (5) shows the data of the expression amount of the L44_G45insS / V54I / Q209R hNAGLU mutant, (6) shows the data of the expression amount of the L44_G45insS / Q209R / R620K hNAGLU mutant, (7) shows the data of the expression amount of the L44_G45insS / V54I / Q209R / R620K hNAGLU mutant, (8) shows the data of the expression amount of the negative control. DETAILED DESCRIPTION

[0187] In the present specification, when referred to simply as "human α-N-acetylglucosaminidase" or "hNAGLU", it includes not only the wild-type hNAGLU consisting of 720 amino acid residues shown in SEQ ID NO: 1, but also hNAGLU mutants corresponding to mutants in which one or more than two amino acid residues are substituted, deleted and / or added with respect to the amino acid sequence shown in SEQ ID NO: 1, as long as they have an enzyme activity capable of decomposing heparan sulfate and the like, and have the function of the wild-type hNAGLU, without intentional distinction. The wild-type hNAGLU is encoded by a gene having the base sequence shown in SEQ ID NO: 2, for example. When the amino acid residues are substituted with other amino acid residues, the number of the substituted amino acid residues is 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2. When the amino acid residues are deleted, the number of the deleted amino acid residues is 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2. In addition, when the amino acid residues are deleted, it can be that the N-terminal amino acid residues are deleted, in which case the number of the deleted amino acid residues is 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2. In addition, these substitutions and deletions of the amino acid residues can be combined.

[0188] The addition of amino acid residues to the amino acid sequence shown in SEQ ID NO: 1 is the addition of one or more amino acid residues to the amino acid sequence of hNAGLU or on the N-terminal side or C-terminal side of the amino acid sequence. The number of amino acid residues added at this time is one to ten, one to five, or one to three, for example, one or two. In addition, the addition of amino acid residues can be combined with substitution, the addition of amino acid residues can be combined with deletion, and the addition of amino acid residues, substitution, and deletion can be combined. A typical wild-type hNAGLU is biosynthesized in a precursor form composed of 743 amino acid residues, and hNAGLU is formed by removing a leader peptide composed of 23 amino acid residues from the N-terminus shown in SEQ ID NO: 67. When an amino acid is added on the N-terminal side of hNAGLU, the amino acid can be an amino acid from the leader peptide. In this case, the amino acid added to the N-terminus is Gly when the amino acid is one, Ala-Gly when the amino acid is two, and Ala-Ala-Gly when the amino acid is two.

[0189] The mutant of hNAGLU in which at least two mutations of the three mutations of substitution, deletion, and addition of amino acids are combined is not limited to the following (i) to (iv), but can be any of the following:

[0190] (i) a mutant having an amino acid sequence formed by 0 to 10 amino acid residues of deletion, 0 to 10 amino acid residues of substitution to other amino acid residues, and 0 to 10 amino acid residues of addition with respect to the amino acid sequence shown in SEQ ID NO: 1;

[0191] (ii) a mutant having an amino acid sequence formed by 0 to 5 amino acid residues of deletion, 0 to 5 amino acid residues of substitution to other amino acid residues, and 0 to 5 amino acid residues of addition with respect to the amino acid sequence shown in SEQ ID NO: 1;

[0192] (iii) a mutant having an amino acid sequence formed by 0 to 3 amino acid residues of deletion, 0 to 3 amino acid residues of substitution to other amino acid residues, and 0 to 3 amino acid residues of addition with respect to the amino acid sequence shown in SEQ ID NO: 1;

[0193] (iv) a mutant having an amino acid sequence formed by 0 to 2 amino acid residues of deletion, 0 to 2 amino acid residues of substitution to other amino acid residues, and 0 to 2 amino acid residues of addition with respect to the amino acid sequence shown in SEQ ID NO: 1.

[0194] hNAGLU also includes hNAGLU in which the amino acid constituting the above-mentioned wild type or mutant hNAGLU is modified by a sugar chain. hNAGLU also includes hNAGLU in which the amino acid constituting the above-mentioned wild type or mutant hNAGLU is modified by a phosphate. hNAGLU also includes hNAGLU in which the amino acid constituting the above-mentioned wild type or mutant hNAGLU is modified by a substance other than a sugar chain and a phosphate. hNAGLU also includes hNAGLU in which the side chain of the amino acid constituting the above-mentioned wild type or mutant hNAGLU is changed by a substitution reaction or the like. As the change, there is a change of a cysteine residue to formylglycine, but it is not limited thereto.

[0195] That is, hNAGLU modified by a sugar chain is considered to be included in hNAGLU having the amino acid sequence before the modification. hNAGLU modified by a phosphate is considered to be included in hNAGLU having the original amino acid sequence before the modification by the phosphate. hNAGLU modified by a substance other than a sugar chain and a phosphate is considered to be included in hNAGLU having the original amino acid sequence before the modification. hNAGLU in which the side chain of the amino acid constituting hNAGLU is changed by a substitution reaction or the like is considered to be included in hNAGLU having the original amino acid sequence before the change. As the change, there is a change of a cysteine residue to formylglycine, but it is not limited thereto.

[0196] In the present application, the term "human α-N-acetylglucosaminidase mutant" (hNAGLU mutant) refers to a substance in which one or more than two amino acid residues are substituted, deleted, and / or added with respect to the amino acid sequence of the usual wild type hNAGLU (the amino acid sequence shown in SEQ ID NO: 1), and has an enzyme activity capable of decomposing heparan sulfate and the like, and has a function as the usual wild type hNAGLU. The preferred hNAGLU mutant in the present application contains an amino acid sequence formed by substitution, deletion, or addition of one or more than two amino acid residues with respect to the amino acid sequence shown in SEQ ID NO: 1. When the amino acid residues in the amino acid sequence are substituted with other amino acid residues, the number of substituted amino acid residues is one to ten, one to five, or one to three, for example, one or two. When the amino acid residues are deleted, the number of deleted amino acid residues is one to ten, one to five, or one to three, for example, one or two. In addition, the hNAGLU mutant can be combined with substitution and deletion of these amino acid residues.

[0197] The addition of amino acid residues to the amino acid sequence shown in SEQ ID NO: 1 is the addition of 1 or more than 2 amino acid residues in the amino acid sequence of hNAGLU or on the N-terminal side or C-terminal side of the amino acid sequence. The number of amino acid residues added at this time is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2. In addition, the addition and substitution of amino acid residues can be combined, the addition and deletion of amino acid residues can be combined, and the addition, substitution, and deletion of amino acid residues can be combined. That is, the hNAGLU mutant is a hNAGLU mutant into which at least two mutations of the three mutations of substitution, deletion, and addition of amino acids are combined with respect to the amino acid sequence shown in SEQ ID NO: 1.

[0198] As the hNAGLU mutant into which at least two mutations of the three mutations of substitution, deletion, and addition of amino acids are combined, the following (i) to (iv) are shown, but are not limited to these:

[0199] (i) a mutant having an amino acid sequence formed by deletion of 0 to 10 amino acid residues, substitution of 0 to 10 amino acid residues to other amino acid residues, and addition of 0 to 10 amino acid residues with respect to the amino acid sequence shown in SEQ ID NO: 1 (where the wild-type hNAGLU is excluded);

[0200] (ii) a mutant having an amino acid sequence formed by deletion of 0 to 5 amino acid residues, substitution of 0 to 5 amino acid residues to other amino acid residues, and addition of 0 to 5 amino acid residues with respect to the amino acid sequence shown in SEQ ID NO: 1 (where the wild-type hNAGLU is excluded);

[0201] (iii) a mutant having an amino acid sequence formed by deletion of 0 to 3 amino acid residues, substitution of 0 to 3 amino acid residues to other amino acid residues, and addition of 0 to 3 amino acid residues with respect to the amino acid sequence shown in SEQ ID NO: 1 (where the wild-type hNAGLU is excluded);

[0202] (iv) a mutant having an amino acid sequence formed by deletion of 0 to 2 amino acid residues, substitution of 0 to 2 amino acid residues to other amino acid residues, and addition of 0 to 2 amino acid residues with respect to the amino acid sequence shown in SEQ ID NO: 1 (where the wild-type hNAGLU is excluded).

[0203] The position of each mutation and the form thereof (deletion, substitution, and addition) in each hNAGLU mutant when compared with the usual wild-type hNAGLU can be easily confirmed by alignment of the amino acid sequences of two hNAGLUs.

[0204] The amino acid sequence of the hNAGLU mutant preferably shows more than 80% identity, more than 85% identity, more than 90% identity, or more than 95% identity, for example, more than 98% or 99% identity, to the amino acid sequence of the general wild-type hNAGLU shown in SEQ ID NO: 1.

[0205] The identity of the amino acid sequence of the wild-type hNAGLU to the amino acid sequence of the hNAGLU mutant can be easily calculated using well-known homology calculation algorithms. For example, as such algorithms, there are BLAST (Altschul SF. J Mol. Biol. 215.403-10, (1990)), the similarity search method of Pearson and Lipman (Proc. Natl. Acad. Sci. USA. 85.2444 (1988)), the local homology algorithm of Smith and Waterman (Adv. Appl. Math. 2.482-9 (1981)), and the like.

[0206] The substitution of an amino acid in the amino acid sequence of the wild-type hNAGLU or the hNAGLU mutant to another amino acid, for example, occurs within families of amino acids associated with the side chains and chemical properties of the amino acids. It can be predicted that such substitution within the family of amino acids does not significantly change the function of the original protein (i.e., conservative amino acid substitution). As the family of amino acids, there are, for example, the families shown in (1) to (12) below:

[0207] (1) aspartic acid and glutamic acid as acidic amino acids,

[0208] (2) histidine, lysine, and arginine as basic amino acids,

[0209] (3) phenylalanine, tyrosine, and tryptophan as aromatic amino acids,

[0210] (4) serine and threonine as amino acids having a hydroxyl group (hydroxyl amino acids),

[0211] (5) methionine, alanine, valine, leucine, and isoleucine as hydrophobic amino acids,

[0212] (6) cysteine, serine, threonine, asparagine, and glutamine as neutral hydrophilic amino acids,

[0213] (7) glycine and proline as amino acids having an influence on the orientation of the peptide chain,

[0214] (8) asparagine and glutamine as amide-type amino acids (polar amino acids),

[0215] (9) alanine, leucine, isoleucine and valine as aliphatic amino acids,

[0216] (10) alanine, glycine, serine and threonine as small side chain amino acids,

[0217] (11) alanine and glycine as particularly small side chain amino acids,

[0218] (12) valine, leucine and isoleucine as amino acids having a branched chain.

[0219] In one embodiment of the present application, the hNAGLU mutant referred to as a high expression type hNAGLU mutant is characterized in that, when expressed as a recombinant protein in a host cell, an expression amount of at least 1.1 times or more, 1.5 times or more, 2 times or more, 4 times or more, 5 times or more, or 6 times or more, for example, 1.5 to 4 times, 2 to 5 times, 2 to 8 times, or the like, is obtained as compared with the case where wild type hNAGLU is expressed as a recombinant protein in a host cell under the same conditions. Here, the same conditions mean that the expression vector, the host cell, the culture conditions, and the like are the same.

[0220] As a preferred embodiment of the high expression type hNAGLU mutant, the following (1) to (7) can be cited:

[0221] (1) a mutant having the amino acid sequence shown in SEQ ID NO: 3 obtained by substituting lysine at position 36 with glutamic acid and substituting proline at position 37 with serine in the amino acid sequence of wild type hNAGLU shown in SEQ ID NO: 1;

[0222] (2) a mutant having the amino acid sequence shown in SEQ ID NO: 5 obtained by adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence of wild type hNAGLU shown in SEQ ID NO: 1;

[0223] (3) a mutant having the amino acid sequence shown in SEQ ID NO: 9 obtained by substituting glutamine at position 209 with arginine in the amino acid sequence of wild type hNAGLU shown in SEQ ID NO: 1;

[0224] (4) a mutant having the amino acid sequence shown in SEQ ID NO: 11 obtained by substituting glutamic acid at position 228 with lysine in the amino acid sequence of wild type hNAGLU shown in SEQ ID NO: 1;

[0225] (5) a mutant having the amino acid sequence shown in SEQ ID NO: 15 obtained by substituting threonine at position 320 with proline and substituting glutamic acid at position 321 with aspartic acid in the amino acid sequence of wild type hNAGLU shown in SEQ ID NO: 1;

[0226] (6) a mutant having the amino acid sequence shown in SEQ ID NO: 17, which is obtained by substituting serine at position 505 with alanine and isoleucine at position 506 with valine in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1;

[0227] (7) a mutant having the amino acid sequence shown in SEQ ID NO: 19, which is obtained by substituting serine at position 526 with asparagine and alanine at position 528 with threonine in the amino acid sequence of wild-type hNAGLU shown in SEQ ID NO: 1.

[0228] Further, as the preferred embodiment of the high-expression-type hNAGLU mutant, the following (1') to (7') can be exemplified.

[0229] (1') no mutation is added to glutamic acid at position 36 and serine at position 37 of the amino acid sequence shown in SEQ ID NO: 3:

[0230] (1'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of the substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0231] (1'-b) the amino acid residues constituting the amino acid sequence are deleted, the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0232] (1'-c) the substitution of the above 1'-a and the deletion of 1'-b are combined;

[0233] (1'-d) one or more amino acid residues are added to the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0234] (1'-e) the substitution of the above 1'-a and the addition of 1'-d are combined;

[0235] (1'-f) the deletion of the above 1'-b and the addition of 1'-d are combined;

[0236] (1'-g) the substitution of the above 1'-a, the deletion of 1'-b, and the addition of 1'-d are combined;

[0237] (1'-h) the amino acid sequence shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity.

[0238] (2') no mutation is added at the serine at position 45 of the amino acid sequence shown in SEQ ID NO: 5:

[0239] (2'-a) one to ten, one to five, or one to three, for example one or two, of the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues;

[0240] (2'-b) one to ten, one to five, or one to three, for example one or two, of the amino acid residues constituting the amino acid sequence are deleted;

[0241] (2'-c) the substitution of 2'-a and the deletion of 2'-b are combined;

[0242] (2'-d) one or more than two amino acid residues are added in the amino acid sequence, or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues being one to ten, one to five, or one to three, for example one or two;

[0243] (2'-e) the substitution of 2'-a and the addition of 2'-d are combined;

[0244] (2'-f) the deletion of 2'-b and the addition of 2'-d are combined;

[0245] (2'-g) the substitution of 2'-a, the deletion of 2'-b, and the addition of 2'-d are combined;

[0246] (2'-h) the amino acid sequence shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity.

[0247] (3') no mutation is added at the arginine at position 209 of the amino acid sequence shown in SEQ ID NO: 9:

[0248] (3'-a) one to ten, one to five, or one to three, for example one or two, of the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues;

[0249] (3'-b) one to ten, one to five, or one to three, for example one or two, of the amino acid residues constituting the amino acid sequence are deleted;

[0250] (3'-c) the substitution of 3'-a and the deletion of 3'-b are combined;

[0251] (3'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0252] (3'-e) the substitution of the above 3'-a and the addition of 3'-d are combined;

[0253] (3'-f) the deletion of the above 3'-b and the addition of 3'-d are combined;

[0254] (3'-g) the substitution of the above 3'-a, the deletion of 3'-b, and the addition of 3'-d are combined;

[0255] (3'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0256] (4') no mutation is added to the lysine at position 228 of the amino acid sequence shown in SEQ ID NO: 11:

[0257] (4'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0258] (4'-b) the amino acid residues constituting the amino acid sequence are deleted, the number of deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0259] (4'-c) the substitution of the above 4'-a and the deletion of 4'-b are combined;

[0260] (4'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0261] (4'-e) the substitution of the above 4'-a and the addition of 4'-d are combined;

[0262] (4'-f) the deletion of the above 4'-b and the addition of 4'-d are combined;

[0263] (4'-g) the substitution of the above 4'-a, the deletion of 4'-b, and the addition of 4'-d are combined;

[0264] (4'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0265] (5') no mutation is added at the proline at position 320 and the aspartic acid at position 321 of the amino acid sequence shown in SEQ ID NO: 15:

[0266] (5'-a) one or more of the amino acid residues constituting the amino acid sequence is / are replaced with another amino acid residue(s), the number of the replaced amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0267] (5'-b) one or more of the amino acid residues constituting the amino acid sequence is / are deleted, the number of the deleted amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0268] (5'-c) the replacement of 5'-a and the deletion of 5'-b are combined;

[0269] (5'-d) one or more amino acid residues are added to the amino acid sequence or at the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0270] (5'-e) the replacement of 5'-a and the addition of 5'-d are combined;

[0271] (5'-f) the deletion of 5'-b and the addition of 5'-d are combined;

[0272] (5'-g) the replacement of 5'-a, the deletion of 5'-b and the addition of 5'-d are combined.

[0273] (5'-h) the amino acid sequence shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0274] (6') no mutation is added at the alanine at position 505 and the valine at position 506 of the amino acid sequence shown in SEQ ID NO: 17:

[0275] (6'-a) one or more of the amino acid residues constituting the amino acid sequence is / are replaced with another amino acid residue(s), the number of the replaced amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0276] (6'-b) one or more of the amino acid residues constituting the amino acid sequence is / are deleted, the number of the deleted amino acid residue(s) being 1 to 10, 1 to 5 or 1 to 3, for example, 1 or 2;

[0277] (6'-c) the replacement of 6'-a and the deletion of 6'-b are combined;

[0278] (6'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0279] (6'-e) the substitution of the above 6'-a and the addition of 6'-d are combined;

[0280] (6'-f) the deletion of the above 6'-b and the addition of 6'-d are combined;

[0281] (6'-g) the substitution of the above 6'-a, the deletion of 6'-b, and the addition of 6'-d are combined;

[0282] (6'-h) the amino acid sequence shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity.

[0283] (7') no mutation is added to the asparagine at position 526 and the threonine at position 528 of the amino acid sequence shown in SEQ ID NO: 19:

[0284] (7'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0285] (7'-b) the amino acid residues constituting the amino acid sequence are deleted, the number of deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0286] (7'-c) the substitution of the above 7'-a and the deletion of 7'-b are combined;

[0287] (7'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0288] (7'-e) the substitution of the above 7'-a and the addition of 7'-d are combined;

[0289] (7'-f) the deletion of the above 7'-b and the addition of 7'-d are combined;

[0290] (7'-g) the substitution of the above 7'-a, the deletion of 7'-b, and the addition of 7'-d are combined;

[0291] (7'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0292] As a high expression type hNAGLU mutant of the amino acid sequence shown in SEQ ID NO: 9 in which the glutamine at position 209 of the wild type hNAGLU amino acid sequence shown in SEQ ID NO: 1 is substituted with arginine, a high expression type hNAGLU mutant in which a further mutation is introduced into the above can be exemplified by the following (8) to (15):

[0293] (8) a mutant having the amino acid sequence shown in SEQ ID NO: 25 in which the glutamine at position 209, the lysine at position 36, and the proline at position 37 of the wild type hNAGLU amino acid sequence shown in SEQ ID NO: 1 are substituted with arginine, glutamic acid, and serine, respectively;

[0294] (9) a mutant having the amino acid sequence shown in SEQ ID NO: 27 in which the glutamine at position 209 of the wild type hNAGLU amino acid sequence shown in SEQ ID NO: 1 is substituted with arginine and a serine is added between the leucine at position 44 and the glycine at position 45;

[0295] (10) a mutant having the amino acid sequence shown in SEQ ID NO: 29 in which the glutamine at position 209, the threonine at position 320, and the glutamic acid at position 321 of the wild type hNAGLU amino acid sequence shown in SEQ ID NO: 1 are substituted with arginine, proline, and aspartic acid, respectively;

[0296] (11) a mutant having the amino acid sequence shown in SEQ ID NO: 31 in which the glutamine at position 209, the lysine at position 36, and the proline at position 37 of the wild type hNAGLU amino acid sequence shown in SEQ ID NO: 1 are substituted with arginine, glutamic acid, and serine, respectively, and a serine is added between the leucine at position 44 and the glycine at position 45;

[0297] (12) a mutant having the amino acid sequence shown in SEQ ID NO: 33 in which the glutamine at position 209, the valine at position 54, and the arginine at position 620 of the wild type hNAGLU amino acid sequence shown in SEQ ID NO: 1 are substituted with arginine, isoleucine, and lysine, respectively;

[0298] (13) a mutant having the amino acid sequence represented by SEQ ID NO: 35, which is obtained by substituting glutamine at position 209 with arginine, substituting valine at position 54 with isoleucine, and adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence of wild-type hNAGLU represented by SEQ ID NO: 1;

[0299] (14) a mutant having the amino acid sequence represented by SEQ ID NO: 37, which is obtained by substituting glutamine at position 209 with arginine, substituting arginine at position 620 with lysine, and adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence of wild-type hNAGLU represented by SEQ ID NO: 1;

[0300] (15) a mutant having the amino acid sequence represented by SEQ ID NO: 39, which is obtained by substituting glutamine at position 209 with arginine, substituting valine at position 54 with isoleucine, substituting arginine at position 620 with lysine, and adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence of wild-type hNAGLU represented by SEQ ID NO: 1.

[0301] Further, as the preferred embodiments of the high-expression-type hNAGLU mutant, the following (8') to (15') can be exemplified.

[0302] (8') no mutation is added to arginine at position 209, glutamic acid at position 36, and serine at position 37 of the amino acid sequence represented by SEQ ID NO: 25:

[0303] (8'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of the substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0304] (8'-b) the amino acid residues constituting the amino acid sequence are deleted, the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0305] (8'-c) the substitution of the above 8'-a and the deletion of 8'-b are combined;

[0306] (8'-d) one or two or more amino acid residues are added to the amino acid sequence, or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0307] (8'-e) the substitution of the above 8'-a and the addition of 8'-d are combined;

[0308] (8'-f) a combination of the deletion of 8'-b and the addition of 8'-d above;

[0309] (8'-g) a combination of the substitution of 8'-a, the deletion of 8'-b and the addition of 8'-d above;

[0310] (8'-h) has 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0311] (9') no mutation is added to the arginine at position 210 and the serine at position 45 of the amino acid sequence shown in SEQ ID NO: 27:

[0312] (9'-a) one to ten, one to five, or one to three, for example, one or two, of the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues;

[0313] (9'-b) one to ten, one to five, or one to three, for example, one or two, of the amino acid residues constituting the amino acid sequence are deleted;

[0314] (9'-c) a combination of the substitution of 9'-a and the deletion of 9'-b above;

[0315] (9'-d) one or more than two, for example, one or two, of the amino acid residues are added to the amino acid sequence, or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues being one to ten, one to five, or one to three, for example, one or two;

[0316] (9'-e) a combination of the substitution of 9'-a and the addition of 9'-d above;

[0317] (9'-f) a combination of the deletion of 9'-b and the addition of 9'-d above;

[0318] (9'-g) a combination of the substitution of 9'-a, the deletion of 9'-b and the addition of 9'-d above;

[0319] (9'-h) has 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0320] (10') no mutation is added to the arginine at position 209, the proline at position 320 and the aspartic acid at position 321 of the amino acid sequence shown in SEQ ID NO: 29:

[0321] (10'-a) one to ten, one to five, or one to three of the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, for example, one or two;

[0322] (10'-b) one to ten, one to five, or one to three of the amino acid residues constituting the amino acid sequence are deleted;

[0323] (10'-c) the substitution of 10'-a and the deletion of 10'-b are combined;

[0324] (10'-d) one or more than two amino acid residues are added to the amino acid sequence or on the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues being one to ten, one to five, or one to three, for example, one or two;

[0325] (10'-e) the substitution of 10'-a and the addition of 10'-d are combined;

[0326] (10'-f) the deletion of 10'-b and the addition of 10'-d are combined;

[0327] (10'-g) the substitution of 10'-a, the deletion of 10'-b, and the addition of 10'-d are combined;

[0328] (10'-h) the amino acid sequence shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0329] (11') no mutation is introduced at the arginine at position 210, the glutamic acid at position 36, the serine at position 37, and the serine at position 45 of the amino acid sequence represented by SEQ ID NO: 31:

[0330] (11'-a) one to ten, one to five, or one to three of the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, for example, one or two;

[0331] (11'-b) one to ten, one to five, or one to three of the amino acid residues constituting the amino acid sequence are deleted;

[0332] (11'-c) the substitution of 11'-a and the deletion of 11'-b are combined;

[0333] (11'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0334] (11'-e) the substitution of the above 11'-a and the addition of 11'-d are combined;

[0335] (11'-f) the deletion of the above 11'-b and the addition of 11'-d are combined;

[0336] (11'-g) the substitution of the above 11'-a, the deletion of 11'-b, and the addition of 11'-d are combined;

[0337] (11'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0338] (12') no mutation is added to arginine at position 209, isoleucine at position 54, and lysine at position 620 of the amino acid sequence represented by SEQ ID NO: 33:

[0339] (12'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, the number of substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0340] (12'-b) the amino acid residues constituting the amino acid sequence are deleted, the number of deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0341] (12'-c) the substitution of the above 12'-a and the deletion of 12'-b are combined;

[0342] (12'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, the number of added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0343] (12'-e) the substitution of the above 12'-a and the addition of 12'-d are combined;

[0344] (12'-f) the deletion of the above 12'-b and the addition of 12'-d are combined;

[0345] (12'-g) the substitution of the above 12'-a, the deletion of 12'-b, and the addition of 12'-d are combined;

[0346] (12'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0347] (13') no mutation is added to the arginine at position 210, the isoleucine at position 55, and the serine at position 45 of the amino acid sequence shown in SEQ ID NO: 35:

[0348] (13'-a) one or two of the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues;

[0349] (13'-b) one or two of the amino acid residues constituting the amino acid sequence are deleted;

[0350] (13'-c) a combination of the substitution of 13'-a and the deletion of 13'-b;

[0351] (13'-d) one or two or more amino acid residues are added to the amino acid sequence or at the N-terminal side or the C-terminal side of the amino acid sequence, the number of the added amino acid residues being one to ten, one to five, or one to three, for example, one or two;

[0352] (13'-e) a combination of the substitution of 13'-a and the addition of 13'-d;

[0353] (13'-f) a combination of the deletion of 13'-b and the addition of 13'-d;

[0354] (13'-g) a combination of the substitution of 13'-a, the deletion of 13'-b, and the addition of 13'-d;

[0355] (13'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0356] (14') no mutation is added to the arginine at position 210, the lysine at position 621, and the serine at position 45 of the amino acid sequence shown in SEQ ID NO: 37:

[0357] (14'-a) one or two of the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues;

[0358] (14'-b) the amino acid residues constituting the amino acid sequence are deleted, and the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0359] (14'-c) the substitution of the above 14'-a and the deletion of the above 14'-b are combined;

[0360] (14'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, and the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0361] (14'-e) the substitution of the above 14'-a and the addition of the above 14'-d are combined;

[0362] (14'-f) the deletion of the above 14'-b and the addition of the above 14'-d are combined;

[0363] (14'-g) the substitution of the above 14'-a, the deletion of the above 14'-b, and the addition of the above 14'-d are combined;

[0364] (14'-h) the amino acid sequence shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0365] (15') no mutation is introduced at the arginine at position 210, the isoleucine at position 55, the lysine at position 621, and the serine at position 45 of the amino acid sequence shown in SEQ ID NO: 39:

[0366] (15'-a) the amino acid residues constituting the amino acid sequence are substituted with other amino acid residues, and the number of the substituted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0367] (15'-b) the amino acid residues constituting the amino acid sequence are deleted, and the number of the deleted amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0368] (15'-c) the substitution of the above 15'-a and the deletion of the above 15'-b are combined;

[0369] (15'-d) 1 or more amino acid residues are added to the amino acid sequence or on the N-terminal side or C-terminal side of the amino acid sequence, and the number of the added amino acid residues is 1 to 10, 1 to 5, or 1 to 3, for example, 1 or 2;

[0370] (15'-e) the substitution of the above 15'-a and the addition of the above 15'-d are combined;

[0371] (15'-f) a combination of the deletion of 15'-b and the addition of 15'-d;

[0372] (15'-g) a combination of the substitution of 15'-a, the deletion of 15'-b, and the addition of 15'-d;

[0373] (15'-h) shows 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% identity to the amino acid sequence.

[0374] The hNAGLU mutant in one embodiment of the present application is an hNAGLU mutant that, when expressed in a host cell in the form of a recombinant protein, is expressed in a larger amount than wild-type hNAGLU expressed in the same conditions in the form of a recombinant protein. In this specification, the hNAGLU mutant of this type is referred to as a high-expression-type hNAGLU mutant. The high-expression-type hNAGLU mutant can improve the production efficiency when produced in the form of a recombinant protein compared to wild-type hNAGLU, and thus can reduce the production cost. Note that the same conditions here refer to the same expression vector, host cell, culture conditions, and the like.

[0375] The gene encoding an hNAGLU mutant that, when expressed in a host cell in the form of a recombinant protein, is expressed in a larger amount than wild-type hNAGLU can be obtained, for example, by the following method. Genes encoding a mutated hNAGLU and wild-type hNAGLU are respectively recombined into the same expression vector, and the same host cell is transformed with the expression vectors, and cells into which the expression vectors have been introduced are obtained. Next, these cells are cultured under the same conditions, and the hNAGLU obtained in the culture supernatant is quantified. The gene introduced into the cells that show a larger quantified value compared to the quantified value of the cells into which the gene encoding wild-type hNAGLU has been introduced is determined to be the gene encoding the target high-expression-type hNAGLU mutant. Note that, as the quantified value here, in addition to the quantified value of hNAGLU in the form of a protein, the value of the enzyme activity of hNAGLU can also be used. For example, as the quantified value, the total amount of the enzyme activity of hNAGLU contained in the culture supernatant can also be used.

[0376] The introduction of mutations into wild-type hNAGLU can be performed using a method of randomly introducing mutations into the gene encoding wild-type hNAGLU. For example, by allowing a mutation source (radiation, mutagen, or the like) to act on a host cell formed by integrating the gene encoding wild-type hNAGLU into a vector and transforming the host cell with the vector, mutations can be introduced into the gene encoding wild-type hNAGLU.

[0377] The introduction of mutations into the wild-type hNAGLU can also be performed using a method of introducing mutations into a predetermined position of a gene encoding the wild-type hNAGLU. For example, by chemically synthesizing a gene having a mutation at a predetermined position, it is possible to introduce the mutation of the gene.

[0378] The high-expression-type hNAGLU mutant can be produced by transforming a host cell with an expression vector into which a gene encoding the mutant is integrated, culturing the transformed host cell, thereby producing the mutant as a recombinant protein.

[0379] As for the host cell used at this time, there is no particular limitation as long as it is capable of expressing the high-expression-type hNAGLU mutant by introducing such an expression vector, and it can be any of eukaryotic cells such as mammalian cells, yeasts, plant cells, insect cells, and prokaryotic cells such as Escherichia coli and Bacillus subtilis, with mammalian cells being particularly preferable.

[0380] When a mammalian cell is used as the host cell, the type of the mammalian cell is not particularly limited, and cells derived from humans, mice, and Chinese hamsters are preferable, with CHO cells derived from Chinese hamster ovary cells or NS / 0 cells derived from mouse myeloma cells being particularly preferable. In addition, the expression vector used at this time for the integration and expression of a DNA fragment encoding the high-expression-type hNAGLU mutant can be used without limitation as long as it causes the expression of the gene when introduced into a mammalian cell. The gene integrated in the expression vector is disposed downstream of a DNA sequence (gene expression regulatory site) capable of regulating the frequency of transcription of the gene in the mammalian cell. As the gene expression regulatory site that can be used in the present application, for example, a promoter derived from cytomegalovirus, an SV40 early promoter, a human elongation factor-1 alpha (EF-1 alpha) promoter, a human ubiquitin C promoter, and the like can be cited.

[0381] It is known that an expression vector in which glutamine synthetase (GS) as a selection marker is disposed downstream of a gene encoding a target protein via an internal ribosome entry site (IRES) (International Patent Publication WO2012 / 063799, WO2013 / 161958). The expression vectors described in these documents are particularly suitable for use in the production of the high-expression-type hNAGLU mutant.

[0382] For example, an expression vector for expressing a target protein, which contains a first gene expression regulatory site, a gene encoding the protein downstream thereof, an internal ribosome entry site downstream thereof, a gene encoding glutamine synthetase downstream thereof, and further contains a dihydrofolate reductase gene or a drug resistance gene downstream of the second gene expression regulatory site which is the same as or different from the first gene expression regulatory site, is suitably used for the production of a high-expression type hNAGLU mutant. In the expression vector, as the first gene expression regulatory site or the second gene expression regulatory site, a promoter from cytomegalovirus, an SV40 early promoter, a human elongation factor-1 alpha promoter (hEF-1 alpha promoter), a human ubiquitin C promoter are suitably used, and the hEF-1 alpha promoter is particularly suitable.

[0383] Further, as the internal ribosome entry site, an internal ribosome entry site from the genome of a virus selected from the group consisting of a virus of the Picornaviridae family, a foot-and-mouth disease virus, a hepatitis A virus, a hepatitis C virus, a coronavirus, a bovine enterovirus, a Theiler's murine encephalomyelitis virus, a coxsackievirus B, or a gene selected from the group consisting of a human immunoglobulin heavy chain binding protein gene, a Drosophila antennapedia gene, a Drosophila Antennapedia gene is suitably used, and an internal ribosome entry site from the 5' untranslated region of the genome of the mouse encephalomyocarditis virus is particularly suitable. When the internal ribosome entry site from the 5' untranslated region of the genome of the mouse encephalomyocarditis virus is used, an internal ribosome entry site in which a part of two or more initiation codons contained in the wild-type internal ribosome entry site is destroyed, in addition to the wild-type internal ribosome entry site, is also suitably used. Further, the drug resistance gene suitably used in the expression vector is preferably a puromycin or a neomycin resistance gene, and more preferably a puromycin resistance gene.

[0384] Further, for example, an expression vector for expressing a target protein, which contains a human elongation factor-1 alpha promoter, a gene encoding the protein downstream thereof, an internal ribosome entry site from the 5' untranslated region of the genome of the mouse encephalomyocarditis virus downstream thereof, and a gene encoding glutamine synthetase downstream thereof, and further contains another gene expression regulatory site and a dihydrofolate reductase gene downstream thereof, and an expression vector in which a part of two or more initiation codons contained in the wild-type internal ribosome entry site in the internal ribosome entry site is destroyed, can be suitably used for the production of a high-expression type hNAGLU mutant. As such an expression vector, an expression vector described in WO2013 / 161958 can be exemplified.

[0385] Further, for example, an expression vector for expressing a target protein, which contains a human elongation factor-1 alpha promoter, a gene encoding the protein downstream thereof, an internal ribosome entry site from the 5' untranslated region of the genome of mouse encephalomyocarditis virus further downstream, and a gene encoding glutamine synthetase further downstream, and which further contains other gene expression regulatory sites and an anti-drug gene downstream thereof, and in which a portion of two or more start codons contained in the wild-type internal ribosome entry site of the internal ribosome entry site is destroyed, can be suitably used for the production of a high-expression-type hNAGLU mutant. As such an expression vector, pE-mIRES-GS-puro described in WO2012 / 063799 and pE-mIRES-GS-mNeo described in WO2013 / 161958 can be cited.

[0386] There are three start codons (ATG) at the 3' end of the wild-type internal ribosome entry site from the 5' untranslated region of the genome of mouse encephalomyocarditis virus. The above-described pE-mIRES-GS-puro and pE-mIRES-GS-mNeo are expression vectors having an IRES in which a portion of the start codon is destroyed.

[0387] A hNAGLU mutant (including a high-expression-type hNAGLU mutant) can be expressed in a cell or in a culture medium by culturing a host cell into which an expression vector in which a gene encoding the same is integrated is introduced. The method of expression of a hNAGLU mutant when the host cell is a mammalian cell will be described in detail below.

[0388] As a culture medium for culturing a mammalian cell, any can be used without particular limitation as long as it can culture and proliferate a mammalian cell, and a serum-free culture medium is preferably used. In the present application, as a serum-free culture medium used as a culture medium for the production of a recombinant protein, for example, a culture medium containing amino acids 3 to 700 mg / L, vitamins 0.001 to 50 mg / L, monosaccharides 0.3 to 10 g / L, inorganic salts 0.1 to 10,000 mg / L, trace elements 0.001 to 0.1 mg / L, nucleosides 0.1 to 50 mg / L, fatty acids 0.001 to 10 mg / L, biotin 0.01 to 1 mg / L, hydrocortisone 0.1 to 20 mg / L, insulin 0.1 to 20 mg / L, vitamin B12 0.1 to 10 mg / L, putrescine 0.01 to 1 mg / L, sodium pyruvate 10 to 500 mg / L, and a water-soluble iron compound is suitably used. If desired, thymidine, hypoxanthine, a commonly used pH indicator, and an antibiotic, etc. can be added to the culture medium.

[0389] As a serum-free medium used for recombinant protein production, DMEM / F12 medium (a mixture of DMEM and F12) can be used as the basal medium, and these media are well known to those skilled in the art. Furthermore, as a serum-free medium, a modified DMEM(HG)HAM (R5) medium containing sodium bicarbonate, L-glutamine, D-glucose, insulin, sodium selenate, diaminobutane, hydrocortisone, ferric(II) sulfate, asparagine, aspartic acid, serine, and polyvinyl alcohol can also be used. Furthermore, commercially available serum-free media, such as CD OptiCHO, can also be used. TM Culture medium, CHO-S-SFMII medium or CD CHO medium (Thermo Fisher Scientific, formerly Lifetech), IS cho-V TM Culture medium (Irvine Scientific), EX-CELL TM 302 culture medium or EX-CELL TM 325-PF medium (SAFC Biosciences) and other similar media were used as the basic culture medium.

[0390] The high-expression hNAGLU mutant is characterized by the following: when mammalian cells inoculated with an expression vector containing the gene encoding hNAGLU are cultured in the aforementioned serum-free medium and expressed as a recombinant protein, the expression level is at least 1.1 times, 1.5 times, 2 times, 4 times, 5 times, or 6 times higher (e.g., 1.5–4 times, 2–5 times, 2–8 times, etc.) compared to wild-type hNAGLU expressed as a recombinant protein under the same conditions. The mammalian cells used in this process include CHO cells, NS / O cells, etc., especially CHO cells.

[0391] Recombinant hNAGLU mutants expressed intracellularly or in culture medium by culturing host cells encoding the hNAGLU mutant can be purified by separating them from impurities using methods such as column chromatography. The purified hNAGLU mutants can then be used as drugs. In particular, the hNAGLU mutants can be used as drugs targeting mucopolysaccharidosis type IIIB (MPS-IIIB), a known form of Sanfilippo syndrome type B.

[0392] The pharmaceutical containing the hNAGLU mutant as an active ingredient can be administered as an injection into intravenous, intramuscular, intraperitoneal, subcutaneous, or intracerebroventricular administration. These injections can be provided in the form of a freeze-dried preparation or an aqueous liquid. When provided as an aqueous liquid, it can be in the form of a tube filled with a liquid, or can be provided as a prefilled preparation filled in a syringe. In the case of a freeze-dried preparation, it is dissolved in an aqueous medium and used after reconstitution before use.

[0393] The hNAGLU mutant in one embodiment of the present application can be bound to an antibody. For example, the hNAGLU mutant in one embodiment of the present application can be a conjugate with an antibody capable of specifically binding to a receptor on a brain vascular endothelial cell. By being a conjugate with an antibody capable of specifically binding to a receptor on a brain vascular endothelial cell, the hNAGLU mutant is allowed to pass through the blood-brain barrier (BBB) and function in the central nervous system (CNS). As such a receptor on a brain vascular endothelial cell, for example, insulin receptor, transferrin receptor, leptin receptor, lipoprotein receptor, and IGF receptor can be listed, but are not limited to these. In addition, the receptor is preferably a human-derived receptor.

[0394] In the present application, the term "antibody" refers to human antibodies, mouse antibodies, humanized antibodies, antibodies derived from Camelidae (including llamas), chimeric antibodies of human antibodies and other mammalian antibodies, and chimeric antibodies of mouse antibodies and other mammalian antibodies, as long as they have the property of specifically binding to a specific antigen, and is not limited to these. In addition, the animal species of the antibody is not particularly limited.

[0395] In the present application, the term "human antibody" refers to an antibody whose entire protein is encoded by a gene derived from humans. However, an antibody encoded by a gene in which a mutation has been added to the original human gene without changing the original amino acid sequence in order to improve the expression efficiency of the gene or the like is also included in the "human antibody". In addition, an antibody made by combining two or more genes encoding human antibodies, or by replacing a part of one human antibody with a part of another human antibody is also a "human antibody". A human antibody has three complementarity determining regions (CDRs) of a light chain and three complementarity determining regions (CDRs) of a heavy chain. The three CDRs of the light chain are called CDR1, CDR2, and CDR3 in order from the N-terminal side. The three CDRs of the heavy chain are called CDR1, CDR2, and CDR3 in order from the N-terminal side. An antibody in which the antigen specificity, affinity, or the like of a human antibody has been changed by replacing the CDR of one human antibody with the CDR of another human antibody is also included in the human antibody.

[0396] In the present application, an antibody in which a substitution, deletion, addition, or the like of an amino acid in the amino acid sequence of a parent antibody is introduced by changing the gene of the parent antibody is also included in the "human antibody". When an amino acid in the amino acid sequence of the parent antibody is substituted with another amino acid, the number of the substituted amino acids is preferably 1 to 20, more preferably 1 to 5, and further preferably 1 to 3. When an amino acid in the amino acid sequence of the parent antibody is deleted, the number of the deleted amino acids is preferably 1 to 20, more preferably 1 to 5, and further preferably 1 to 3. In addition, an antibody in which a mutation combining these substitutions and deletions of amino acids is introduced is also a human antibody. When an amino acid is added, 1 to 20, more preferably 1 to 5, and further preferably 1 to 3 amino acids are added to the amino acid sequence of the parent antibody or at the N terminus or C terminus. An antibody in which a mutation combining these additions, substitutions, and deletions of amino acids is introduced is also a human antibody. The amino acid sequence of the antibody in which the mutation is introduced preferably shows 80% or more identity, more preferably 90% or more identity, further preferably 95% or more identity, and still more preferably 98% or more identity to the amino acid sequence of the parent antibody. When the above mutation is introduced into a human antibody, the mutation can be introduced into the variable region of the antibody. When the above mutation is introduced into the variable region of the antibody, the mutation can be introduced into either of the CDR and the framework region of the variable region, and particularly into the framework region. That is, the "gene of human origin" in the present application includes not only a gene of human origin but also a gene in which a change is introduced.

[0397] In the present application, the term "humanized antibody" refers to an antibody in which a part of the variable region (for example, particularly all or a part of the CDR) has an amino acid sequence derived from a mammal other than a human, and the other region is derived from a human. For example, as a humanized antibody, an antibody in which the three complementarity determining regions (CDRs) of the light chain and the three complementarity determining regions (CDRs) of the heavy chain constituting a human antibody are replaced with CDRs of another mammal can be exemplified. The species of the other mammal from which the CDRs to be grafted into a suitable position of the human antibody are derived is not particularly limited as long as it is a mammal other than a human, and is preferably a mouse, a rat, a rabbit, a horse, or a primate other than a human, and more preferably a mouse and a rat, and further preferably a mouse. In addition, an antibody in which the same mutation as that which can be introduced into the above human antibody is introduced into the amino acid sequence of the parent humanized antibody is also included in the "humanized antibody".

[0398] In the present application, the term "chimeric antibody" refers to an antibody in which fragments of two or more different antibodies derived from two or more different species are linked.

[0399] A chimeric antibody of a human antibody and another mammal antibody means an antibody in which a part of a human antibody is replaced with a part of another mammal antibody. An antibody is composed of an Fc region, a Fab region, and a hinge region as described below. As a specific example of such a chimeric antibody, there can be mentioned a chimeric antibody in which the Fc region is derived from a human antibody and the Fab region is derived from another mammal antibody. The hinge region is derived from either of a human antibody and another mammal antibody. Conversely, there can be mentioned a chimeric antibody in which the Fc region is derived from another mammal and the Fab region is derived from a human antibody. The hinge region is derived from either of a human antibody and another mammal antibody.

[0400] In addition, an antibody can also be said to be composed of a variable region and a constant region. As another specific example of a chimeric antibody, there can be mentioned a chimeric antibody in which the constant region of a heavy chain (C H ) and the constant region of a light chain (C L ) are derived from a human antibody and the variable region of a heavy chain (V H ) and the variable region of a light chain (V L ) are derived from another mammal antibody, and conversely, a chimeric antibody in which the constant region of a heavy chain (C H ) and the constant region of a light chain (C L ) are derived from another mammal antibody and the variable region of a heavy chain (V H ) and the variable region of a light chain (V L ) are derived from a human antibody. Here, the biological species of another mammal is not particularly limited as long as it is a mammal other than a human, and is preferably a mouse, a rat, a rabbit, a horse, or a primate other than a human, for example, a mouse.

[0401] The antibody in one embodiment of the present application has a basic structure composed of a total of 4 polypeptide chains of 2 immunoglobulin light chains (or simply "light chains") and 2 immunoglobulin heavy chains (or simply "heavy chains"). However, when referred to as an "antibody" in the present application, the following antibodies are also included in the "antibody" of the present application in addition to the antibody having the basic structure:

[0402] (1) an antibody composed of a total of 2 polypeptide chains of 1 light chain and 1 heavy chain;

[0403] (2) an antibody composed of a Fab region and an antibody composed of a total or a part of a Fab region and a hinge region (including Fab, F(ab'), and F(ab')2) in which the Fc region is deleted from the basic structure of an antibody in the original sense;

[0404] (3) a single-chain antibody in which a linker sequence is bound to the C-terminal side of a light chain, and further a heavy chain is bound to the C-terminal side thereof;

[0405] (4) a single-chain antibody in which a linker sequence is bound to the C-terminal side of a heavy chain, and further a light chain is bound to the C-terminal side thereof.

[0406] (5) an antibody in which a Fab region is deleted from the basic structure of an antibody in the original sense, and which is composed of an Fc region and the amino acid sequence of which is altered to have a property of specifically binding to a particular antigen (Fc antibody);

[0407] (6) a single domain antibody described later.

[0408] The antibody in one embodiment of the present application is an antibody derived from a camelid (including a llama). The antibody of a camelid has a structure composed of 2 heavy chains connected by a disulfide bond. This antibody composed of 2 heavy chains is referred to as a heavy chain antibody. VHH is an antibody composed of 1 heavy chain containing a variable region of a heavy chain constituting a heavy chain antibody, or an antibody composed of 1 heavy chain in which a constant region (CH) constituting a heavy chain antibody is deleted. VHH is also one of the antibodies in the embodiment of the present application. Furthermore, an antibody composed of 2 light chains connected by a disulfide bond is also one of the antibodies in the embodiment of the present application. This antibody composed of 2 light chains is referred to as a light chain antibody. An antibody in which a mutation is added to the amino acid sequence of the antibody of a camelid in order to reduce antigenicity when the antibody derived from a camelid (including VHH) is administered to a human is also an antibody in one embodiment of the present application. When a mutation is added to the amino acid of the antibody of a camelid, the same mutation as that which can be added to the antibody described in the present specification can be added.

[0409] The antibody in one embodiment of the present application is an antibody derived from a shark. The antibody of a shark has a structure composed of 2 heavy chains connected by a disulfide bond. This antibody composed of 2 heavy chains is referred to as a heavy chain antibody. VNAR is an antibody composed of 1 heavy chain containing a variable region of a heavy chain constituting a heavy chain antibody, or an antibody composed of 1 heavy chain in which a constant region (CH) constituting a heavy chain antibody is deleted. VNAR is also one of the antibodies in the embodiment of the present application. An antibody in which a mutation is added to the amino acid sequence of the antibody of a shark in order to reduce antigenicity when the antibody derived from a shark (including VNAR) is administered to a human is also an antibody in one embodiment of the present application. When a mutation is added to the amino acid of the antibody of a shark, the same mutation as that which can be added to the antibody described in the present specification can be added. An antibody in which the antibody of a shark is humanized is also one of the antibodies in the embodiment of the present application.

[0410] An antibody having a basic structure composed of 2 light chains and 2 heavy chains, a total of 4 polypeptide chains, has 3 complementarity determining regions (CDRs) in a variable region of a light chain (V L ) and 3 complementarity determining regions (CDRs) in a variable region of a heavy chain (V H). The three CDRs of the light chain are referred to as CDR1, CDR2 and CDR3, in order from the N- terminal side. The three CDRs of the heavy chain are referred to as CDR1, CDR2 and CDR3, in order from the N-terminal side. Of these CDRs, a part or all of them are included in the antibody even if they are not complete or are absent, as long as they have the property of specifically binding to a particular antigen. The variable region of the light chain (V L and V H Regions other than the CDRs in the antibody of the present application are referred to as framework regions (FRs). The FRs are referred to as FR1, FR2, FR3 and FR4, in order from the N-terminal side. Generally, the CDRs and FRs exist in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4, in order from the N-terminal side.

[0411] In one embodiment of the present application, an antibody formed by adding a substitution, deletion, addition or the like mutation to the amino acid sequence of the original antibody is also included in the antibody. When an amino acid in the amino acid sequence of the original antibody is substituted with another amino acid, the number of amino acids substituted is preferably 1 to 20, more preferably 1 to 5, and even more preferably 1 to 3. When an amino acid in the amino acid sequence of the original antibody is deleted, the number of amino acids deleted is preferably 1 to 20, more preferably 1 to 5, and even more preferably 1 to 3. In addition, an antibody formed by adding a mutation combining substitution and deletion of these amino acids is also an antibody. When an amino acid is added, 1 to 20, more preferably 1 to 5, and even more preferably 1 to 3 amino acids are added to the amino acid sequence of the original antibody or at the N- or C-terminus. An antibody formed by adding a mutation combining addition, substitution and deletion of these amino acids is also an antibody. The amino acid sequence of the antibody formed by adding a mutation preferably shows 80% or more identity, more preferably 85% or more identity, and even more preferably 90% or more, 95% or more, or 98% or more identity to the amino acid sequence of the original antibody.

[0412] In one embodiment of the present application, an antibody in which a substitution, deletion, addition, or the like, of an amino acid in the amino acid sequence of the variable region of the original antibody is introduced is also included in the antibody. When an amino acid in the amino acid sequence of the original antibody is substituted with another amino acid, the number of substituted amino acids is preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3. When an amino acid in the amino acid sequence of the original antibody is deleted, the number of deleted amino acids is preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3. In addition, an antibody in which a substitution and a deletion of these amino acids are combined is also included in the antibody. When an amino acid is added, 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3 amino acids are added to the amino acid sequence of the original antibody or at the N- or C-terminus. An antibody in which an addition, a substitution, and a deletion of these amino acids are combined is also included in the antibody. The amino acid sequence of the antibody in which a mutation is introduced preferably shows 80% or more identity, more preferably 85% or more identity, and even more preferably 90% or more, 95% or more, or 98% or more identity to the amino acid sequence of the original antibody. When a mutation is introduced into the variable region of the antibody, the mutation can be introduced into any of the CDR and the framework region of the variable region, and is particularly introduced into the framework region.

[0413] In one embodiment of the present application, an antibody in which a substitution, deletion, addition, or the like, of an amino acid in the amino acid sequence of the variable region of the original antibody is introduced is also included in the antibody. When an amino acid in the amino acid sequence of the original antibody is substituted with another amino acid, the number of substituted amino acids is preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3. When an amino acid in the amino acid sequence of the original antibody is deleted, the number of deleted amino acids is preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3. In addition, an antibody in which a substitution and a deletion of these amino acids are combined is also included in the antibody. When an amino acid is added, 1 to 10, more preferably 1 to 5, and even more preferably 1 to 3 amino acids are added to the amino acid sequence of the original antibody or at the N- or C-terminus. An antibody in which an addition, a substitution, and a deletion of these amino acids are combined is also included in the antibody. The amino acid sequence of the antibody in which a mutation is introduced preferably shows 80% or more identity, more preferably 85% or more identity, and even more preferably 90% or more, 95% or more, or 98% or more identity to the amino acid sequence of the original antibody. When a mutation is introduced into the variable region of the antibody, the mutation can be introduced into any of the CDR and the framework region of the variable region, and is particularly introduced into the framework region.

[0414] In one embodiment of the present application, an antibody in which a substitution, deletion, addition, or the like, of an amino acid in the amino acid sequence of the CDR region of the variable region of the original antibody is added is also included in the antibody. When an amino acid in the amino acid sequence of the original antibody is substituted with another amino acid, the number of amino acids to be substituted is preferably 1 to 5, more preferably 1 to 3, and even more preferably 1 or 2. When an amino acid in the amino acid sequence of the original antibody is deleted, the number of amino acids to be deleted is preferably 1 to 5, more preferably 1 to 3, and even more preferably 1 or 2. In addition, an antibody in which a substitution and a deletion of these amino acids are combined is also included in the antibody. When an amino acid is added, 1 to 5, more preferably 1 to 3, and even more preferably 1 or 2 amino acids are added to the amino acid sequence of the original antibody or at the N- or C-terminus. An antibody in which an addition, a substitution, and a deletion of these amino acids are combined is also included in the antibody. The amino acid sequence of the antibody to which a mutation is added preferably shows 80% or more identity, more preferably 85% or more identity, and even more preferably 90% or more, 95% or more, or 98% or more identity to the amino acid sequence of the original antibody.

[0415] The identity of the amino acid sequence of the original antibody to the amino acid sequence of the antibody to which a mutation is added can be easily calculated using a well-known homology calculation algorithm. For example, as such an algorithm, there are BLAST (Altschul SF. J Mol. Biol. 215.403-10, (1990)), the similarity search method of Pearson and Lipman (Proc. Natl. Acad. Sci. USA. 85.2444 (1988)), the local homology algorithm of Smith and Waterman (Adv. Appl. Math. 2.482-9 (1981)), and the like.

[0416] In one embodiment of the present application, Fab refers to a molecule in which one light chain including a variable region and a C L region (a constant region of a light chain) and one heavy chain including a variable region and a C H 1 region (part 1 of a constant region of a heavy chain) are bound to each other by a disulfide bond through cysteine residues present in each of them. In Fab, the heavy chain can further include a part of a hinge region in addition to the variable region and the C H 1 region (part 1 of a constant region of a heavy chain), and in this case, the hinge region lacks a cysteine residue present in the hinge region that binds the antibody heavy chains to each other. In Fab, the light chain and the heavy chain are bound to each other by a disulfide bond through a cysteine residue present in the constant region of the light chain (C L region) and the constant region of the heavy chain (C H1 region present in the hinge region. The heavy chain that forms the Fab is referred to as a Fab heavy chain. The cysteine residue present in the hinge region that binds the heavy chains of the antibody to each other is deleted in the Fab, and thus the Fab is composed of one light chain and one heavy chain. The light chain that constitutes the Fab includes a variable region and a C L 1 region. The heavy chain that constitutes the Fab can be composed of a variable region and a C H 1 region, and can also include a variable region, a C H 1 region, and a portion of the hinge region. However, in this case, in order to avoid the formation of a disulfide bond between two heavy chains via the hinge region, the hinge region is selected so as not to include the cysteine residue that binds the heavy chains to each other. In the F(ab'), the heavy chain includes, in addition to the variable region and the C H 1 region, the entire or a portion of the hinge region that includes the cysteine residue that binds the heavy chains to each other. The F(ab')2 refers to a molecule in which two F(ab')s are bound to each other by a disulfide bond via the cysteine residues present in the hinge regions of each other. The heavy chain that forms the F(ab') or the F(ab')2 is referred to as a Fab' heavy chain. In addition, a dimer, a trimer, or the like in which two or more antibodies are bound directly or via a linker is also an antibody. Furthermore, not limited to these, an antibody that includes a portion of an antibody molecule and has the property of specifically binding to an antigen is also included in the "antibody" referred to in the present application. That is, when referred to as a light chain in the present application, it includes one from a light chain and having all or a portion of the amino acid sequence of the variable region thereof. In addition, when referred to as a heavy chain, it includes one from a heavy chain and having all or a portion of the amino acid sequence of the variable region thereof. Thus, as long as it has all or a portion of the amino acid sequence of the variable region, for example, one in which the Fc region is deleted is also a heavy chain.

[0417] In addition, here, the Fc or the Fc region refers to a region of a fragment in an antibody molecule that includes C H 2 region (part 2 of the constant region of the heavy chain) and C H 3 region (part 3 of the constant region of the heavy chain).

[0418] Further, the antibody of one embodiment of the present application also includes (7) a single-chain antibody (scFab, scF(ab'), and scF(ab')2) in which the light chain and the heavy chain constituting the Fab, F(ab'), or F(ab')2of the above (2) are combined by means of a linker sequence. Here, the scFab, scF(ab'), and scF(ab')2may be an antibody in which a linker sequence is combined at the C-terminal side of the light chain, and further a heavy chain is combined at the C-terminal side thereof, or can be an antibody in which a linker sequence is combined at the C-terminal side of the heavy chain, and further a light chain is combined at the C-terminal side thereof. Further, a scFv in which the variable region of the light chain and the variable region of the heavy chain are combined by means of a linker sequence to form a single-chain antibody is also included in the antibody of the present application. The scFv can be an antibody in which a linker sequence is combined at the C-terminal side of the variable region of the light chain, and further a variable region of a heavy chain is combined at the C-terminal side thereof, or can be an antibody in which a linker sequence is combined at the C-terminal side of the variable region of the heavy chain, and further a variable region of a light chain is combined at the C-terminal side thereof.

[0419] Further, the "antibody" in the present specification includes any of antigen-binding fragments (antibody fragments) in which a part of a full-length antibody is deleted, in addition to the full-length antibody and the antibodies of the above (1) to (7), as a more general concept including (1) to (7). The antigen-binding fragments include heavy chain antibodies, light chain antibodies, VHH, VNAR, and fragments in which a part of these is deleted.

[0420] The term "antigen-binding fragment" refers to an antibody fragment in which at least a part of the specific binding activity to an antigen is maintained. Examples of the binding fragment include Fab, Fab', F(ab')2, a variable region (Fv), a single-chain antibody (scFv) in which a heavy chain variable region (V H ) and a light chain variable region (V L ) are connected by means of a suitable linker, a diabody which is a dimer of a polypeptide including the heavy chain variable region (V H ) and the light chain variable region (V L ), a minibody which is a dimer in which a part of a constant region (C H 3) is combined on a heavy chain (H chain) of the scFv, other low-molecular-weight antibodies, and the like. However, as long as the binding ability to an antigen is possessed, it is not limited to these molecules.

[0421] In one embodiment of the present application, a "single-chain antibody" refers to a protein in which a linker sequence is bound to the C-terminal side of the entire or a part of the amino acid sequence of the variable region of the light chain, and further, an amino acid sequence of the entire or a part of the variable region of the heavy chain is bound to the C-terminal side thereof, and which is capable of specifically binding to a specific antigen. Also, a protein in which a linker sequence is bound to the C-terminal side of the entire or a part of the amino acid sequence of the variable region of the heavy chain, and further, an amino acid sequence of the entire or a part of the variable region of the light chain is bound to the C-terminal side thereof, and which is capable of specifically binding to a specific antigen is also a "single-chain antibody" in the present application. In a single-chain antibody in which the light chain is bound to the C-terminal side of the heavy chain via a linker sequence, generally, the heavy chain lacks the Fc region. The variable region of the light chain has three complementarity determining regions (CDRs) related to the antigen specificity of the antibody. Also, the variable region of the heavy chain has three CDRs. These CDRs are the main regions that determine the antigen specificity of the antibody. Therefore, the single-chain antibody preferably contains all three heavy chain CDRs and all three light chain CDRs. However, as long as the antigen specificity affinity of the antibody is maintained, it can also be a single-chain antibody in which one or more CDRs are deleted.

[0422] In the single-chain antibody, the linker sequence disposed between the light chain and the heavy chain of the antibody is a peptide chain composed of preferably 2 to 50, more preferably 8 to 50, further preferably 10 to 30, and still further preferably 12 to 18 or 15 to 25, for example, 15 or 25 amino acid residues. Such a linker sequence is not limited in the amino acid sequence as long as the affinity to hTfR is maintained in the anti-hTfR antibody formed by linking the two chains with the linker, and is preferably composed of only glycine or glycine and serine, for example, contains the amino acid sequence Gly-Ser, the amino acid sequence Gly-Gly-Ser, the amino acid sequence Gly-Gly-Gly, the amino acid sequence Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 58), the amino acid sequence Gly-Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 59), the amino acid sequence Ser-Gly-Gly-Gly-Gly (SEQ ID NO: 60), or a sequence formed by repeating these amino acid sequences 2 to 10 times or 2 to 5 times. For example, in the case where the variable region of the heavy chain is bound to the C-terminal side of the entire region of the amino acid sequence of the variable region of the light chain via a linker sequence, a linker sequence containing a total of 15 amino acids, which is equivalent to a sequence in which three amino acid sequences Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 58) are continuous, is preferable.

[0423] In one embodiment of the present application, a single domain antibody refers to an antibody in which a single variable region has a property of specifically binding to an antigen. The single domain antibody includes an antibody in which a variable region is composed of only a variable region of a heavy chain (heavy chain single domain antibody) and an antibody in which a variable region is composed of only a variable region of a light chain (light chain single domain antibody). VHH, VNAR is one of the single domain antibodies.

[0424] In one embodiment of the present application, the term "human transferrin receptor" refers to a membrane protein having the amino acid sequence shown in SEQ ID NO: 57. The antibody of the present application specifically binds to a portion from a cysteine residue at the 89th position on the N-terminal side to a phenylalanine on the C-terminal side in the amino acid sequence shown in SEQ ID NO: 57 (extracellular region of the transferrin receptor) in one embodiment, but is not limited thereto.

[0425] As a method for producing an antibody against a desired protein, there is generally a method of producing a recombinant protein using a cell into which an expression vector in which a gene encoding the protein is integrated is introduced, immunizing an animal such as a mouse with the recombinant protein, and obtaining the same. A cell producing an antibody against the recombinant protein can be obtained from the animal after immunization, fused with a myeloma cell, and a hybridoma cell having the ability to produce an antibody against the recombinant protein can be produced.

[0426] In addition, by immunizing an immune system cell obtained from an animal such as a mouse with a desired protein using an in vitro immunization method, a cell producing an antibody against the protein can also be obtained. When the in vitro immunization method is used, the animal species from which the immune system cell is derived is not particularly limited, and is preferably a mouse, a rat, a rabbit, a guinea pig, a dog, a cat, a horse, and a primate including a human, and more preferably a mouse, a rat, and a human, and further preferably a mouse and a human. As the immune system cell of a mouse, for example, a spleen cell prepared from the spleen of a mouse can be used. As the immune system cell of a human, a cell prepared from the peripheral blood, bone marrow, spleen, or the like of a human can be used. When the immune system cell of a human is immunized by the in vitro immunization method, a human antibody against the recombinant protein can be obtained.

[0427] After the immune system cell is immunized by the in vitro immunization method, the cell is fused with a myeloma cell, and a hybridoma cell having an antibody-producing ability can be produced. In addition, mRNA can be extracted from the cell after immunization, cDNA can be synthesized, a DNA fragment containing a gene encoding a light chain and a heavy chain of an immunoglobulin can be amplified by a PCR reaction using the cDNA as a template, and these artificially reconstructed antibody genes can be used.

[0428] The hybridoma cell obtained by the above-described method also contains a cell producing an antibody recognizing a protein other than the target as an antigen. In addition, the hybridoma cell producing an antibody against a desired protein does not necessarily produce an antibody exhibiting a desired property such as a high affinity for the protein.

[0429] Likewise, artificially reconstituted antibody genes also include genes encoding antibodies that recognize proteins other than the target protein as antigens. In addition, genes encoding antibodies against the desired protein are not necessarily all genes encoding antibodies exhibiting desired properties such as high affinity for the protein.

[0430] Therefore, a step of selecting hybridoma cells producing antibodies having desired properties from the hybridoma cells obtained as described above is required. In addition, for artificially reconstituted antibody genes, a step of selecting genes encoding antibodies having desired properties from the antibody genes is required. For example, as a method of selecting hybridoma cells producing antibodies having high affinity for a desired protein (high-affinity antibodies), or genes encoding high-affinity antibodies, the method to be described below is effective.

[0431] For example, in selecting hybridoma cells producing antibodies having high affinity for a desired protein, the following method is used: after the protein is added to a plate and allowed to remain, culture supernatant of hybridoma cells is added, and then antibodies that have not bound to the protein are removed from the plate, and the amount of antibodies remaining on the plate is measured. According to this method, the higher the affinity of the antibodies contained in the culture supernatant of hybridoma cells added to the plate for the protein, the more antibodies remain on the plate. Therefore, the amount of antibodies remaining on the plate can be measured, and hybridoma cells corresponding to the plate on which more antibodies remain are selected as a cell strain producing antibodies having relatively high affinity for the protein. By extracting mRNA from the cell strain thus selected and synthesizing cDNA, using the cDNA as a template, and amplifying a DNA fragment containing a gene encoding an antibody against the protein using PCR, a gene encoding a high-affinity antibody can also be isolated.

[0432] When selecting a gene encoding an antibody having high affinity against a target protein from the artificially reconstituted antibody genes described above, the artificially reconstituted antibody genes can be temporarily integrated into an expression vector, and the expression vector can be introduced into a host cell. At this time, as a cell used as a host cell, as long as it is a cell that can express an antibody gene by introduction of an expression vector into which an artificially reconstituted antibody gene is integrated, either a prokaryotic cell or a eukaryotic cell can be used without particular limitation, and a cell derived from a mammal such as a human, a mouse, or a Chinese hamster is preferred, and a CHO cell derived from a Chinese hamster ovary or an NS / 0 cell derived from a mouse myeloma is particularly preferred. In addition, the expression vector used for integration and expression of a gene encoding an antibody gene can be used without particular limitation as long as it is an expression vector that can express the gene when introduced into a mammal cell. The gene integrated into the expression vector is disposed downstream of a DNA sequence (gene expression regulatory site) that can regulate the frequency of transcription of a gene in a mammal cell. As a gene expression regulatory site that can be used in the present application, a promoter derived from a cytomegalovirus, an SV40 early promoter, a human elongation factor-1 alpha (EF-1 alpha) promoter, a human ubiquitin C promoter, and the like can be exemplified.

[0433] A mammal cell into which such an expression vector is introduced can express the artificially reconstituted antibody integrated into the expression vector described above. When selecting a cell producing an antibody having high affinity against a desired protein from the cells thus obtained that express an artificially reconstituted antibody, the following method is used: the protein is added to a plate and allowed to remain, the culture supernatant of the cell is brought into contact with the protein, and then the antibody not bound to the protein is removed from the plate, and the amount of the antibody remaining on the plate is measured. According to this method, the higher the affinity of the antibody contained in the culture supernatant of the cell to the protein, the more the amount of the antibody remaining on the plate. Therefore, the amount of the antibody remaining on the plate can be measured, and a cell corresponding to a plate on which more antibody remains can be selected as a cell strain producing an antibody having relatively high affinity to the protein, and further a gene encoding an antibody having high affinity to the protein can be selected. From the cell strain thus selected, a DNA fragment containing a gene encoding an antibody against the protein can be amplified using a PCR method, and thus a gene encoding a high-affinity antibody can also be isolated.

[0434] As a method for producing a conjugate of the hNAGLU mutant of the present application and an antibody, there are a method of conjugating them with a non-peptide linker or a peptide linker. As the non-peptide linker, polyethylene glycol, polypropylene glycol, a copolymer of ethylene glycol and propylene glycol, polyoxyethylated polyol, polyvinyl alcohol, polysaccharides, dextran, polyvinyl ether, a biodegradable polymer, a lipid polymer, chitin, hyaluronic acid, or a derivative of these, or a combination of these can be used. The peptide linker is a peptide chain composed of 1 to 50 amino acids or a derivative thereof, and forms a covalent bond with either the hNAGLU mutant or the antibody at the N-terminus and the C-terminus, respectively, thereby conjugating the hNAGLU mutant and the antibody.

[0435] The antibody and the hNAGLU mutant can be conjugated at the N-terminus or the C-terminus of the hNAGLU mutant to the C-terminal side or the N-terminal side of the heavy chain or the light chain of the antibody with a linker or directly with a peptide bond. The conjugate formed by conjugating the antibody and the hNAGLU mutant in this way can be obtained in the form of a fusion protein by placing the cDNA encoding the hNAGLU mutant in frame at the 3'-terminal side or the 5'-terminal side of the cDNA encoding the heavy chain or the light chain of the antibody, directly or with a DNA fragment encoding a linker sequence interposed, integrating the resulting DNA fragment into an expression vector for mammalian cells, and culturing mammalian cells into which the expression vector has been introduced. In the case where the DNA fragment encoding the hNAGLU mutant is conjugated to the heavy chain in the mammalian cells, an expression vector for mammalian cells into which a cDNA fragment encoding the light chain of the antibody has been integrated can also be introduced into the same host cells, and, in the case where the DNA fragment encoding the hNAGLU mutant is conjugated to the light chain, an expression vector for mammalian cells into which a cDNA fragment encoding the heavy chain of the antibody has been integrated can also be introduced into the same host cells. In the case where the antibody is a single-chain antibody, a fusion protein formed by conjugating the antibody and the hNAGLU mutant can be obtained by ligating a cDNA encoding the single-chain antibody at the 5'-terminal side or the 3'-terminal side of the cDNA encoding the hNAGLU mutant, directly or with a DNA fragment encoding a linker sequence interposed, integrating the resulting DNA fragment into an expression vector for (mammalian cells, eukaryotic cells such as yeast, or prokaryotic cells such as E. coli), and expressing in these cells into which the expression vector has been introduced, thereby obtaining. The fusion protein of the antibody and the hNAGLU mutant can be produced in the form of a recombinant protein by the above-described method.

[0436] As a culture medium for culturing the mammalian cells into which the expression vector has been introduced, any medium that can culture the mammalian cells and proliferate them can be used without particular limitation, and a serum-free medium is preferably used. In the present application, as a serum-free medium used as a culture medium for production of a recombinant protein, a medium containing, for example, amino acids 3 to 700 mg / L, vitamins 0.001 to 50 mg / L, monosaccharides 0.3 to 10 g / L, inorganic salts 0.1 to 10,000 mg / L, trace elements 0.001 to 0.1 mg / L, nucleosides 0.1 to 50 mg / L, fatty acids 0.001 to 10 mg / L, biotin 0.01 to 1 mg / L, hydrocortisone 0.1 to 20 mg / L, insulin 0.1 to 20 mg / L, vitamin B12 0.1 to 10 mg / L, putrescine 0.01 to 1 mg / L, sodium pyruvate 10 to 500 mg / L, and a water-soluble iron compound can be appropriately used. If desired, thymidine, hypoxanthine, a commonly used pH indicator, and an antibiotic, etc. can also be added to the medium.

[0437] As a serum-free medium used as a culture medium for production of a fusion protein of an antibody and an hNAGLU mutant, DMEM / F12 medium (a mixed medium of DMEM and F12) can be used as a basic medium, and each of these media is well known to those skilled in the art. Further, as a serum-free medium, DMEM (HG) HAM modified (R5) medium containing sodium bicarbonate, L-glutamine, D-glucose, insulin, sodium selenate, diaminobutane, hydrocortisone, iron (II) sulfate, asparagine, aspartic acid, serine, and polyvinyl alcohol can also be used. Further, commercially available serum-free media, such as CD OptiCHO medium (Thermo Fisher Scientific, formerly Life Technologies), IS cho-V medium (Irvine Scientific), EX-CELL 302 medium (JRH Biosciences), EX-CELL 325-PF medium (SAFC Biosciences), etc. can also be used as a basic medium. TM Culture medium, CHO-S-SFMII medium, or CD CHO medium (Thermo Fisher Scientific, formerly Life Technologies), IS cho-V TM Culture medium (Irvine Scientific), EX-CELL TM 302 medium, or EX-CELL TM 325-PF medium (SAFC Biosciences), etc. can be used as a basic medium.

[0438] As preferred embodiments of a fusion protein of an antibody and an hNAGLU mutant, the following (1) to (7) can be cited. That is:

[0439] (1) a fusion protein containing a conjugate of an hNAGLU mutant directly or via a linker conjugated to the C-terminus of a heavy chain of an antibody, and a light chain of the antibody;

[0440] (2) a fusion protein containing a conjugate of a hNAGLU mutant directly or via a linker at the N-terminus of the heavy chain of an antibody, and a light chain of the antibody;

[0441] (3) a fusion protein containing a conjugate of a hNAGLU mutant directly or via a linker at the C-terminus of the light chain of an antibody, and a heavy chain of the antibody;

[0442] (4) a fusion protein containing a conjugate of a hNAGLU mutant directly or via a linker at the N-terminus of the light chain of an antibody, and a heavy chain of the antibody.

[0443] When the antibody and the hNAGLU mutant are conjugated via a linker sequence, the linker sequence disposed between the antibody and the hNAGLU mutant is a peptide chain composed of preferably 1 to 60 or 1 to 50, more preferably 1 to 17, further preferably 1 to 10, and still further preferably 1 to 5 amino acids, and the number of amino acids constituting the linker sequence can be appropriately adjusted to 1, 2, 3, 1 to 17, 1 to 10, 10 to 40, 20 to 34, 23 to 31, 25 to 29, 27, etc. Such a linker sequence is not limited in the amino acid sequence as long as it can maintain the affinity of the antibody to which it is linked to the receptor on the brain vascular endothelial cell and the hNAGLU mutant linked by the linker sequence can exert the physiological activity of the hNAGLU mutant under physiological conditions, and is preferably a linker composed of glycine and serine. Examples of the linker include a linker composed of any one of glycine or serine, a linker containing the amino acid sequence Gly-Ser, the amino acid sequence Ser-Ser, the amino acid sequence Gly-Gly-Ser, the amino acid sequence Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 58), the amino acid sequence Gly-Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 59), the amino acid sequence Ser-Gly-Gly-Gly-Gly (SEQ ID NO: 60), or a linker formed by 1 to 10 or 2 to 5 of these amino acid sequences in series. The linker has a sequence composed of 1 to 50 amino acids, a sequence composed of 2 to 17, 2 to 10, 10 to 40, 20 to 34, 23 to 31, 25 to 29, or 27 amino acids, etc. For example, a linker containing the amino acid sequence Gly-Ser can be appropriately used as the linker sequence. In addition, a linker containing a total of 27 amino acid sequences formed by 5 amino acid sequences Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 58) in series after the amino acid sequence Gly-Ser can be appropriately used as the linker sequence. Further, a linker containing a total of 25 amino acid sequences formed by 5 amino acid sequences Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 58) in series can also be appropriately used as the linker sequence.

[0444] Note that in the present application, when one peptide chain contains two or more linker sequences, each linker sequence is named as the 1st linker sequence, the 2nd linker sequence, and so on, in order from the N-terminal side.

[0445] As a specific example of the antibody to be combined with the hNAGLU mutant of the present application, the following anti-human transferrin receptor antibody (anti-hTfR antibody) can be cited. That is,

[0446] (1) An anti-hTfR antibody, wherein the light chain of the antibody contains the amino acid sequence of SEQ ID NO: 61, and the heavy chain contains the amino acid sequence of SEQ ID NO: 62; and

[0447] (2) An anti-hTfR antibody, which is also a Fab antibody, wherein the light chain of the antibody contains the amino acid sequence of SEQ ID NO: 61, and the heavy chain contains the amino acid sequence of SEQ ID NO: 63.

[0448] However, these are not limiting, and a substitution, deletion, addition, or the like, can be appropriately added to the above-described amino acid sequence. Note that the anti-hTfR antibody of the above (1) and (2) is a humanized anti-hTfR antibody.

[0449] When the amino acid of the amino acid sequence of the light chain of the above-described anti-human transferrin receptor antibody is substituted with another amino acid, the number of amino acids to be substituted is preferably 1 to 10, more preferably 1 to 5, further preferably 1 to 3, and even more preferably 1 or 2. When the amino acid of the amino acid sequence of the light chain is deleted, the number of amino acids to be deleted is preferably 1 to 10, more preferably 1 to 5, further preferably 1 to 3, and even more preferably 1 or 2. In addition, a mutation combining substitution and deletion of these amino acids can also be added.

[0450] When an amino acid is added to the amino acid sequence of the light chain of the above-described anti-human transferrin receptor antibody, 1 to 10, more preferably 1 to 5, further preferably 1 to 3, and even more preferably 1 or 2 amino acids are added to the amino acid sequence of the light chain, or on the N-terminal side or the C-terminal side. A mutation combining addition, substitution, and deletion of these amino acids can also be added. The amino acid sequence of the light chain to which the mutation is added preferably has 80% or more identity, more preferably shows 90% or more identity, and further preferably shows 95% or more identity, to the original amino acid sequence of the light chain.

[0451] When the amino acid of the amino acid sequence of the heavy chain of the above-described anti-human transferrin receptor antibody is substituted with another amino acid, the number of substituted amino acids is preferably 1 to 10, more preferably 1 to 5, further preferably 1 to 3, and still more preferably 1 or 2. When the amino acid of the amino acid sequence of the heavy chain is deleted, the number of deleted amino acids is preferably 1 to 10, more preferably 1 to 5, further preferably 1 to 3, and still more preferably 1 or 2. In addition, a mutation combining substitution and deletion of these amino acids can be added.

[0452] When an amino acid is added to the amino acid sequence of the heavy chain of the above-described anti-human transferrin receptor antibody, 1 to 10, more preferably 1 to 5, further preferably 1 to 3, and still more preferably 1 or 2 amino acids are added to the amino acid sequence of the heavy chain on either the N-terminal side or the C-terminal side. A mutation combining addition, substitution, and deletion of these amino acids can be added. The amino acid sequence of the heavy chain to which the mutation is added preferably has 80% or more identity, more preferably shows 90% or more identity, and further preferably shows 95% or more identity to the original amino acid sequence of the heavy chain.

[0453] The hNAGLU mutant of the present application can function in the brain by passing through the blood-brain barrier by binding to an antibody against a receptor on a cerebral vascular endothelial cell, and thus can be used for the production of a blood administration agent for treating a disease state of the central nervous system caused by NAGLU deficiency. In addition, the hNAGLU mutant to which the antibody is bound can be used for a therapeutic method including the step of administering a therapeutically effective amount of blood administration (including intravenous injection such as intravenous drip infusion) to a patient eligible for a disease state of the central nervous system caused by NAGLU deficiency. The hNAGLU mutant to which the antibody is bound after blood administration can reach not only the brain but also other organs / organ systems expressing NAGLU. In addition, the agent can also be used for preventing the onset of the disease state.

[0454] The hNAGLU mutant of the present application can be used as an agent to be administered to blood and to exert a pharmaceutical effect in the central nervous system (CNS) by binding to an antibody against a receptor on a cerebral vascular endothelial cell. The agent is usually administered to a patient by intravenous injection, subcutaneous injection, intramuscular injection, or the like using intravenous drip infusion or the like, but the administration route is not particularly limited.

[0455] The hNAGLU mutant in one embodiment of the present application is not limited to being bound to an antibody, and can be made into a conjugate with another protein. The other protein is not particularly limited, and is, for example, a protein of human origin. The conjugate of the hNAGLU mutant and the other protein can be obtained by the method described above for producing a conjugate of the hNAGLU mutant and an antibody. In addition, a fusion protein of the hNAGLU mutant and the other protein can be obtained in the form of a recombinant protein by the method described above for producing a fusion protein with an antibody. In one embodiment of the present application, there are included a gene encoding a fusion protein of the hNAGLU mutant and the other protein, an expression vector into which the gene is integrated, and a host cell into which the expression vector is introduced.

[0456] The hNAGLU mutant in one embodiment of the present application is not limited to an anti-hTfR antibody, and can be a conjugate of a substance capable of binding to human hTfR. The substance is not particularly limited, and is, for example, human transferrin. Human transferrin is not limited to wild type, and can be a partial fragment, a mutant thereof as long as it has affinity to hTfR. Such a conjugate is capable of passing through the blood-brain barrier and exerting a function in the brain. A fusion protein of the hNAGLU mutant and human transferrin can be obtained in the form of a recombinant protein by the method described above for producing a fusion protein with an antibody. In one embodiment of the present application, there are included a gene encoding a fusion protein of the hNAGLU mutant and human transferrin, an expression vector into which the gene is integrated, and a host cell into which the expression vector is introduced.

[0457] Example

[0458] The present application is further explained in detail below with reference to examples, but the present application is not intended to be limited by the examples.

[0459] [Example 1] Construction of an expression vector for a hNAGLU mutant

[0460] A DNA fragment having the base sequence shown in SEQ ID NO: 41 was synthesized. Using this as a template, PCR was performed using the MluI addition 5' primer having the base sequence shown in SEQ ID NO: 42 as a forward primer and the primers shown in Table 1 as reverse primers, and No. 1 to 7 and 11 shown in Table 1. Table 1 shows the sequence numbers corresponding to the base sequences of the respective reverse primers.

[0461] [Table 1]

[0462] Table 1 Primers used in PCR

[0463]

[0464] Next, as a template, a DNA fragment having the base sequence shown in SEQ ID NO: 41 was used, as a forward primer, a PCR product obtained by PCR of Nos. 1 to 7 and 11 shown in Table 1 was used, and as a reverse primer, a His tag-Notl addition 3' primer having the base sequence shown in SEQ ID NO: 43 was used, and PCR was performed, and a PCR product containing a gene encoding an hNAGLU mutant shown in Table 2 was obtained. Table 2 shows the sequence number corresponding to the amino acid sequence of each hNAGLU mutant, the sequence number corresponding to the base sequence encoding the same, and the number of each hNAGLU mutant (mutant number).

[0465] [Table 2]

[0466] Table 2 Name of PCR product

[0467]

[0468] As a template, a DNA fragment having the base sequence shown in SEQ ID NO: 41 containing a wild-type hNAGLU gene was used, as a forward primer, a primer shown in Table 3 was used, and as a reverse primer, a His tag-Notl addition 3' primer having the base sequence shown in SEQ ID NO: 43 was used, and PCR of Nos. 8 to 10 shown in Table 3 was performed. Table 3 shows the sequence number corresponding to the base sequence of each forward primer.

[0469] [Table 3]

[0470] Table 3 Primer used in PCR

[0471]

[0472] Next, as a template, a DNA fragment having the base sequence shown in SEQ ID NO: 41 was used, as a forward primer, a Mlul addition 5' primer having the base sequence shown in SEQ ID NO: 42 was used, and as a reverse primer, a PCR product obtained by PCR of Nos. 8 to 10 shown in Table 3 was used, and PCR was performed, and a PCR product containing a gene encoding an hNAGLU mutant shown in Table 4 was obtained. Table 4 shows the sequence number corresponding to the amino acid sequence of each hNAGLU mutant, the sequence number corresponding to the base sequence encoding the same, and the number of each hNAGLU mutant (mutant number).

[0473] [Table 4]

[0474] Table 4 Name of PCR product

[0475]

[0476] Next, the PCR products obtained by the PCR of Nos. 1 to 11 and the DNA fragment having the base sequence shown in SEQ ID NO: 41 encoding the wild-type hNAGLU were subjected to restriction enzyme treatment with MluI and NotI (Takara Bio Inc.), and were separated by agarose gel electrophoresis. After EtBr staining, the band containing the target DNA fragment was excised under UV irradiation, and the DNA was extracted from the gel using a QIAEXII Gel Extraction Kit (QIAGEN). Similarly, the pCI-neo vector (Promega), the pEI-puro vector were also subjected to restriction enzyme treatment, gel extraction, and purification with MluI and NotI. Each of the restriction enzyme-treated PCR products was mixed with each of the restriction enzyme-treated vectors, and a ligation reaction was performed using Ligation Mix (Takara Bio Inc.) at 16°C for 30 to 60 minutes. The ligation reaction was also performed for the DNA fragment having the base sequence shown in SEQ ID NO: 41 containing the wild-type hNAGLU gene.

[0477] Note that the pEI-puro vector was produced according to the following steps. The pEF / myc / nuc vector (Invitrogen) was digested with restriction enzymes (KpnI and Ncol) to excise a DNA fragment containing an EF-1a promoter and its first intron, and the DNA fragment was subjected to blunt-end treatment with T4 DNA polymerase. Separately, the pCI-neo (Invitrogen) was digested with restriction enzymes (BglII and EcoRI) to excise a region containing a CMV enhancer / promoter and an intron, and subjected to blunt-end treatment with T4 DNA polymerase. The above-described region containing the EF-1a promoter and its first intron (the product of the blunt-end treatment) was inserted therein. This was designated as the pE-neo vector. The pCAGIpuro vector (Miyahara M. et. al., J. Biol. Chem. 275, 613-618 (2000)) was digested with restriction enzymes (NotI and BamHI) to excise a DNA fragment containing an internal ribosome entry site (IRES) from a mouse encephalomyocarditis virus (EMCV), a puromycin resistance gene (PuroR), and a polyadenylation signal (polyA) from a bovine growth hormone (bGH). Separately, the pE-neo vector was digested with restriction enzymes (NotI and BamHI) to excise a region of about 2 kbp containing a neomycin resistance gene (NeoR). The above-described DNA fragment containing the IRES, PuroR, and bGH-derived polyA was inserted therein. This was designated as the pEI-puro vector. r ) and a polyadenylation signal (polyA) from a bovine growth hormone (bGH). Separately, the pE-neo vector was digested with restriction enzymes (NotI and BamHI) to excise a region of about 2 kbp containing a neomycin resistance gene (Neo r ) and a polyadenylation signal (polyA) from a bovine growth hormone (bGH). Separately, the pE-neo vector was digested with restriction enzymes (NotI and BamHI) to excise a region of about 2 kbp containing a neomycin resistance gene (Neo

[0478] Next, each of the ligation reaction solutions was used to transform Escherichia coli (E. coli) (ECOS TMX Competent E. coli DH5a (Nippon Gene Co., Ltd.). To confirm whether the obtained transformant retains the target plasmid DNA, a single colony was cultured in LB Broth (Sigma-Aldrich Co., Ltd.) overnight, and the plasmid DNA was purified in a small amount using a FastGene Plasmid Miniprep Kit (Japan Genetics Co., Ltd.). The purified plasmid DNA was subjected to restriction enzyme treatment with Mlul and Notl, and separated by agarose gel electrophoresis, thereby confirming the insertion of the target insert DNA. In addition, it was confirmed by Sanger sequencing analysis that the target alteration had been introduced into each hNAGLU gene. For each plasmid in which it had been confirmed that the target hNAGLU mutant or wild-type hNAGLU was integrated, purification was performed by a conventional method.

[0479] [Example 2] Transient expression of hNAGLU mutants

[0480] Transient expression of hNAGLU mutants was performed using the plasmids in which the genes encoding each hNAGLU mutant were integrated in the purified pCI-neo vector obtained in Example 1. As a control, a plasmid in which the gene encoding wild-type NAGLU was integrated in the pCI-neo vector was used.

[0481] ExpiCHO cells were transformed with the plasmid in which the gene encoding the hNAGLU mutant was integrated and the plasmid in which the gene encoding wild-type hNAGLU was integrated, according to the high titer protocol of the ExpiCHO Expression System (Thermo Fisher Scientific, Inc.). After transformation, the cells were cultured for 8 days, and each hNAGLU mutant and wild-type hNAGLU was expressed in the culture supernatant. After the culture, the culture solution was subjected to centrifugal separation, and the culture supernatant was recovered.

[0482] [Example 3] Confirmation of the expression amount of hNAGLU mutants based on transient expression (SDS page electrophoresis)

[0483] The culture supernatant obtained in Example 2, 10 μL, was mixed with 8 μL of 2x sample buffer (Bio-Rad) and 2 μL of 2-mercaptoethanol, and heat-denatured under reducing conditions at 100°C for 3 minutes. Five μL of the heat-denatured sample was applied to each well of a 5-20% polyacrylamide gel set in a 50 mM Tris buffer / 380 mM glycine buffer (pH 8.3) containing 0.1% SDS, and electrophoresed at a constant current of 25 mA. The electrophoresed gel was immersed in Oriole fluorescent gel stain (Bio-Rad) and shaken at room temperature for 90 minutes. The gel was washed with pure water, and the protein bands were detected with a luminescent imaging analyzer (Amersham Imager 600RGB, GE Healthcare).

[0484] [Example 4] Confirmation of the expression amount of the hNAGLU mutant based on transient expression (Western blotting)

[0485] The electrophoresis was performed in the same manner as described in Example 3, and the nitrocellulose membrane and the electrophoresed gel were sandwiched with blotting paper immersed in a 25 mM Tris buffer / 192 mM glycine buffer containing 20% methanol, and electric current was passed at 1.0 A and 25 V for 10 minutes in a blotting apparatus, thereby transferring the proteins to the nitrocellulose membrane. After the transferred nitrocellulose membrane was immersed and shaken in PBST containing 5% skim milk for 1 hour, it was immersed in a solution of mouse anti-His tag mAb (Medical & Biological Laboratories) diluted to 0.4 μg / mL and shaken for 1 hour. After the membrane was washed with PBST, it was immersed in a solution of anti-mouse IgG (H+L), HRP conjugate (Promega) diluted to 0.4 μg / mL and shaken for 30 minutes, and washed again with PBST. The HRP detection reagent (Bio-Rad) was added to the transfer surface of the membrane and allowed to react for 5 minutes, and the bands corresponding to each hNAGLU mutant and wild-type hNAGLU were detected by a luminescent imaging analyzer.

[0486] [Example 5] Confirmation of the expression amount of the hNAGLU mutant based on transient expression (enzyme activity assay)

[0487] As a sample solution, a solution was prepared in which the culture supernatant obtained in Example 2 was diluted 10-fold with 100 mM citric acid buffer (pH 4.2) containing 0.1% BSA. As a standard solution, 4-MU (4-methylumbelliferone, Sigma Aldrich) was gradient-diluted to 400 to 35.12 μΜ in 100 mM citric acid buffer (pH 4.2) containing 0.1% BSA. As a substrate solution, a solution was prepared in which 4-methylumbelliferyl-N-acetyl-α-D-glucosaminide (Sigma Aldrich) as an artificial substrate for NAGLU was diluted to 1 mmol / L with 100 mM citric acid buffer (pH 4.2) containing 0.1% BSA. To each well of a microplate, 25 μL of the sample solution or the standard solution was added, and further 25 μL / well of the substrate solution was added, and mixed by shaking with a plate shaker. After incubation of the plate at 37°C for 1 hour, 150 μL of 200 mmol / L glycine-NaOH buffer (pH 10.7) was added to each well to stop the reaction. The fluorescence intensity of free 4-MU (4-methylumbelliferone) was measured with a fluorescence plate reader (Gemini XPS, Molecular Devices) (excitation wavelength 355 nm, fluorescence wavelength 460 nm). Based on the measurement results of the standard solution, a calibration curve was prepared, and the measurement values of each sample solution were interpolated into the calibration curve to calculate the amount of enzyme activity.

[0488] [Example 6] Confirmation of the amount of expression of hNAGLU mutants based on transient expression (results)

[0489] Figure 1 The results of the measurement of the amount of expression of hNAGLU mutants based on transient expression measured in Examples 2 to 4 are shown. Table 5 shows the amounts of expression of each hNAGLU mutant based on the results of the enzyme activity measurement shown in the bar chart, in the form of relative values when the expression amount of the wild type is taken as 1. Figure 1 The amounts of expression of each hNAGLU mutant based on the results of the enzyme activity measurement shown in the bar chart.

[0490] [Table 5]

[0491] Table 5 Amount of expression of each hNAGLU mutant based on transient expression (relative amount when the expression amount of wild type hNAGLU is taken as 1)

[0492] Names of hNAGLU mutants Mutant number Expression level Wild-type hNAGLU - 1 K36E / P37S hNAGLU mutant 1 2.5 L44_G45insS hNAGLU mutant 2 3.2 R129Q hNAGLU mutant 16 0.5 Q209R hNAGLU mutant 3 4.4 E228K hNAGLU mutant 4 1.5 T240V hNAGLU mutant 17 0.6 T320P / E321D hNAGLU mutant 5 2.0 S505A / 1506V hNAGLU mutant 6 1.5 S526N / A528T hNAGLU mutant 7 1.2 D613Q hNAGLU mutant 18 0.6 H204K hNAGLU mutant 19 0.4

[0493] The seven mutants (mutant Nos. 1 to 7) of K36E / P37S hNAGLU mutant, L44_G45insS hNAGLU mutant, Q209R hNAGLU mutant, E228K hNAGLU mutant, T320P / E321D hNAGLU mutant, S505A / I506V hNAGLU mutant, and S526N / A528T hNAGLU mutant showed high transient expression as compared with the wild type. In particular, the Q209R hNAGLU mutant (mutant No. 3) showed 4.4-fold expression as compared with the wild type hNAGLU. On the other hand, the R129Q hNAGLU mutant (mutant No. 16), the S526N / A528T hNAGLU mutant (mutant No. 17), the D613Q hNAGLU mutant (mutant No. 18), and the H204K hNAGLU mutant (mutant No. 19) showed low transient expression as compared with the wild type.

[0494] In addition, a positive correlation was observed between the amount of enzyme activity and the expression amount of the hNAGLU mutant confirmed on the SDS page electrophoresis shown in (a) of Figure 1 Furthermore, a positive correlation was also observed between the amount of enzyme activity and the expression amount of the hNAGLU mutant confirmed by the Western blotting shown in (b) of Figure 1

[0495] [Example 7] Production of hNAGLU mutant-expressing batch cells

[0496] Using a gene introduction device (super electroporator NEPA21, NEPA GENE), the expression plasmid in which the gene encoding each hNAGLU mutant or wild type hNAGLU was integrated, obtained in Example 1, was introduced into a serum-free acclimated strain of CHO-K1 cells, and selection culture was performed using CD OptiCHO medium (Thermo Fisher Scientific) containing 10 μg / mL puromycin (Thermo Fisher Scientific). Medium exchange was performed every 3 to 4 days and the culture fluid volume was gradually increased, and at the time when the survival rate of the cells in culture exceeded 90%, the cells were recovered and used as hNAGLU mutant-expressing batch cells and wild type hNAGLU-expressing batch cells.

[0497] [Example 8] Culture of hNAGLU mutant-expressing batch cells

[0498] Into CD OptiCHO medium containing 10 μg / mL puromycin, 2 x 107cells of each of the hNAGLU mutant-expressing batch cells and the wild type hNAGLU-expressing batch cells were inoculated, and the cells were cultured at 37°C in a 5% CO2 incubator. 5 ​The respective hNAGLU mutant expression batch cells and wild-type hNAGLU expression batch cells obtained in Example 7 were seeded at a cell density of 1 x 10

[0499] [Example 9] Confirmation of hNAGLU mutant expression amount based on batch cells (enzyme activity assay)

[0500] As a sample solution, a liquid obtained by diluting the culture supernatant obtained in Example 8 10-fold with a citric acid buffer (pH 4.2) containing 0.1% BSA was prepared. As a substrate solution, a liquid in which 4-methylumbelliferyl-N-acetyl-a-D-glucosaminide as an artificial substrate for hNAGLU was diluted with a citric acid buffer (pH 4.2) to 1 mmol / L was prepared. To each well of a microplate, 25 μL of the sample solution or a standard solution was added, and further 25 μL / well of the substrate solution was added, and stirred and mixed with a plate shaker. After the plate was incubated at 37°C for 1 hour, 150 μL of a 200 mmol / L glycine-NaOH buffer (pH 10.7) was added to each well to stop the reaction. The fluorescence intensity of free 4-MU (4-methylumbelliferone) was measured with a fluorescence plate reader (excitation wavelength 355 nm, fluorescence wavelength 460 nm). A calibration curve was prepared based on the measurement results of the standard solution, and the measurement values of each sample solution were interpolated into the calibration curve to calculate the enzyme activity amount. The enzyme activity amount was calculated as the enzyme activity amount (nmol / h / 1 x 10 6 6 6 cells. The enzyme activity amount was calculated as the enzyme activity amount (nmol / h / 1 x 10

[0501] [Example 10] Confirmation of hNAGLU mutant expression amount based on batch cells (results)

[0502] Figure 2 The measurement results of the hNAGLU mutant expression amount based on batch cells measured in Example 9 are shown. Table 6 shows the expression amount of each hNAGLU mutant based on the bar chart shown in Example 9 as a relative value when the expression amount of the wild type is taken as 1. Note that the batch cell culture was repeated four times, and the enzyme activity assay was performed for each. Figure 2

[0503] [Table 6]

[0504] Table 6 Expression amount of each hNAGLU mutant based on batch cells (relative amount when the expression amount of wild-type hNAGLU is taken as 1)

[0505] ​​

[0506] As in the case of the transient expression, the expression amount of the seven mutants (mutant Nos. 1 to 7) of the K36E / P37S hNAGLU mutant, the L44_G45insS hNAGLU mutant, the Q209R hNAGLU mutant, the E228K hNAGLU mutant, the T320P / E321D hNAGLU mutant, the S505A / I506V hNAGLU mutant, and the S526N / A528T hNAGLU mutant was more than that of the wild type. In particular, the Q209R hNAGLU mutant (mutant No. 3) showed 2.2-fold expression amount compared to the wild type hNAGLU. Also, as in the case of the transient expression, the R129Q hNAGLU mutant (mutant No. 16), the S526N / A528T hNAGLU mutant (mutant No. 17), the D613Q hNAGLU mutant (mutant No. 18), and the H204K hNAGLU mutant (mutant No. 19) showed less expression amount than the wild type.

[0507] [Example 11] Introduction of Mutation into Q209R hNAGLU Mutant and Construction of Expression Vector

[0508] From the experimental results of Examples 1 to 10, it was known that the Q209R hNAGLU mutant among the hNAGLU mutants showed the highest expression amount. Therefore, in order to obtain a further highly-expressing hNAGLU mutant, a mutation was further introduced into the Q209R hNAGLU mutant. As a template, the plasmid obtained in Example 1, in which the gene encoding the Q209R hNAGLU mutant was integrated, was used, and as a forward primer, the MluI addition 5' primer having the base sequence shown in SEQ ID NO: 42 was used, and as a reverse primer, the primers shown in Table 7 were used, and PCR of Nos. 12 to 15 shown in Table 7 was performed. Table 7 shows the sequence numbers corresponding to the base sequences of the respective reverse primers.

[0509] [Table 7]

[0510] Table 7 Primers used in PCR

[0511]

[0512] In addition, as a template, the plasmid obtained in Example 1, in which the gene encoding the Q209R hNAGLU mutant was integrated, was used, and as a forward primer, the primers shown in Table 8 were used, and as a reverse primer, the His tag-NotI addition 3' primer having the base sequence shown in SEQ ID NO: 43 was used, and PCR of No. 16 shown in Table 8 was performed. Table 8 shows the sequence numbers corresponding to the base sequences of the forward primers.

[0513] [Table 8]

[0514] Table 8 Primer 4 used in PCR

[0515]

[0516] Next, using the plasmid obtained in Example 1 in which the gene encoding the Q209R hNAGLU mutant was integrated as a template, PCR of Nos. 17 to 26 shown in Table 9 was performed using the forward primer and the reverse primer shown in Table 9.

[0517] [Table 9]

[0518] Table 9 Primer 5 used in PCR

[0519]

[0520] By the above PCR of Nos. 17 to 19, 21, and 23 to 26, DNA fragments of the hNAGLU mutants shown in Table 10 encoding 1 to 3 mutations further introduced in the Q209R hNAGLU mutant were amplified. Table 10 shows the sequence number corresponding to the amino acid sequence of each hNAGLU mutant, the sequence number corresponding to the base sequence encoding the same, and the number of each hNAGLU mutant (mutant number).

[0521] [Table 10]

[0522] Table 10 Name 3 of PCR product

[0523]

[0524] Next, each of the PCR products obtained in the PCR of Nos. 17 to 19, 21, and 23 to 26 was subjected to restriction enzyme treatment with MluI and NotI (Takara Bio Inc.), and separated by agarose gel electrophoresis. After EtBr staining, the band containing the target DNA fragment was excised under UV irradiation, and the DNA was extracted from the gel using QIAEX II Gel Extraction Kit (QIAGEN). Similarly, the pCI-neo vector (Promega), the pEI-puro vector were also subjected to restriction enzyme treatment with MluI and NotI, gel extraction, and purification. Each of the PCR products after the restriction enzyme treatment was mixed with each of the vectors after the restriction enzyme treatment, and subjected to a ligation reaction for 30 to 60 minutes at 16°C using Ligation Mix (Takara Bio Inc.).

[0525] Next, each of the ligation reaction solutions was used to transform Escherichia coli (E. coli) (ECOS TMX Competent E. coli DH5a (Nippon Gene Co., Ltd.). To confirm whether the obtained transformant retains the target plasmid DNA, a single colony was cultured overnight in LB Broth (Sigma-Aldrich Co., Ltd.), and the plasmid DNA was purified in a small amount using a FastGene Plasmid Miniprep Kit (Japan Genetics Co., Ltd.). The purified plasmid DNA was subjected to restriction enzyme treatment with MluI and NotI, and separated by agarose gel electrophoresis, whereby it was confirmed that the target insertion DNA was inserted. In addition, it was confirmed by Sanger sequencing analysis that the target change was introduced in each hNAGLU gene. For each plasmid in which the target hNAGLU mutant was integrated, purification was performed by a conventional method.

[0526] [Example 12] Transient expression of hNAGLU mutants

[0527] Transient expression of hNAGLU mutants was performed using the plasmid in which the hNAGLU mutant was integrated in the pCI-neo vector, which was purified in Example 11. As a control, a plasmid in which wild-type hNAGLU was integrated in the pCI-neo vector was used.

[0528] ExpiCHO cells were transformed with the plasmid in which the gene encoding the hNAGLU mutant was integrated and the plasmid in which the gene encoding wild-type hNAGLU was integrated, according to the high titer protocol of the ExpiCHO Expression System (Thermo Fisher Scientific, Inc.). After transformation, the cells were cultured for 8 days, and each hNAGLU mutant and wild-type hNAGLU was expressed in the culture supernatant. After the culture, the culture solution was subjected to centrifugal separation, and the culture supernatant was recovered. In addition, as a negative control, the culture supernatant of the untransformed cells was also recovered.

[0529] [Example 13] Confirmation of the expression amount of hNAGLU mutants based on transient expression (SDS page electrophoresis)

[0530] 10 pL of the culture supernatant obtained in Example 12 was mixed with 8 pL of 2x sample buffer and 2 pL of 2-mercaptoethanol, and subjected to heat denaturation under reducing conditions at 100°C for 3 minutes. After heat denaturation, 5 pL of the sample was each applied to a well of a 5-20% polyacrylamide gel set in a 50 mM Tris buffer / 380 mM glycine buffer (pH 8.3) containing 0.1% SDS, and electrophoresis was performed at a constant current of 25 mA. After electrophoresis, the gel was immersed in Oriole fluorescent gel stain (Bio-Rad Laboratories, Inc.) and shaken at room temperature for 90 minutes. The gel was washed with pure water, and then the band of the protein was detected with a luminescent imaging analyzer.

[0531] [Example 14] Confirmation of expression amount of hNAGLU mutant based on transient expression (Western blotting method)

[0532] The electrophoresis was performed in the same manner as described in the method described in Example 13, and the nitrocellulose membrane and the gel after the electrophoresis were sandwiched with a blotting paper immersed in a 25 mM Tris buffer / 192 mM glycine buffer containing 20% methanol, and electric current was passed at 1.0 A, 25 V for 10 minutes in a blotting apparatus, to thereby transfer the proteins onto the nitrocellulose membrane. After the membrane after the transfer was immersed and shaken in PBST containing 5% skim milk for 1 hour, it was immersed in a mouse anti-His tag mAb solution diluted to 0.4 μg / mL and shaken for 1 hour. After the membrane was washed with PBST, it was immersed in an anti-mouse IgG (H+L), HRP conjugate solution diluted to 0.4 μg / mL and shaken for 30 minutes, and washed again with PBST. The HRP detection reagent was added to the transfer surface of the membrane and allowed to react for 5 minutes, and detection was performed by a luminescent imaging analyzer.

[0533] [Example 15] Confirmation of expression amount of hNAGLU mutant based on transient expression (enzyme activity assay)

[0534] As a sample solution, a solution obtained by diluting 10 times the culture supernatant obtained in Example 12 with a citric acid buffer (pH 4.2) containing 0.1% BSA was prepared. As a substrate solution, a solution was prepared in which 4-methylumbelliferyl-N-acetyl-α-D-glucosaminide as an artificial substrate of hNAGLU was diluted to 1 mmol / L with a citric acid buffer (pH 4.2). The sample solution or a standard solution was added to a microplate at 25 μL / well, and further 25 μL of the substrate solution was added to each well, which was stirred and mixed with a plate shaker. After the plate was incubated at 37°C for 1 hour, the reaction was stopped by adding 200 mmol / L glycine-NaOH buffer (pH 10.7) at 150 μL / well. The fluorescence intensity of free 4-MU (4-methylumbelliferyl) was measured with a fluorescence plate reader (excitation wavelength 355 nm, fluorescence wavelength 460 nm). A calibration curve was prepared based on the measurement results of the standard solution, and the measurement values of each sample solution were interpolated into the calibration curve, to thereby calculate the enzyme activity amount.

[0535] [Example 16] Confirmation of expression amount of hNAGLU mutant based on transient expression (results)

[0536] Figure 3 and Figure 4 The measurement results of the expression amount of the hNAGLU mutant based on transient expression measured in Examples 12 to 15 are shown. Table 11 shows the expression amount of the hNAGLU mutant based on transient expression in the form of a relative value when the expression amount of the wild type is taken as 1. Figure 3 and 4The expression amount of each hNAGLU mutant shown in the enzyme activity measurement result of the bar graph.

[0537] [Table 11]

[0538] Table 11 Expression amount of each hNAGLU mutant based on transient expression (relative amount when the expression amount of wild type NAGLU is 1)

[0539] Names of hNAGLU mutants Mutant number Expression level Wild-type hNAGLU - 1 Q209R hNAGLU mutant 3 3.3 K36E / P37S / Q209R hNAGLU mutant 8 3.7 L44_G45insS / Q209R hNAGLU mutant 9 5.4 Q209R / T320P / E321D hNAGLU mutant 10 4.0 K36E / P37S / L44_G45insS / Q209R hNAGLU mutant 11 5.4 V541 / Q209R / R620K hNAGLU mutant 12 5.9 L44_G45insS / V541 / Q209R hNAGLU mutant 13 5.1 L44_G45insS / Q209R / R620K hNAGLU mutant 14 4.2 L44_G45insS / V54I / Q209R / R620K hNAGLU mutant 15 5.6

[0540] (Note) The expression amount of Q209R hNAGLU mutant and K36E / P37S / L44_G45insS / Q209R hNAGLU mutant is Figure 3 and Figure 4 the average of the expression amount shown in

[0541] The K36E / P37S / Q209R hNAGLU mutant, L44_G45insS / Q209R hNAGLU mutant, Q209R / T320P / E321D hNAGLU mutant, K36E / P37S / L44_G45insS / Q209R hNAGLU mutant, V54I / Q209R / R620K hNAGLU mutant, L44_G45insS / V54I / Q209R hNAGLU mutant, L44_G45insS / Q209R / R620K hNAGLU mutant and L44_G45insS / V54I / Q209R / R620K hNAGLU mutant (mutants 8 to 15) further added to the Q209R hNAGLU mutant all showed high transient expression compared to the Q209R hNAGLU mutant. In particular, the V54I / Q209R / R620K hNAGLU mutant showed about 1.8 times (5.9 times of wild type) of the transient expression compared to the Q209R hNAGLU mutant. In addition, the enzyme activity amount and the expression amount of each hNAGLU mutant shown in Figure 3 (b) and Figure 4 (a) were observed to be positively correlated. Further, the enzyme activity amount and the expression amount of each hNAGLU mutant shown in Figure 4 (b) were also observed to be positively correlated.

[0542] [Example 17]

[0543] The above results show that, in the production of the recombinant hNAGLU, the production amount of the recombinant Q209R hNAGLU mutant instead of the recombinant wild-type hNAGLU can be increased by 2 to 5 times. In addition, it is shown that, by further adding mutations to the Q209R hNAGLU mutant in the form of a recombinant K36E / P37S / Q209R hNAGLU mutant, a recombinant L44_G45insS / Q209R hNAGLU mutant, a recombinant Q209R / T320P / E321D hNAGLU mutant, a recombinant K36E / P37S / L44_G45insS / Q209R hNAGLU mutant, a recombinant V54I / Q209R / R620K hNAGLU mutant, a recombinant L44_G45insS / V54I / Q209R hNAGLU mutant, a recombinant L44_G45insS / Q209R / R620K hNAGLU mutant, and a recombinant L44_G45insS / V54I / Q209R / R620K hNAGLU mutant, the production amount of the recombinant hNAGLU can be further increased.

[0544] [Example 18] Construction of a cell for expressing a fusion protein of an anti-human transferrin receptor antibody (anti-hTfR antibody) and a hNAGLU mutant

[0545] The fusion protein of the anti-human transferrin receptor antibody (anti-hTfR antibody) and the hNAGLU mutant can be produced by the method described below.

[0546] A pE-neo vector and a pE-hygr vector as expression vectors were constructed using the method described in the patent document (WO2018 / 124121). The pE-neo vector and the pE-hygr vector were digested with MluI and NotI, respectively.

[0547] A DNA fragment encoding a protein shown in SEQ ID NO: 64 of the L44_G45insS / Q209R hNAGLU mutant (mutant No. 9) was synthesized by combining 15 amino acids in total, which are sequentially formed at the C-terminal end of the Fab heavy chain of the anti-hTfR antibody having the amino acid sequence of SEQ ID NO: 63, by means of 3 amino acid sequences shown in SEQ ID NO: 3. On the 5' side of the DNA fragment, an MluI sequence and a sequence encoding a leader peptide functioning as a secretion signal were disposed in order from the 5' end, and a NotI sequence was disposed on the 3' side. The DNA fragment was digested with MluI and NotI, and integrated between MluI and NotI of the pE-neo vector, thereby constructing a pE-neo(HC-mhNAGLU).

[0548] In addition, a DNA fragment encoding a protein shown in SEQ ID NO: 65 was synthesized, which is a linker sequence consisting of a total of 15 amino acids formed in succession at the C-terminal end of the L44_G45insS / Q209R hNAGLU mutant (mutant No. 9) by means of 3 amino acid sequences shown in SEQ ID NO: 3, combined with the Fab heavy chain of the anti-hTfR antibody containing the amino acid sequence of SEQ ID NO: 63. On the 5' side of this DNA fragment, an MluI sequence and a sequence encoding a leader peptide functioning as a secretion signal were disposed in this order from the 5' end, and a NotI sequence was disposed on the 3' side. This DNA fragment was digested with MluI and NotI, and integrated between MluI and NotI of the pE-neo vector, thereby constructing pE-neo(mhNAGLU-HC).

[0549] A DNA fragment encoding the light chain of the anti-hTfR containing the amino acid sequence of SEQ ID NO: 61 (SEQ ID NO: 66) was synthesized. This DNA fragment was digested with MluI and NotI, and integrated between MluI and NotI of the pE-hygr vector, thereby constructing pE-hygr(LC).

[0550] For CHO cells (CHO-K1: obtained from the American Type Culture Collection), transformation was performed using pE-neo(HC-mhNAGLU) and pE-neo(HC-mhNAGLU), or pE-neo(HC-mhNAGLU) and pE-neo(mhNAGLU-HC) respectively by the following method using a GenePulser (Bio-Rad Inc.). Transformation of the cells was generally performed by the following method. 5 x 10 5 CHO-K1 cells were seeded into 3.5 cm dishes added with CD OptiCHO TM medium (Life Technologies Inc.), and incubated at 37°C under 5% CO2 for one night. The medium was exchanged for Opti-MEM TM I medium (Life Technologies Inc.), and the cells were suspended at a density of 5 x 10 6 CHO-K1 cells were seeded into 3.5 cm dishes added with CD OptiCHO TM I medium (Life Technologies Inc.), and the cells were suspended at a density of 5 x 10 TMSelective culture is carried out in the culture medium.

[0551] Next, cells selected through selective culture were seeded on 96-well plates using a limiting dilution method, with no more than one cell seeded per well. Each cell was cultured for approximately 10 days to form monoclonal colonies. The culture supernatant from the wells containing monoclonal colonies was collected, and the content of humanized antibodies in the supernatant was investigated using ELISA. Cell lines with high expression of humanized antibodies were selected.

[0552] The ELISA method at this stage is generally performed as follows: Add 100 μL of a solution diluted to 4 μg / mL with 0.05 M bicarbonate buffer (pH 9.6) to each well of a 96-well microtiter plate (Nunc). Incubate at room temperature for at least 1 hour to allow the antibody to adsorb onto the plate. Next, wash each well three times with PBS-T. Then, add 200 μL of Starting Block (PBS) blocking buffer (Thermo Fisher Scientific) to each well and incubate at room temperature for 30 minutes. After washing each well three times with PBS-T, add 100 μL of a solution diluted to the appropriate concentration with PBS-BT (PBS-BT containing 0.5% BSA and 0.05% Tween 20) to each well. Incubate the plate at room temperature for at least 1 hour. After washing the plates three times with PBS-T, add 100 μL of HRP-labeled anti-human IgG polyclonal antibody solution diluted with PBS-BT to each well, and incubate the plates at room temperature for at least 1 hour. Wash each well three times with PBS-T, then add 100 μL of 0.4 mg / mL o-phenylenediamine containing phosphate-citrate buffer (pH 5.0) to each well, and incubate at room temperature for 8–20 minutes. Next, add 100 μL of 1 mol / L sulfuric acid to each well to stop the reaction, and measure the absorbance at 490 nm using a 96-well microplate reader. Cells corresponding to wells showing high absorbance values ​​can be used as high-expression cell lines for the fabrication of fusion proteins.

[0553] [Example 19] Manufacturing of the fusion protein of anti-hTfR antibody and hNAGLU mutant

[0554] The fusion protein of anti-hTfR antibody and hNAGLU mutant can be manufactured by the following method. The high-expression cell line described in Example 18 is used with CD OptiCHO... TM The culture medium has a cell concentration of approximately 2 × 10⁻⁶. 5The cell suspension was diluted in a manner of 1 g / mL, 200 mL of the cell suspension was added to a 1 L triangular flask, and incubation was performed at 37°C in a humidified environment composed of 5% CO2and 95% air at a stirring speed of about 70 rpm for 6 to 7 days. The culture supernatant was recovered by centrifugation, filtered with a 0.22 μm filter (Millipore Corporation), and the culture supernatant was recovered. The culture supernatant was added with 20 mM Tris buffer (pH 8.0) containing 150 mM NaCl in an amount of 5 times the column volume, and loaded onto a protein A column (column volume: 1 mL, Bio-Rad Corporation) previously equilibrated with 20 mM Tris buffer (pH 8.0) containing 150 mM NaCl in an amount of 3 times the column volume. Subsequently, the column was washed by supplying the same buffer in an amount of 5 times the column volume, and the adsorbed fusion protein was eluted with 50 mM glycine buffer (pH 2.8) containing 150 mM NaCl in an amount of 4 times the column volume. The eluate containing the fusion protein was adjusted to pH 7.0 by adding 1 M Tris buffer (pH 8.0). The thus obtained solution was stored at 4°C or frozen as a purified product of the fusion protein.

[0555] INDUSTRIAL APPLICABILITY

[0556] According to the present application, it is possible to provide a hNAGLU mutant for treating a patient with mucopolysaccharidosis type IIIB, which can be administered as an enzyme replacement therapy, and which can be produced more efficiently as a recombinant protein compared to wild-type hNAGLU.

[0557] SEQUENCE LIST FREE TEXT

[0558] SEQ ID NO: 1: Amino acid sequence of wild-type hNAGLU

[0559] SEQ ID NO: 2: Base sequence of a DNA fragment encoding wild-type hNAGLU, synthetic sequence

[0560] SEQ ID NO: 3: Amino acid sequence of hNAGLU mutant No. 1

[0561] SEQ ID NO: 4: Base sequence of a DNA fragment encoding hNAGLU mutant No. 1, synthetic sequence

[0562] SEQ ID NO: 5: Amino acid sequence of hNAGLU mutant No. 2

[0563] SEQ ID NO: 6: Base sequence of a DNA fragment encoding hNAGLU mutant No. 2, synthetic sequence

[0564] SEQ ID NO: 7: Amino acid sequence of hNAGLU mutant No. 16

[0565] SEQ ID NO: 8: Base sequence of a DNA segment encoding hNAGLU mutant number 16, synthetic sequence

[0566] SEQ ID NO: 9: Amino acid sequence of hNAGLU mutant number 3

[0567] SEQ ID NO: 10: Base sequence of a DNA segment encoding hNAGLU mutant number 3, synthetic sequence

[0568] SEQ ID NO: 11: Amino acid sequence of hNAGLU mutant number 4

[0569] SEQ ID NO: 12: Base sequence of a DNA segment encoding hNAGLU mutant number 4, synthetic sequence

[0570] SEQ ID NO: 13: Amino acid sequence of hNAGLU mutant number 17

[0571] SEQ ID NO: 14: Base sequence of a DNA segment encoding hNAGLU mutant number 17, synthetic sequence

[0572] SEQ ID NO: 15: Amino acid sequence of hNAGLU mutant number 5

[0573] SEQ ID NO: 16: Base sequence of a DNA segment encoding hNAGLU mutant number 5, synthetic sequence

[0574] SEQ ID NO: 17: Amino acid sequence of hNAGLU mutant number 6

[0575] SEQ ID NO: 18: Base sequence of a DNA segment encoding hNAGLU mutant number 6, synthetic sequence

[0576] SEQ ID NO: 19: Amino acid sequence of hNAGLU mutant number 7

[0577] SEQ ID NO: 20: Base sequence of a DNA segment encoding hNAGLU mutant number 7, synthetic sequence

[0578] SEQ ID NO: 21: Amino acid sequence of hNAGLU mutant number 18

[0579] SEQ ID NO: 22: Base sequence of a DNA segment encoding hNAGLU mutant number 18, synthetic sequence

[0580] SEQ ID NO: 23: Amino acid sequence of hNAGLU mutant number 19

[0581] SEQ ID NO: 24: Base sequence of a DNA segment encoding hNAGLU mutant number 19, synthetic sequence

[0582] SEQ ID NO: 25: Amino acid sequence of hNAGLU mutant number 8

[0583] Sequence number 26: Base sequence encoding the DNA fragment of hNAGLU mutant number 8, synthetic sequence

[0584] Serial number 27: Amino acid sequence of hNAGLU mutant number 9

[0585] Sequence number 28: Base sequence encoding the DNA fragment of hNAGLU mutant number 9, synthetic sequence

[0586] Serial number 29: Amino acid sequence of hNAGLU mutant number 10

[0587] Sequence number 30: Base sequence encoding the DNA fragment of hNAGLU mutant number 10, synthetic sequence

[0588] Serial number 31: Amino acid sequence of hNAGLU mutant number 11

[0589] Sequence number 32: Base sequence encoding the DNA fragment of mutant hNAGLU number 11, synthetic sequence

[0590] Serial number 33: Amino acid sequence of hNAGLU mutant number 12

[0591] Sequence number 34: Base sequence encoding the DNA fragment of hNAGLU mutant number 12, synthetic sequence

[0592] Serial number 35: Amino acid sequence of hNAGLU mutant number 13

[0593] Sequence number 36: Base sequence encoding the DNA fragment of hNAGLU mutant number 13, synthetic sequence

[0594] Serial number 37: Amino acid sequence of hNAGLU mutant number 14

[0595] Sequence number 38: Base sequence encoding the DNA fragment of hNAGLU mutant number 14, synthetic sequence

[0596] Serial number 39: Amino acid sequence of hNAGLU mutant number 15

[0597] Sequence number 40: Base sequence encoding the DNA fragment of hNAGLU mutant number 15, synthetic sequence

[0598] Serial number 41: Contains the base sequence of the gene encoding hNAGLU, synthetic sequence

[0599] Serial number 42: MluI with 5' primer added, synthesized sequence

[0600] Serial number 43: His tag - NotI, add 3' primer, synthesize sequence

[0601] SEQ ID NO: 44: 3' primer for introducing K36E / P37S mutation, synthetic sequence

[0602] SEQ ID NO: 45: 3' primer for introducing L44_G45insS mutation, synthetic sequence

[0603] SEQ ID NO: 46: 3' primer for introducing R129Q mutation, synthetic sequence

[0604] SEQ ID NO: 47: 3' primer for introducing Q209R mutation, synthetic sequence

[0605] SEQ ID NO: 48: 3' primer for introducing E228K mutation, synthetic sequence

[0606] SEQ ID NO: 49: 3' primer for introducing T240V mutation, synthetic sequence

[0607] SEQ ID NO: 50: 3' primer for introducing T320P / E321D mutation, synthetic sequence

[0608] SEQ ID NO: 51: 5' primer for introducing S505A / I506V mutation, synthetic sequence

[0609] SEQ ID NO: 52: 5' primer for introducing S526N / A528T mutation, synthetic sequence

[0610] SEQ ID NO: 53: 5' primer for introducing D613Q mutation, synthetic sequence

[0611] SEQ ID NO: 54: 3' primer for introducing H204K mutation, synthetic sequence

[0612] SEQ ID NO: 55: 3' primer for introducing V54I mutation, synthetic sequence

[0613] SEQ ID NO: 56: 5' primer for introducing R620K mutation, synthetic sequence

[0614] SEQ ID NO: 57: Amino acid sequence of human transferrin receptor

[0615] SEQ ID NO: 58: Example 1 of amino acid sequence of linker

[0616] SEQ ID NO: 59: Example 2 of amino acid sequence of linker

[0617] SEQ ID NO: 60: Example 3 of amino acid sequence of linker

[0618] SEQ ID NO: 61: Amino acid sequence of light chain of anti-hTfR antibody

[0619] SEQ ID NO: 62: Amino acid sequence of heavy chain of anti-hTfR antibody

[0620] SEQ ID NO: 63: Amino acid sequence of Fab heavy chain of anti-hTfR antibody

[0621] SEQ ID NO: 64: Amino acid sequence 1 of the fusion protein of hNAGLU mutant number 9 and the Fab heavy chain of an anti-hTfR antibody

[0622] SEQ ID NO: 65: Amino acid sequence 2 of the fusion protein of hNAGLU mutant number 9 and the Fab heavy chain of an anti-hTfR antibody

[0623] SEQ ID NO: 66: Base sequence of the amino acid sequence encoding the light chain of an anti-hTfR antibody, synthetic sequence

[0624] SEQ ID NO: 67: Amino acid sequence of the signal peptide of wild-type hNAGLU precursor SEQUENCE LISTING <110> JCR PHARMACEUTICAL CO., LTD. <120> Mutants of alpha-N-acetylglucosaminidase <130> 1233JP <150> P2020-145100 <151> 2020-08-28 <160> 67 <170> PatentIn version 3.5 <210> 1 <211> 720 <212> PRT <213> Homo sapiens <400> 1 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gin Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gin Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gin Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gin Gly Ile Pro Phe Gin Gin His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys lie Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 2 <211> 2229 <212> DNA <213> Homo sapiens <400> 2 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 3 <211> 720 <212> PRT <213> Artificial sequence <220> <223> amino acid sequence of hNAGLU mutant type 1 <400> 3 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Glu Ser Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gin Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gin Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gin Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gin Gly Ile Pro Phe Gin Gin His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 4 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 1, synthetic sequence <400> 4 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctgagtcc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 5 <211> 721 <212> PRT <213> Artificial sequence <220> <223> amino acid sequence of hNAGLU mutant type 2 <400> 5 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Ser Gly Gly Gly 35 40 45 Gly Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala 50 55 60 Ala Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala 65 70 75 80 Trp Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro 85 90 95 Gly Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn 100 105 110 Val Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp 115 120 125 Glu Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu 130 135 140 Ala Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu 145 150 155 160 Gly Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe 165 170 175 Leu Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu 180 185 190 Pro Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu 195 200 205 Asp Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala 210 215 220 Gly His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val 225 230 235 240 Thr Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser 245 250 255 Phe Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu 260 265 270 Phe Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly 275 280 285 Ala Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr 290 295 300 Leu Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp 305 310 315 320 Thr Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro 325 330 335 Gln Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro 340 345 350 Arg Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val 355 360 365 Tyr Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met 370 375 380 Leu His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala 385 390 395 400 Val Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met 405 410 415 Val Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val 420 425 430 Tyr Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp 435 440 445 Leu Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser 450 455 460 His Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr 465 470 475 480 Asn Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val 485 490 495 Arg Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser 500 505 510 Asp Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu 515 520 525 Ala Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gin 530 535 540 Ala Val Gin Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala 545 550 555 560 Tyr Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu 565 570 575 Ala Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser 580 585 590 Arg Phe Leu Leu Gly Ser Trp Leu Glu Gin Ala Arg Ala Ala Ala Val 595 600 605 Ser Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu 610 615 620 Thr Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gin 625 630 635 640 Leu Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe 645 650 655 Leu Glu Ala Leu Val Asp Ser Val Ala Gin Gly Ile Pro Phe Gin Gin 660 665 670 His Gin Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu 675 680 685 Ser Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu 690 695 700 Ala Lys Lys lie Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser 705 710 715 720 Trp <210> 6 <211> 2232 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 2, synthetic sequence <400> 6 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct ctctggcgga ggaggagctg ctagggttcg tgttcgtgga 240 tccactggtg tggccgctgc tgctggactc catcgttatt tacgggattt ctgtggatgc 300 cacgtggctt ggagcggcag ccaactgagg ctccctaggc ctctgcccgc tgtccccggt 360 GAACCTGACC GAGGCTACCC CCAATCGGTA CCGGTACTAC CAGAACGTGT GCACCCAAAG C 420 TATTCCCTTC GTGTGGGTGG ACTGGGCTCG TTGGGAAAGG GAGATCGACT GGATGGCCCT C 480 AACGGAATTA TCTGGCTTTA GCTTGGTCCG GCCAAGAGGC CATTTGGCAG AGGGTGACA 540 CTCGCTTTAG GTTTCACACA AGCTGAGATC AACGAATTC TTCACCGGCC CCCTTTTCTC 600 GCTTGGGGAC GGATGGGCAT TTACACACTT GGGATGGCCC TCTCCCCCTT CTTGGCAC 660 ATTAAGCAAC TGTATTTACA GCATCGTGTC TCGATCAGAT GAGGTCCTTC GGCATGACA 720 CCCGTGCTCC CCGCTTTTGC TGGCCACGTC CCCGAAGCTG TCACTCGTGT GTTTCCTCAA 780 GTTAACGTGA CAAAGATGGG CTCTTGGGGC CACTTTAACT GCAGCTACAG CTGTTCTTTT 840 TTACTGGCCC CCGAGGATCC CATTTTTCCC ATCATCGGCT CCCTCTTTTT AAGGGAGCTG 900 ATCAAAGAGT TCGGCACCGA CCACATTTAC GGCGCCGACA CCTTAACGA GATGCAGCCC 960 CCTAGCAGCG AGCCTAGCTA TTTCGCTGCT GCCACCACAG CCCTATGAGG CCATGACC 1020 GCCGTGGACA CCGAAGCTGT GTGGCTGCTG CAAGGTTGGC TGTTCAGCAC CAGCCTCAG 1080 ttctggggcc ccgctcaaat tcgtgccgtg ctgggcgccg tgcctcgggg tcgtctgctg 1140 gtcctcgatc tgttcgctga gtcccaaccc gtttacacaa ggacagcctc cttccaaggt 1200 cagcccttca tctggtgcat gctgcacaac tttggcggaa accacggact gttcggagct 1260 ttagaggctg tgaatggcgg acccgaagct gcccggctgt tccccaactc caccatggtg 1320 ggaaccggaa tggcccccga aggcatttcc cagaatgagg tggtctacag cctcatggcc 1380 gagctcggat ggcggaagga tcccgttccc gatttagctg cttgggtgac ctccttcgct 1440 gctcggaggt atggcgtgtc ccatcccgat gccggagctg cttggaggtt attattacgt 1500 tccgtctaca actgctccgg cgaggcttgc cggggacata atcggtcccc tttagttcgt 1560 aggccttctt tacagatgaa taccagcatc tggtacaacc ggagcgacgt gttcgaagct 1620 tggcgtttat tactgacatc cgctccctct ttagctacca gccccgcctt tcgttatgat 1680 ttattagatc tgactcgtca agctgtgcaa gaactggtgt ctttatacta cgaggaagct 1740 cggagcgcct atttatccaa agagctggcc tctttactga gggctggagg cgtgctggct 1800 tatgagctgc tccccgcttt agatgaggtt ttagctagcg actctcgttt tttactggga 1860 tcttggctgg agcaagctcg tgccgctgcc gtgagcgaag ccgaggccga tttctatgag 1920 cagaactccc ggtaccagct gacactctgg ggccccgagg gcaacattct ggactacgcc 1980 aacaagcagc tggctggact ggtggccaac tactacaccc ctcgttggag gctgttttta 2040 gaagctctgg tcgactccgt ggcccaaggt atccccttcc aacagcacca gttcgacaag 2100 aatgtgttcc agctggaaca agctttcgtg ctgtccaaac aaaggtaccc ctcccagccc 2160 cggggagaca cagtggatct ggccaagaag atctttttaa agtattaccc tcggtgggtg 2220 gctggaagct gg 2232 <210> 7 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of hNAGLU mutant type 16 <400> 7 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Gln Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His lie Lys Gin Leu Tyr Leu Gin His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gin Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro lie Phe Pro lie lie Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu lie Lys Glu Phe Gly Thr Asp His lie Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gin Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gin Gly Trp Leu Phe Gin His Gin Pro Gin 325 330 335 Phe Trp Gly Pro Ala Gin lie Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gin Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gin Gly Gin Pro Phe He Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly He Ser Gin Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gin Met Asn Thr Ser He Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys He Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 8 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 16, synthetic sequence <400> 8 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaacaggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 9 <211> 720 <212> PRT <213> Artificial sequence <220> <223> Amino acid sequence of hNAGLU mutant type 3 <400> 9 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu Asp 195 200 205 Arg Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gin lie Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gin Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gin Gly Gin Pro Phe lie Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly lie Ser Gin Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gin Met Asn Thr Ser He Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gin Ala 530 535 540 Val Gin Glu Leu Val Ser Leu Tyr Tyr Gin Gin Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Gin Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gin Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn He Leu Asp Tyr Ala Asn Lys Gin Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gin Gly He Pro Phe Gin Gin His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys He Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 10 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 3, synthetic sequence <400> 10 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcggatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 11 <211> 720 <212> PRT <213> Artificial sequence <220> <223> Amino acid sequence of hNAGLU mutant type 4 <400> 11 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gin Ala Glu He Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His He Lys Gin Leu Tyr Leu Gin His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Lys Ala Val Thr Arg Val Phe Pro Gin Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro He Phe Pro He He Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu He Lys Glu Phe Gly Thr Asp His He Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gin Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gin Gly Trp Leu Phe Gin His Gin Pro Gin 325 330 335 Phe Trp Gly Pro Ala Gin He Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Gin Ser Gin Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gin Gly Gin Pro Phe He Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Gin Ala Val 385 390 395 400 Asn Gly Gly Pro Gin Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Gin Gly He Ser Gin Asn Gin Val Val Tyr 420 425 430 Ser Leu Met Ala Gin Leu Gly Trp Arg Lys Asp Pro Val Pro Gin Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Gin Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Gin 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gln Leu Glu Gln Ala Phe Val Leu Ser 675 680 685 Lys Gln Arg Tyr Pro Ser Gln Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 12 <211> 2229 <212> DNA <213> Artificial sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 4, synthetic sequence <400> 12 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtccc gctgccgattttttccgtgagcgtcgagagggccctcgc tgctaagccc 180 ggtttagacacctactccctcggcggaggaggagctgctagggttcgtgt tcgtggatcc 240 actggtgtggccgctgctgctggactccatcgttatttacgggatttctg tggatgccac 300 gtggcttggagcggcagccaactgaggctccctaggcctctgcccgctgt ccccggtgaa 360 ctgaccgaggctacccccaatcggtaccggta ctaccagaacgtgtgcacccaaagctat 420 tccttcgtgtggtgggactgggctcgttgggaaagggagatcgactggat ggccctcaac 480 ggaattaatctggctttagcttggtccggccaagaggccatttggcagag ggtgtacctc 540 gctttaggtttaacacaagctgagatcaacgaattcttcacggccccc ttttctcgct 600 tggggacggatgggcaatttacacacttgggatggccctctccccctt cttggcacatt 660 aagcaactgtatttacagcatcgtgtgctcgatcagatgaggtccttcgg catgacaccc 720 gtgctccccgctttgctggccacgtccccaaagctgtcactcgtgtgtt tcctcaagtt 780 aacgtgacaaagatgggctcttggggccactttaactgcagctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 13 <211> 720 <212> PRT <213> Artificial sequences <220> <223> amino acid sequence of hNAGLU mutant type 17 <400> 13 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gin Glu Ala lie Trp Gin Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gin Ala Glu lie Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His lie Lys Gin Leu Tyr Leu Gin His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gin Val Asn Val Val 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro lie Phe Pro lie lie Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu lie Lys Glu Phe Gly Thr Asp His lie Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gin Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gin His Gin Pro Gin 325 330 335 Phe Trp Gly Pro Ala Gin He Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Gin Ser Gin Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gin Gly Gin Pro Phe He Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Gin Gin Val 385 390 395 400 Asn Gly Gly Pro Gin Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Gin Gly He Ser Gin Asn Gin Val Val Tyr 420 425 430 Ser Leu Met Ala Gin Leu Gly Trp Arg Lys Asp Pro Val Pro Gin Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn lie Leu Asp Tyr Ala Asn Lys Gin Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gin Gly lie Pro Phe Gin Gin His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys lie Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 14 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 17, synthetic sequence <400> 14 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc tttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtggtca agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATGTAATAA TATATATAAT ATATAATATAT ATATAATATAT ATAT 2 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 15 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hNAGLU mutant type 5 <400> 15 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gin Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu He Asp Trp Met Ala Leu Asn Gly He Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gin Glu Ala He Trp Gin Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gin Ala Glu He Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His He Lys Gin Leu Tyr Leu Gin His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gin Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro He Phe Pro He He Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Pro 305 310 315 320 Asp Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gin Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gin Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gin Gly Ile Pro Phe Gin Gin His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 16 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 5, synthetic sequence <400> 16 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc tttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggaccccg acgctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 17 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hNAGLU mutant type 6 <400> 17 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gin Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gin Asn Val 100 105 110 Cys Thr Gin Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu He Asp Trp Met Ala Leu Asn Gly He Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gin Glu Ala He Trp Gin Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gin Ala Glu He Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His He Lys Gin Leu Tyr Leu Gin His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gin Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ala Val Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gin Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gin Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gin Gly Ile Pro Phe Gin Gin His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys lie Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 18 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 6, synthetic sequence <400> 18 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cgccgtctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 19 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of hNAGLU mutant type 7 <400> 19 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Asn Leu Thr 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gin Ala 530 535 540 Val Gin Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gin Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gin Asn Ser Arg Tyr Gin Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gin Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gin Gly Ile Pro Phe Gin Gin His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gln Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys lie Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 20 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 7, synthetic sequence <400> 20 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tcccaattta actaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 21 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of hNAGLU mutant type 18 <400> 21 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His lie Lys Gin Leu Tyr Leu Gin His Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gin Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro lie Phe Pro lie lie Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu lie Lys Glu Phe Gly Thr Asp His lie Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gin Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gin Gly Trp Leu Phe Gin His Gin Pro Gin 325 330 335 Phe Trp Gly Pro Ala Gin lie Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gin Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gin Gly Gin Pro Phe He Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly He Ser Gin Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gin Met Asn Thr Ser He Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Gln Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gin Leu Glu Gin Ala Phe Val Leu Ser 675 680 685 Lys Gin Arg Tyr Pro Ser Gin Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys lie Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 22 <211> 2229 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 18, synthetic sequence <400> 22 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggcccagtt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 23 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of hNAGLU mutant type 19 <400> 23 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 ​​​​​​​​​​​​​​​​​​​Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln Lys Arg Val Leu Asp 195 200 205 Gln Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gin lie Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gin Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gin Gly Gin Pro Phe lie Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly lie Ser Gin Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gln Leu Glu Gln Ala Phe Val Leu Ser 675 680 685 Lys Gln Arg Tyr Pro Ser Gln Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 24 <211> 2229 <212> DNA <213> Artificial sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 19, synthetic sequence <400> 24 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagaa gcgtgtgctc gatcagatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 25 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hNAGLU mutant type 8 <400> 25 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Glu Ser Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu Asp 195 200 205 Arg Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gln Leu Glu Gln Ala Phe Val Leu Ser 675 680 685 Lys Gln Arg Tyr Pro Ser Gln Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 26 <211> 2229 <212> DNA <213> Artificial sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 8, synthetic sequence <400> 26 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctgagtcc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcggatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tcccttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc ttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc ttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 27 <211> 721 <212> PRT <213> Artificial sequence <220> <223> amino acid sequence of hNAGLU mutant type 9 <400> 27 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Ser Gly Gly Gly 35 40 45 Gly Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala 50 55 60 Ala Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala 65 70 75 80 Trp Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro 85 90 95 Gly Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn 100 105 110 Val Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp 115 120 125 Glu Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu 130 135 140 Ala Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu 145 150 155 160 Gly Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe 165 170 175 Leu Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu 180 185 190 Pro Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu 195 200 205 Asp Arg Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala 210 215 220 Gly His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val 225 230 235 240 Thr Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser 245 250 255 Phe Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu 260 265 270 Phe Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly 275 280 285 Ala Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr 290 295 300 Leu Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp 305 310 315 320 Thr Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro 325 330 335 Gln Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro 340 345 350 Arg Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val 355 360 365 Tyr Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met 370 375 380 Leu His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala 385 390 395 400 Val Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met 405 410 415 Val Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val 420 425 430 Tyr Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp 435 440 445 Leu Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser 450 455 460 His Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr 465 470 475 480 Asn Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val 485 490 495 Arg Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser 500 505 510 Asp Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu 515 520 525 Ala Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln 530 535 540 Ala Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala 545 550 555 560 Tyr Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu 565 570 575 Ala Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser 580 585 590 Arg Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val 595 600 605 Ser Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu 610 615 620 Thr Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln 625 630 635 640 Leu Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe 645 650 655 Leu Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln 660 665 670 His Gln Phe Asp Lys Asn Val Phe Gln Leu Glu Gln Ala Phe Val Leu 675 680 685 Ser Lys Gln Arg Tyr Pro Ser Gln Pro Arg Gly Asp Thr Val Asp Leu 690 695 700 Ala Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser 705 710 715 720 Trp <210> 28 <211> 2232 <212> DNA <213> Artificial sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 9, synthetic sequence <400> 28 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct ctctggcgga ggaggagctg ctagggttcg tgttcgtgga 240 tccactggtg tggccgctgc tgctggactc catcgttatt tacgggattt ctgtggatgc 300 cacgtggctt ggagcggcag ccaactgagg ctccctaggc ctctgcccgc tgtccccggt 360 gaactgaccg aggctacccc caatcggtac cggtactacc agaacgtgtg cacccaaagc 420 tattccttcg tgtggtggga ctgggctcgt tgggaaaggg agatcgactg gatggccctc 480 aacggaatta atctggcttt agcttggtcc ggccaagagg ccatttggca gagggtgtac 540 ctcgctttag gtttaacaca agctgagatc aacgaattct tcaccggccc cgcttttctc 600 gcttggggac ggatgggcaa tttacacact tgggatggcc ctctcccccc ttcttggcac 660 attaagcaac tgtatttaca gcatcgtgtg ctcgatcgga tgaggtcctt cggcatgaca 720 cccgtgctcc ccgcttttgc tggccacgtc cccgaagctg tcactcgtgt gtttcctcaa 780 gttaacgtga caaagatggg ctcttggggc cactttaact gcagctacag ctgttccttt 840 ttactggccc ccgaggatcc catttttccc atcatcggct ccctcttttt aagggagctg 900 atcaaagagt tcggcaccga ccacatttac ggcgccgaca cctttaacga gatgcagccc 960 cctagcagcg agcctagcta tttagctgct gccaccacag ccgtctatga ggccatgacc 1020 gccgtggaca ccgaagctgt gtggctgctg caaggttggc tgttccagca ccagcctcag 1080 ttctggggcc ccgctcaaat tcgtgccgtg ctgggcgccg tgcctcgggg tcgtctgctg 1140 gtcctcgatc tgttcgctga gtcccaaccc gtttacacaa ggacagcctc cttccaaggt 1200 cagcccttca tctggtgcat gctgcacaac tttggcggaa accacggact gttcggagct 1260 ttagaggctg tgaatggcgg acccgaagct gcccggctgt tccccaactc caccatggtg 1320 ggaaccggaa tggcccccga aggcatttcc cagaatgagg tggtctacag cctcatggcc 1380 gagctcggat ggcggaagga tcccgttccc gatttagctg cttgggtgac ctccttcgct 1440 gctcggaggt atggcgtgtc ccatcccgat gccggagctg cttggaggtt attackcgt 1500 tccgtctaca actgctccgg cgaggcttgc cggggacata atcggtcccc tttagttcgt 1560 aggccttctt tacagatgaa taccagcatc tggtacaacc ggagcgacgt gttcgaagct tggcgtttat tactgacatc cgctccctct ttagctacca gccccgcctt tcgttatgat 1680. ttattagatc tgactcgtca agctgtgcaa gaactggtgt ctttatacta cgaggaagct cggagcgcct atttatccaa agagctggcc tctttactga gggctggagg cgtgctggct tatgagctgc tccccgcttt agatgaggtt ttagctagcg actctcgttt tttactggga tcttggctgg agcaagctcg tgccgctgcc gtgagcgag ccgaggccga tttctatgag cagaactccc ggtaccagct cagactctgg ggccccgagg gcacattct ggactacgcc aacaagcagc tggctggact ggtggccaac tactacaccc ctcgttggag gctgttttta gaagctctgg tcgactccgt ggcccaaggt atccccttcc aacagcacca gttcgacaag aatgtgttcc agctggaca agctttcgtg ctgtccaaac aaaggtaccc ctcccagccc cggggagaca cagtggatct ggccaagaag atctttttaa agtattaccc tcggtgggtg 2220 gctggaagct gg 2232 <210> 29 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hNAGLU mutant type 10 <400> 29 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu Asp 195 200 205 Arg Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Pro 305 310 315 320 Asp Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gln Leu Glu Gln Ala Phe Val Leu Ser 675 680 685 Lys Gln Arg Tyr Pro Ser Gln Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 30 <211> 2229 <212> DNA <213> Artificial sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 10, synthetic sequence <400> 30 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtgt tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcggatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggaccccg acgctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttat attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactcccggt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 31 <211> 721 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hNAGLU mutant type 11 <400> 31 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Glu Ser Gly Leu Asp Thr Tyr Ser Leu Ser Gly Gly Gly 35 40 45 Gly Ala Ala Arg Val Arg Val Arg Gly Ser Thr Gly Val Ala Ala Ala 50 55 60 Ala Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala 65 70 75 80 Trp Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro 85 90 95 Gly Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn 100 105 110 Val Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp 115 120 125 Glu Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu 130 135 140 Ala Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu 145 150 155 160 Gly Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe 165 170 175 Leu Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu 180 185 190 Pro Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu 195 200 205 Asp Arg Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala 210 215 220 Gly His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val 225 230 235 240 Thr Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser 245 250 255 Phe Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu 260 265 270 Phe Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly 275 280 285 Ala Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr 290 295 300 Leu Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp 305 310 315 320 Thr Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro 325 330 335 Gln Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro 340 345 350 Arg Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val 355 360 365 Tyr Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met 370 375 380 Leu His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala 385 390 395 400 Val Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met 405 410 415 Val Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val 420 425 430 Tyr Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp 435 440 445 Leu Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser 450 455 460 His Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr 465 470 475 480 Asn Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val 485 490 495 Arg Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser 500 505 510 Asp Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu 515 520 525 Ala Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln 530 535 540 Ala Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala 545 550 555 560 Tyr Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu 565 570 575 Ala Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser 580 585 590 Arg Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val 595 600 605 Ser Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Arg Tyr Gln Leu 610 615 620 Thr Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln 625 630 635 640 Leu Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe 645 650 655 Leu Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln 660 665 670 His Gln Phe Asp Lys Asn Val Phe Gln Leu Glu Gln Ala Phe Val Leu 675 680 685 Ser Lys Gln Arg Tyr Pro Ser Gln Pro Arg Gly Asp Thr Val Asp Leu 690 695 700 Ala Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser 705 710 715 720 Trp <210> 32 <211> 2232 <212> DNA <213> Artificial sequence <220> <223> Nucleic acid sequence coding hNAGLU mutant type 11, synthetic sequence <400> 32 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctgagtcc 180 ggtttagaca cctactccct ctctggcgga ggaggagctg ctagggttcg tgttcgtgga 240 tccactggtg tggccgctgc tgctggactc catcgttatt tacgggattt ctgtggatgc 300 cacgtggctt ggagcggcag ccaactgagg ctccctaggc ctctgcccgc tgtccccggt 360 gaactgaccg aggctacccc caatcggtac cggtactacc agaacgtgtg cacccaaagc 420 tattccttcg tgtggtggga ctgggctcgt tgggaaaggg agatcgactg gatggccctc 480 aacggaatta atctggcttt agcttggtcc ggccaagagg ccatttggca gagggtgtac 540 ctcgctttag gtttaacaca agctgagatc aacgaattct tcaccggccc cgcttttctc 600 gcttggggac ggatgggcaa tttacacact tgggatggcc ctctcccccc ttcttggcac 660 attaagcaac tgtatttaca gcatcgtgtg ctcgatcgga tgaggtcctt cggcatgaca 720 cccgtgctcc ccgcttttgc tggccacgtc cccgaagctg tcactcgtgt gtttcctcaa 780 gttaacgtga caaagatggg ctcttggggc cactttaact gcagctacag ctgttccttt 840 ttactggccc ccgaggatcc catttttccc atcatcggct ccctcttttt aagggagctg 900 atcaaagagt tcggcaccga ccacatttac ggcgccgaca cctttaacga gatgcagccc 960 cctagcagcg agcctagcta tttagctgct gccaccacag ccgtctatga ggccatgacc 1020 gccgtggaca ccgaagctgt gtggctgctg caaggttggc tgttccagca ccagcctcag 1080 ttctggggcc ccgctcaaat tcgtgccgtg ctgggcgccg tgcctcgggg tcgtctgctg 1140 gtcctcgatc tgttcgctga gtcccaaccc gtttacacaa ggacagcctc cttccaaggt 1200 cagcccttca tctggtgcat gctgcacaac tttggcggaa accacggact gttcggagct 1260 ttagaggctg tgaatggcgg acccgaagct gcccggctgt tccccaactc caccatggtg 1320 ggaaccggaa tggcccccga aggcatttcc cagaatgagg tggtctacag cctcatggcc 1380 gagctcggat ggcggaagga tcccgttccc gatttagctg cttgggtgac ctccttcgct 1440 gctcggaggt atggcgtgtc ccatcccgat gccggagctg cttggaggtt attattacgt 1500 tccgtctaca actgctccgg cgaggcttgc cggggacata atcggtcccc tttagttcgt 1560 aggccttctt tacagatgaa taccagcatc tggtacaacc ggagcgacgt gttcgaagct 1620 tggcgtttat tactgacatc cgctccctct ttagctacca gccccgcctt tcgttatgat 1680 ttattagatc tgactcgtca agctgtgcaa gaactggtgt ctttatacta cgaggaagct 1740 cggagcgcct atttatccaa agagctggcc tctttactga gggctggagg cgtgctggct 1800 tatgagctgc tccccgcttt agatgaggtt ttagctagcg actctcgttt tttactggga 1860 tcttggctgg agcaagctcg tgccgctgcc gtgagcgaag ccgaggccga tttctatgag 1920 cagaactccc ggtaccagct gacactctgg ggccccgagg gcaacattct ggactacgcc 1980 aacaagcagc tggctggact ggtggccaac tactacaccc ctcgttggag gctgttttta 2040 gaagctctgg tcgactccgt ggcccaaggt atccccttcc aacagcacca gttcgacaag 2100 aatgtgttcc agctggaaca agctttcgtg ctgtccaaac aaaggtaccc ctcccagccc 2160 cggggagaca cagtggatct ggccaagaag atctttttaa agtattaccc tcggtgggtg 2220 gctggaagct gg 2232 <210> 33 <211> 720 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hNAGLU mutant type 12 <400> 33 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Gly Gly Gly Gly 35 40 45 Ala Ala Arg Val Arg Ile Arg Gly Ser Thr Gly Val Ala Ala Ala Ala 50 55 60 Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala Trp 65 70 75 80 Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro Gly 85 90 95 Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn Val 100 105 110 Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp Glu 115 120 125 Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu Ala 130 135 140 Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu Gly 145 150 155 160 Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe Leu 165 170 175 Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu Pro 180 185 190 Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu Asp 195 200 205 Arg Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala Gly 210 215 220 His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val Thr 225 230 235 240 Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser Phe 245 250 255 Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu Phe 260 265 270 Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly Ala 275 280 285 Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr Leu 290 295 300 Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp Thr 305 310 315 320 Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro Gln 325 330 335 Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro Arg 340 345 350 Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val Tyr 355 360 365 Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met Leu 370 375 380 His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala Val 385 390 395 400 Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met Val 405 410 415 Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val Tyr 420 425 430 Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp Leu 435 440 445 Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser His 450 455 460 Pro Asp Ala Gly Ala Ala Trp Arg Leu Leu Leu Arg Ser Val Tyr Asn 465 470 475 480 Cys Ser Gly Glu Ala Cys Arg Gly His Asn Arg Ser Pro Leu Val Arg 485 490 495 Arg Pro Ser Leu Gln Met Asn Thr Ser Ile Trp Tyr Asn Arg Ser Asp 500 505 510 Val Phe Glu Ala Trp Arg Leu Leu Leu Thr Ser Ala Pro Ser Leu Ala 515 520 525 Thr Ser Pro Ala Phe Arg Tyr Asp Leu Leu Asp Leu Thr Arg Gln Ala 530 535 540 Val Gln Glu Leu Val Ser Leu Tyr Tyr Glu Glu Ala Arg Ser Ala Tyr 545 550 555 560 Leu Ser Lys Glu Leu Ala Ser Leu Leu Arg Ala Gly Gly Val Leu Ala 565 570 575 Tyr Glu Leu Leu Pro Ala Leu Asp Glu Val Leu Ala Ser Asp Ser Arg 580 585 590 Phe Leu Leu Gly Ser Trp Leu Glu Gln Ala Arg Ala Ala Ala Val Ser 595 600 605 Glu Ala Glu Ala Asp Phe Tyr Glu Gln Asn Ser Lys Tyr Gln Leu Thr 610 615 620 Leu Trp Gly Pro Glu Gly Asn Ile Leu Asp Tyr Ala Asn Lys Gln Leu 625 630 635 640 Ala Gly Leu Val Ala Asn Tyr Tyr Thr Pro Arg Trp Arg Leu Phe Leu 645 650 655 Glu Ala Leu Val Asp Ser Val Ala Gln Gly Ile Pro Phe Gln Gln His 660 665 670 Gln Phe Asp Lys Asn Val Phe Gln Leu Glu Gln Ala Phe Val Leu Ser 675 680 685 Lys Gln Arg Tyr Pro Ser Gln Pro Arg Gly Asp Thr Val Asp Leu Ala 690 695 700 Lys Lys Ile Phe Leu Lys Tyr Tyr Pro Arg Trp Val Ala Gly Ser Trp 705 710 715 720 <210> 34 <211> 2229 <212> DNA <213> Artificial sequence <220> <223> nucleic acid sequence coding hNAGLU mutant type 12, synthetic sequence <400> 34 atggaggctg tggccgtcgc cgccgctgtg ggcgtgctgc tgctggctgg cgctggcggc 60 gccgccggcg acgaggctag ggaagccgcc gccgtgcggg ccctcgtggc taggctgctg 120 ggccccggtc ccgctgccga tttttccgtg agcgtcgaga gggccctcgc tgctaagccc 180 ggtttagaca cctactccct cggcggagga ggagctgcta gggttcgtat tcgtggatcc 240 actggtgtgg ccgctgctgc tggactccat cgttatttac gggatttctg tggatgccac 300 gtggcttgga gcggcagcca actgaggctc cctaggcctc tgcccgctgt ccccggtgaa 360 ctgaccgagg ctacccccaa tcggtaccgg tactaccaga acgtgtgcac ccaaagctat 420 tccttcgtgt ggtgggactg ggctcgttgg gaaagggaga tcgactggat ggccctcaac 480 ggaattaatc tggctttagc ttggtccggc caagaggcca tttggcagag ggtgtacctc 540 gctttaggtt taacacaagc tgagatcaac gaattcttca ccggccccgc ttttctcgct 600 tggggacgga tgggcaattt acacacttgg gatggccctc tccccccttc ttggcacatt 660 aagcaactgt atttacagca tcgtgtgctc gatcggatga ggtccttcgg catgacaccc 720 gtgctccccg cttttgctgg ccacgtcccc gaagctgtca ctcgtgtgtt tcctcaagtt 780 aacgtgacaa agatgggctc ttggggccac tttaactgca gctacagctg ttccttttta 840 ctggcccccg aggatcccat ttttcccatc atcggctccc tctttttaag ggagctgatc 900 aaagagttcg gcaccgacca catttacggc gccgacacct ttaacgagat gcagccccct 960 agcagcgagc ctagctattt agctgctgcc accacagccg tctatgaggc catgaccgcc 1020 gtggacaccg aagctgtgtg gctgctgcaa ggttggctgt tccagcacca gcctcagttc 1080 tggggccccg ctcaaattcg tgccgtgctg ggcgccgtgc ctcggggtcg tctgctggtc 1140 ctcgatctgt tcgctgagtc ccaacccgtt tacacaagga cagcctcctt ccaaggtcag 1200 cccttcatct ggtgcatgct gcacaacttt ggcggaaacc acggactgtt cggagcttta 1260 gaggctgtga atggcggacc cgaagctgcc cggctgttcc ccaactccac catggtggga 1320 accggaatgg cccccgaagg catttcccag aatgaggtgg tctacagcct catggccgag 1380 ctcggatggc ggaaggatcc cgttcccgat ttagctgctt gggtgacctc cttcgctgct 1440 cggaggtatg gcgtgtccca tcccgatgcc ggagctgctt ggaggttatt attacgttcc 1500 gtctacaact gctccggcga ggcttgccgg ggacataatc ggtccccttt agttcgtagg 1560 ccttctttac agatgaatac cagcatctgg tacaaccgga gcgacgtgtt cgaagcttgg 1620 cgtttattac tgacatccgc tccctcttta gctaccagcc ccgcctttcg ttatgattta 1680 ttagatctga ctcgtcaagc tgtgcaagaa ctggtgtctt tatactacga ggaagctcgg 1740 agcgcctatt tatccaaaga gctggcctct ttactgaggg ctggaggcgt gctggcttat 1800 gagctgctcc ccgctttaga tgaggtttta gctagcgact ctcgtttttt actgggatct 1860 tggctggagc aagctcgtgc cgctgccgtg agcgaagccg aggccgattt ctatgagcag 1920 aactccaagt accagctgac actctggggc cccgagggca acattctgga ctacgccaac 1980 aagcagctgg ctggactggt ggccaactac tacacccctc gttggaggct gtttttagaa 2040 gctctggtcg actccgtggc ccaaggtatc cccttccaac agcaccagtt cgacaagaat 2100 gtgttccagc tggaacaagc tttcgtgctg tccaaacaaa ggtacccctc ccagccccgg 2160 ggagacacag tggatctggc caagaagatc tttttaaagt attaccctcg gtgggtggct 2220 ggaagctgg 2229 <210> 35 <211> 721 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hNAGLU mutant type 13 <400> 35 Asp Glu Ala Arg Glu Ala Ala Ala Val Arg Ala Leu Val Ala Arg Leu 1 5 10 15 Leu Gly Pro Gly Pro Ala Ala Asp Phe Ser Val Ser Val Glu Arg Ala 20 25 30 Leu Ala Ala Lys Pro Gly Leu Asp Thr Tyr Ser Leu Ser Gly Gly Gly 35 40 45 Gly Ala Ala Arg Val Arg Ile Arg Gly Ser Thr Gly Val Ala Ala Ala 50 55 60 Ala Gly Leu His Arg Tyr Leu Arg Asp Phe Cys Gly Cys His Val Ala 65 70 75 80 Trp Ser Gly Ser Gln Leu Arg Leu Pro Arg Pro Leu Pro Ala Val Pro 85 90 95 Gly Glu Leu Thr Glu Ala Thr Pro Asn Arg Tyr Arg Tyr Tyr Gln Asn 100 105 110 Val Cys Thr Gln Ser Tyr Ser Phe Val Trp Trp Asp Trp Ala Arg Trp 115 120 125 Glu Arg Glu Ile Asp Trp Met Ala Leu Asn Gly Ile Asn Leu Ala Leu 130 135 140 Ala Trp Ser Gly Gln Glu Ala Ile Trp Gln Arg Val Tyr Leu Ala Leu 145 150 155 160 Gly Leu Thr Gln Ala Glu Ile Asn Glu Phe Phe Thr Gly Pro Ala Phe 165 170 175 Leu Ala Trp Gly Arg Met Gly Asn Leu His Thr Trp Asp Gly Pro Leu 180 185 190 Pro Pro Ser Trp His Ile Lys Gln Leu Tyr Leu Gln His Arg Val Leu 195 200 205 Asp Arg Met Arg Ser Phe Gly Met Thr Pro Val Leu Pro Ala Phe Ala 210 215 220 Gly His Val Pro Glu Ala Val Thr Arg Val Phe Pro Gln Val Asn Val 225 230 235 240 Thr Lys Met Gly Ser Trp Gly His Phe Asn Cys Ser Tyr Ser Cys Ser 245 250 255 Phe Leu Leu Ala Pro Glu Asp Pro Ile Phe Pro Ile Ile Gly Ser Leu 260 265 270 Phe Leu Arg Glu Leu Ile Lys Glu Phe Gly Thr Asp His Ile Tyr Gly 275 280 285 Ala Asp Thr Phe Asn Glu Met Gln Pro Pro Ser Ser Glu Pro Ser Tyr 290 295 300 Leu Ala Ala Ala Thr Thr Ala Val Tyr Glu Ala Met Thr Ala Val Asp 305 310 315 320 Thr Glu Ala Val Trp Leu Leu Gln Gly Trp Leu Phe Gln His Gln Pro 325 330 335 Gln Phe Trp Gly Pro Ala Gln Ile Arg Ala Val Leu Gly Ala Val Pro 340 345 350 Arg Gly Arg Leu Leu Val Leu Asp Leu Phe Ala Glu Ser Gln Pro Val 355 360 365 Tyr Thr Arg Thr Ala Ser Phe Gln Gly Gln Pro Phe Ile Trp Cys Met 370 375 380 Leu His Asn Phe Gly Gly Asn His Gly Leu Phe Gly Ala Leu Glu Ala 385 390 395 400 Val Asn Gly Gly Pro Glu Ala Ala Arg Leu Phe Pro Asn Ser Thr Met 405 410 415 Val Gly Thr Gly Met Ala Pro Glu Gly Ile Ser Gln Asn Glu Val Val 420 425 430 Tyr Ser Leu Met Ala Glu Leu Gly Trp Arg Lys Asp Pro Val Pro Asp 435 440 445 Leu Ala Ala Trp Val Thr Ser Phe Ala Ala Arg Arg Tyr Gly Val Ser 450 455 460 His Pro As...

Claims

1. A mutant of human α-N-acetylglucosidase (hNAGLU), comprising the amino acid sequence shown in Serial No. 9 obtained by replacing glutamine at position 209 with arginine in the amino acid sequence of wild-type hNAGLU shown in Serial No.

1.

2. An hNAGLU mutant selected from the following groups (8) to (15): (8) The hNAGLU mutant, which is composed of the amino acid sequence shown in sequence number 25, obtained by replacing lysine at position 36 with glutamic acid and proline at position 37 with serine in the amino acid sequence shown in sequence number 9. (9) The hNAGLU mutant, which is formed by adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence shown in sequence number 9. (10) The hNAGLU mutant, which is composed of the amino acid sequence shown in sequence number 29, obtained by replacing threonine at position 320 with proline and glutamic acid at position 321 with aspartic acid in the amino acid sequence shown in sequence number 9. (11) The hNAGLU mutant is formed by replacing lysine at position 36 with glutamic acid, proline at position 37 with serine, and adding serine between leucine at position 44 and glycine at position 45, resulting in the amino acid sequence shown in sequence number 31. (12) The hNAGLU mutant is composed of the amino acid sequence shown in sequence number 33, which is obtained by replacing valine at position 54 with isoleucine and arginine at position 620 with lysine in the amino acid sequence shown in sequence number 9. (13) The hNAGLU mutant is formed by replacing valine at position 54 with isoleucine and adding serine between leucine at position 44 and glycine at position 45. (14) The hNAGLU mutant, consisting of the amino acid sequence shown in Serial No. 37, obtained by replacing arginine at position 620 with lysine and adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence shown in Serial No. 9; and (15) The hNAGLU mutant is formed by replacing valine at position 54 with isoleucine, replacing arginine at position 620 with lysine, and adding serine between leucine at position 44 and glycine at position 45 in the amino acid sequence shown in sequence number 9.

3. A DNA containing a gene encoding the hNAGLU mutant of claim 1 or 2.

4. An expression vector containing the DNA of claim 3.

5. A mammalian cell transformed with the expression vector of claim 4.

6. A method for manufacturing an hNAGLU mutant, comprising the step of culturing the mammalian cells of claim 5 in a serum-free culture medium.

7. A fusion protein, which is a fusion protein of the hNAGLU mutant and an antibody as described in claim 1 or 2, wherein, The fusion protein can cross the blood-brain barrier (BBB) ​​by binding to receptors on brain vascular endothelial cells with the antibody.

8. The fusion protein according to claim 7, wherein, The receptors on these brain vascular endothelial cells are selected from a group consisting of insulin receptor, transferrin receptor, leptin receptor, lipoprotein receptor, and IGF receptor.

9. The fusion protein according to claim 7, wherein, The receptor on these brain vascular endothelial cells is the transferrin receptor.

10. The fusion protein according to any one of claims 7 to 9, wherein, The antibody is any one of Fab antibody, F(ab')2 antibody, F(ab') antibody, single-domain antibody, single-chain antibody, or Fc antibody.

11. The fusion protein according to any one of claims 7 to 9, wherein, The hNAGLU mutant binds to either the C-terminal or N-terminal side of the light chain of the antibody.

12. The fusion protein according to any one of claims 7 to 9, wherein, The hNAGLU mutant binds to either the C-terminal or N-terminal side of the heavy chain of the antibody.

13. The fusion protein according to any one of claims 7 to 9, wherein, The hNAGLU mutant binds to either the C-terminal or N-terminal side of the light chain or either the C-terminal or N-terminal side of the heavy chain of the antibody via a linker sequence.

14. The fusion protein according to claim 13, wherein, The linker sequence consists of 1 to 50 amino acid residues.

15. The fusion protein according to claim 14, wherein, The linker sequence contains an amino acid sequence selected from the group consisting of one glycine, one serine, the amino acid sequence Gly-Ser, the amino acid sequence Ser-Ser, the amino acid sequence Gly-Gly-Ser, the amino acid sequence Gly-Gly-Gly-Gly-Ser shown in sequence number 58, the amino acid sequence Gly-Gly-Gly-Gly-Gly-Ser shown in sequence number 59, the amino acid sequence Ser-Gly-Gly-Gly-Gly shown in sequence number 60, and 1 to 10 amino acid sequences linked together from these amino acid sequences.

16. A DNA containing a gene encoding the fusion protein of any one of claims 7 to 15.

17. An expression vector containing the DNA of claim 16.

18. A mammalian cell transformed with the expression vector of claim 17.

19. A method for manufacturing a fusion protein of an hNAGLU mutant and an antibody, comprising culturing the mammalian cells of claim 18 in a serum-free culture medium.

Images