Epoxy resin composition

By interfering with the siRNA of the EoblCXE27 gene of the tea geometrid moth's antennal esterase, the problem of reduced sensitivity of the tea geometrid moth to bifenthrin was solved, thereby increasing the sensitivity of the tea geometrid moth to bifenthrin, enhancing the control effect, and improving the quality and safety of tea.

CN116240211BActive Publication Date: 2026-06-02TEA RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310157349.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-20
Publication Date
2026-06-02
Estimated Expiration
2043-02-20

AI Technical Summary

Technical Problem

The reduced sensitivity of tea geometrid moths to bifenthrin has led to tea quality and safety issues and economic losses caused by the use of chemical pesticides. Existing technologies are insufficient to effectively address insect resistance to pyrethroid pesticides.

Method used

Interference RNA (siRNA) of the EoblCXE27 gene of the tea geometrid moth was used to interfere with the expression of the EoblCXE27 gene, thereby reducing its expression level and increasing the sensitivity of the tea geometrid moth to bifenthrin.

Benefits of technology

By interfering with the EoblCXE27 gene of the tea geometrid moth's antennal esterase, the sensitivity of the tea geometrid moth to bifenthrin was significantly increased, enhancing the control effect, reducing pesticide residues, and improving the quality and safety of tea.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116240211B_ABST
    Figure CN116240211B_ABST
Patent Text Reader

Abstract

The tea geometrid antennal esterase EoblCXE27 gene and the interfering RNA of the gene and the application thereof belong to the technical field of biotechnology.The application provides the application of the tea geometrid antennal esterase EoblCXE27 gene and the application of the interfering RNA.The results show that the tea geometrid antennal esterase EoblCXE27 gene can be successfully interfered after the siEoblCXE27 is injected into the larvae and female adults.Compared with the control group, the sensitivity of the tea geometrid larvae after the antennal esterase EoblCXE27 gene is interfered to bifenthrin is significantly increased.The application will help to develop the green control technology of the tea geometrid with the antennal esterase EoblCXE27 gene as a target.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the EoblCXE27 gene of the tea geometrid moth and its interfering RNA, as well as their applications. Background Technology

[0002] The tea geometrid moth (Ectropis obliqua Prout), belonging to the family Geometridae in the order Lepidoptera, is a major lepidopteran pest in my country's tea gardens. It primarily feeds on the leaves of tea plants, and in severe outbreaks, it can deplete the entire tea plantation, causing serious harm to the safe production of tea and resulting in significant economic losses. Currently, chemical pesticides remain the main method for controlling the tea geometrid moth. However, the use of chemical pesticides easily leads to pesticide resistance in the moth and increases pesticide residues in tea, causing quality and safety issues.

[0003] Bifenthrin is a type of pyrethroid insecticide with broad-spectrum insecticidal and highly effective knockdown properties. It possesses strong contact and stomach poison effects and is widely used in tea gardens to control the tea geometrid moth. However, the widespread use of bifenthrin in tea gardens has led to decreased sensitivity and increased resistance in the tea geometrid moth.

[0004] Antennae esterases belong to the carboxylesterase (CXE) α / β hydrolase family and are widely distributed in organisms. CXEs play multiple functions in the metabolism of endogenous and exogenous chemicals in insects, including participating in the detoxification process of insects against pesticides such as pyrethroids. The amino acid sequence of CXEs contains the catalytic triplet Ser-His-Asp, which catalyzes the cleavage of ester bonds, thereby degrading esters. CXEs can also mediate insect resistance by chelating and blocking the interaction between pesticides and related target genes.

[0005] RNA interference (RNAi) is a highly conserved evolutionary phenomenon characterized by the efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). Small interfering RNA (siRNA) is a class of double-stranded RNA molecules, 20-25 base pairs in length, that can effectively interfere with or inhibit the expression of target genes.

[0006] Therefore, studying the EoblCXE27 gene of the tea geometrid moth's antennal esterase and its small interfering RNA has certain guiding significance for the green control of the tea geometrid moth. Summary of the Invention

[0007] To address the problems existing in the prior art, the present invention aims to provide a technical solution for the EoblCXE27 gene of the tea geometrid moth and its interfering RNA, as well as their applications.

[0008] The present invention specifically adopts the following technical solution:

[0009] The first aspect of this invention provides the application of the tea geometrid moth antennal esterase EoblCXE27 gene in the control of tea geometrid moth.

[0010] The second aspect of this invention provides the application of the tea geometrid moth antennal esterase EoblCXE27 gene in regulating the sensitivity of the tea geometrid moth to bifenthrin.

[0011] Furthermore, the application involves using gene interference techniques to interfere with the expression of the EoblCXE27 gene of the tea geometrid moth, thereby increasing the sensitivity of the tea geometrid moth to bifenthrin.

[0012] Furthermore, the gene interference specifically employs the siRNA of the tea geometrid moth's antennal esterase EoblCXE27 gene, the sense sequence of which is shown in SEQ ID NO.1, and the antisense sequence as shown in SEQ ID NO.2.

[0013] The third aspect of the present invention provides an siRNA that targets and interferes with the expression of the EoblCXE27 gene of the tea geometrid moth, wherein the sense sequence of the siRNA is shown in SEQ ID NO.1 and the antisense sequence is shown in SEQ ID NO.2.

[0014] The fourth aspect of this invention provides the application of the siRNA in the control of the tea geometrid moth.

[0015] The fifth aspect of this invention provides the application of the siRNA in regulating the sensitivity of the tea geometrid moth to bifenthrin.

[0016] The sixth aspect of this invention provides a method for improving the sensitivity of the tea geometrid moth to bifenthrin. Specifically, the method involves introducing the siRNA of the tea geometrid moth's antennal esterase gene EoblCXE27 into the tea geometrid moth to reduce the expression level of the antennal esterase gene, thereby improving the sensitivity of the tea geometrid moth to bifenthrin. The sense sequence of the siRNA is shown in SEQ ID NO.1, and the antisense sequence is shown in SEQ ID NO.2.

[0017] This invention utilizes siRNA to interfere with the antennal esterase gene of the tea geometrid moth. Results showed that the EoblCXE27 antennal esterase gene was successfully interfered with in both larvae and adult females after injection of siEoblCXE27. Compared to the control group, the larvae of the tea geometrid moth with interfered EoblCXE27 gene showed significantly increased sensitivity to bifenthrin. This invention will contribute to the development of green control technologies for the tea geometrid moth targeting the EoblCXE27 antennal esterase gene. Attached Figure Description

[0018] Figure 1 For the amino acid sequence alignment analysis of EoblCXE27;

[0019] Figure 2 Tissue expression profile of EoblCXE27 larvae of the tea geometrid moth;

[0020] Figure 3 Tissue expression profile of adult tea geometrid moth EoblCXE27;

[0021] Figure 4 The position of the EoblCXE27 mutant amino acid;

[0022] Figure 5 The interaction between EoblCXE27 and bifenthrin molecules;

[0023] Figure 6 To verify the interference efficiency of the EoblCXE27 gene in larvae;

[0024] Figure 7 To verify the interference efficiency of the EoblCXE27 gene in female adults;

[0025] Figure 8 Sensitivity determination of tea geometrid moth larvae to bifenthrin after EoblCXE27 gene interference. Detailed Implementation

[0026] The present invention will be further illustrated below with reference to the embodiments.

[0027] Test insect: The tea geometrid moth was a multi-generational cultured population in the laboratory. Collected from Yuhang, Zhejiang Province, the population was identified as *Tea geometrid moth* using mitochondrial DNA cytochrome oxidase I (COI) gene markers and morphological observation. Rearing conditions: Temperature 25±1℃, relative humidity 70%±5%.

[0028] Reagents and instruments: Trizol, MonScript TM RTIII Super Mix with dsDNase(Two-Step)、MonPure TMGel & PCR Purification Kit (Mona Biotechnology, Wuhan) Max MasterMix, pCE2TA / Blunt-Zero vector (Norvita, Nanjing), 10×Ex Taq Buffer (Mg 2+ The equipment includes TB GreenPremix Ex TaqⅡ (TliRNaseH Plus) (TaKaRa, Dalian Takara Bio), Roche Light Cycler 480 Quantitative PCR instrument (Roche, Switzerland), and NanoDrop 2000 spectrophotometer, etc.

[0029] Example 1: Cloning and verification of the EoblCXE27 gene sequence of the tea geometrid moth's antennal esterase

[0030] 1. Total RNA and first-strand cDNA synthesis

[0031] Total RNA was extracted using the Trizol method, and RNA quality was verified using a NanoDrop 2000 spectrophotometer and 2% agarose gel electrophoresis. MonScript was used for analysis. TM RTIII Super Mix with dsDNase (Two-Step) (Mona Bio) reagent was used to synthesize the first-strand cDNA using a two-step PCR method. The mixture was stored at -20°C for later use.

[0032] 2. PCR amplification

[0033] Based on the gene sequence of the tea geometrid moth's antennal esterase EoblCXE27 (GenBank accession number: KX015869.1), cloning primers were designed using primer3plus (https: / / www.primer3plus.com / ). The primer sequences are as follows:

[0034] EoblCXE27-F:ATGGCAAAAGTGAAAGTGAATCAAGG(SEQ ID NO.5)

[0035] EoblCXE27-R:TTAAAATTCGAGTCCAGCCTTGAAATAA(SEQ ID NO.6)

[0036] use PCR reactions were performed using Max Master Mix (Novizan, Nanjing) reagents. PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 40 cycles: 95℃ denaturation for 15 s; annealing for 15 s; 72℃ extension for 2 min; 72℃ final extension for 5 min. Reaction products were stored at 4℃. PCR products were analyzed using 1.5% agarose gels and analyzed with MonPure gels. TM The gel and PCR Purification Kit (Mona Biotechnology, Wuhan) were used to recover the DNA, ligate it into the pCE2 TA / Blunt-Zero vector, and select positive clones for sequencing.

[0037] 3 Results Analysis

[0038] Alignment of the CLUSTALW sequence (EoblCXE27-1)(KX015869.1) with the re-cloned sequence (EoblCXE27-2) revealed a single amino acid variation at Ser221Thr. Figure 1 ).

[0039] Example 2: Tissue expression analysis of the EoblCXE27 gene, an esterase in the antennae of the tea geometrid moth.

[0040] 1. Quantitative Real-Time PCR

[0041] The expression levels of EoblCXEs in different tissues were analyzed using qRT-PCR. Variations between samples were corrected using GAPDH (accession number: KT_991373) and its quantitative primers: EoblGADPH-F: TATCTCTCTGAACGACAACTT (SEQ ID NO.7); EoblGADPH-R: TTGGTCTGGATGTACTTGAT (SEQ ID NO.8). The quantitative primers for EoblCXE27 are as follows: EoblCXE27-qPCR-F: TGGTAACAGAAGACGGGAAGT (SEQ ID NO.9); EoblCXE27-qPCR-R: CATGGTATAGGTGGTTGAGGG (SEQ ID NO.10). qRT-PCR reagent used was TB Green Premix Ex TaqⅡ (TliRNaseH Plus) (TaKaRa, Dalian Takara Bio). The qPCR program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 20 s, for 40 cycles. Melting curve analysis: 95℃ for 5 s; 60℃ for 1 min; then heated to 95℃, followed by 50℃ for 30 s. The melting curve was observed to verify primer specificity. 2 -△△CTResults were calculated using SPSS and Microsoft Excel software for data analysis. Relative expression levels between tissues were determined using one-way analysis of variance (ANOVA), with multiple comparisons performed using Tukey's method. Experimental graphs were generated using Origin 2018 software.

[0042] 2. Results Analysis

[0043] EoblCXE27 was expressed at the highest level in the midgut of the tea geometrid moth larvae, and at lower levels in the larval head, fat body, and epidermis. Figure 2 Tissue expression profile analysis of adult insects showed that EoblCXE27 was mainly expressed in the heads of both male and female adults. Figure 3 ).

[0044] Example 3: Docking of tea geometrid moth antennal esterase EoblCXE27 with bifenthrin molecules

[0045] 1. Construction of the tea geometrid moth EoblCXE27 model and its docking with bifenthrin molecules

[0046] 3D structures of compound molecules were obtained from PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ) and the PheroBase database (http: / / www.pherobase.com / ) for molecular docking operations.

[0047] The AlphaFold2 model (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb) was used to predict the EoblCXE27 model of the tea geometrid moth. The obtained model was evaluated using SAVS v6.0. The binding of EoblCXE27 of the tea geometrid moth to bifenthrin was studied using AutoDockVina 1.2.3 software, and the main interaction forces between the protein and ligand were analyzed using LigPlus.

[0048] 2. Results Analysis

[0049] The amino acid variant EoblCXE27, Ser221Thr, is not located at the binding cavity. Figure 4 EoblCXE27 showed a strong binding ability to bifenthrin, with a binding energy of -9.804 kcal / mol, indicating that the tea geometrid moth EoblCXE27 may be able to bind bifenthrin, and then catalyze the amino acid to break the ester bond of bifenthrin, thereby achieving degradation.

[0050] Binding force analysis of the complex formed by the tea geometrid moth EoblCXE27 and bifenthrin revealed that hydrophobic interactions and hydrogen bonds are the key forces binding EoblCXE27 to bifenthrin. A 2.93 Å hydrogen bond is formed between the Phe residue at position 282 of EoblCXE27 and bifenthrin. The amino acid residues Pro262, Ile263, Leu281, Leu279, Phe280, Ala277, Gly108, Phe111, Gly107, Gly110, Met70, Arg68, Phe73, and Ile260 are the main contributing amino acid residues to the hydrophobic interactions between EoblCXE27 and bifenthrin. Figure 5 ).

[0051] Example 4: RNA interference in the EoblCXE27 gene of the tea geometrid moth's antennal esterase

[0052] 1. RNA interference in the EoblCXE27 gene of the tea geometrid moth larvae

[0053] Small interfering RNA (siRNA) was designed from a specific region of the EoblCXE27 sequence of the tea geometrid moth. The design and synthesis of the EoblCXE27 gene siRNA were completed by Gemma Gene (Shanghai, China).

[0054] siEoblCXE27sense(5'-3'):GGGUGAAGGAGAAUAUAAATT(SEQ ID NO.1)

[0055] siEoblCXE27antisense(5'-3'):UUUAUAUUCUCCUUCACCCTT(SEQ ID NO.2)

[0056] The negative control siGFP primer sequences were: sense (5'-3'): GGCUACGUCCAGGAGCGCACC (SEQ ID NO. 3), antisense (5'-3'): UGCGCUCCUGGACGUAGCCUU (SEQ ID NO. 4). 400 ng of siEoblCXE27 was injected into the larvae of the tea geometrid moth. Larvae were fed with fresh tea leaves 12 h, 24 h, and 48 h after injection, and samples were taken at these times. The interference effect of siEoblCXE27 on the EoblCXE27 gene was detected by qRT-PCR.

[0057] 2. Mortality rate of tea geometrid moth larvae after EoblCXE27 gene interference with bifenthrin

[0058] Larvae injected with siEoblCXE27 were treated with bifenthrin 24 hours later; 20 larvae per replicate, for a total of 7 replicates. Mortality was recorded 48 hours after treatment, with siGFP injection as a control.

[0059] 3. RNA interference in the EoblCXE27 gene of female adult tea geometrid moths

[0060] 400 ng of siEoblCXE27 and siGEP were injected into the abdomen of female insects, respectively. Fifteen insects were injected in each group, with each adult female receiving 2 μL (200 ng / μL), and each treatment was repeated four times. siGFP was injected into adult females as a control. Female insects were fed honey water for 30 h and 42 h after injection, and the EoblCXE27 gene interference effect was detected by qRT-PCR.

[0061] 4. Results Analysis

[0062] Quantitative fluorescence results showed that, compared with the control (siGFP), the expression level of the EoblCXE27 gene was significantly decreased in tea geometrid moth larvae 24h and 48h after injection. Figure 6 ). 42 hours after injection of siEoblCXE27 into female adult tea geometrid moths, the expression level of the EoblCXE27 gene was significantly downregulated compared to the control (siGFP). Figure 7 ).

[0063] Experiments on the susceptibility of tea geometrid moth larvae to bifenthrin showed that successful interference with the EoblCXE27 gene significantly increased the larvae's sensitivity to bifenthrin, with a mortality rate increasing by approximately 19.3% compared to the control group. Figure 8 ).

Claims

1. Targeted interference with the antennal esterase of the tea geometrid moth EoblCXE27 siRNA for gene expression, characterized by, The sense sequence of the siRNA is shown in SEQ ID NO.1, and the antisense sequence is shown in SEQ ID NO.

2.

2. The application of the combination of siRNA and bifenthrin as described in claim 1 in the control of tea geometrid moth.

3. The application of the siRNA as described in claim 1 in improving the sensitivity of tea geometrid moth to bifenthrin.

4. A method for improving the sensitivity of the tea geometrid moth to bifenthrin, characterized in that, Tea geometrid moth antennae esterase EoblCXE27 The siRNA gene was introduced into the tea geometrid moth to reduce the expression level of the antennal enzyme gene, thereby increasing the sensitivity of the tea geometrid moth to bifenthrin. The sense sequence of the siRNA is shown in SEQ ID NO.1, and the antisense sequence is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Tea geometrid chitin synthetase gene chsA and use thereof

    CN101215570A

  • Alkyl substituted phosphates and phosphonates as disruptants of insect sex pheromone-mediated behavior

    US5128333A