A method for hydrolyzing nucleosides by a biological enzyme
By using acidophilic nucleoside hydrolase to catalyze the hydrolysis of purine and pyrimidine nucleosides under acidic conditions, the problems of low conversion rate and difficult separation and purification in the existing technology have been solved, and efficient nucleoside hydrolysis and product separation have been achieved.
Patent Information
- Application Number
- CN202310244524.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-08
- Filing Date
- 2023-03-13
- Publication Date
- 2025-12-26
- Estimated Expiration
- 2043-03-13
AI Technical Summary
In existing technologies, the optimal working pH of nucleoside hydrolases is close to neutral, which is not conducive to substrate dissolution. The conversion rate of the hydrolysis reaction is difficult to exceed 95%, which increases the difficulty of downstream separation and purification.
Acidophilic nucleoside hydrolases derived from Trypanosoma cruzi strain CL Brener and Trypanosoma conorhinia were used to catalyze the hydrolysis of purine or pyrimidine nucleosides in the presence of CaCl2 or Ca(HCO3)2 at 20–50 °C and pH 3.0–6.0. The enzyme solutions were purified using recombinant plasmids and nickel ion affinity chromatography columns.
Complete hydrolysis of purine and pyrimidine nucleosides was achieved under acidic conditions, with a conversion rate exceeding 95%, shortening the production cycle and reducing the difficulty of separation and purification.
Smart Images

Figure CN116240249B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of bioengineering, and relates to a nucleoside, in particular to a method for hydrolyzing nucleoside by biological enzyme. BACKGROUND
[0002] Nucleosides are a class of compounds composed of purine or pyrimidine base, ribose or deoxyribose. The hydrolysis products of nucleosides mainly include adenine, guanine, hypoxanthine, cytosine, uracil and other bases, which have a wide range of uses in food, cosmetics, medicine and other industries. For example, guanine can be used as a cosmetic colorant, color additive, sunscreen (Panush S, et al. Subtle patina metallic coatings contain guanine. EP439112). Hypoxanthine has pharmacological activities such as lowering blood pressure, relieving asthma, and treating gout (Song Yan, et al. Optimization of hypoxanthine purification process in rabbit myocardium. Chinese Journal of Biochemistry and Medicinal, 2012. 33(06)). In agricultural production, hypoxanthine has bactericidal effect and can be used as a pesticide intermediate. Cytosine can be used to synthesize anti-AIDS drugs and anticancer drugs. Because purine and pyrimidine bases have a wide range of uses, their production research has been increasingly valued.
[0003] At present, the main production methods of purine and pyrimidine bases with industrial prospects include enzyme hydrolysis and chemical synthesis. Chemical synthesis usually requires high temperature and high pressure environment, and a large amount of toxic reagents are also used. More importantly, the substrate conversion rate is not high, which limits the production of such substances. Enzymatic hydrolysis is a method that uses nucleoside hydrolase as a catalyst and a variety of nucleosides as raw materials to cut the glycosidic bond of nucleosides through a one-step enzymatic reaction to obtain the corresponding base. Nucleoside hydrolases can be classified according to their preferred substrates, and common ones include cytidine-uridine nucleoside hydrolase, inosine-adenosine-guanosine nucleoside hydrolase, etc. Maciej et al. purified a nucleoside hydrolase from yellow lupin seeds that prefers guanosine-inosine, and the enzyme activity reached a maximum in the presence of divalent cations (Maciej, et al. Calcium-stimulated guanosine–inosine nucleosidase from yellow lupin (Lupinus luteus). Phytochemistry. 2006, 67(14)). Meng et al. identified the enzymatic properties of three nucleoside hydrolases from Corynebacterium glutamicum and found that they could all hydrolyze adenosine, cytidine, guanosine, inosine and uridine, but the substrate preference was different (Meng Yan, et al. Enzymatic properties of nucleoside hydrolases from Corynebacterium glutamicum. Food and Fermentation Industries, 2022). However, the optimal working pH of the reported nucleoside hydrolases is close to neutral, which is very unfavorable for substrate dissolution. In addition, the conversion rate of the hydrolysis reaction is difficult to exceed 95%, which increases the difficulty of downstream separation and purification.
[0004] Therefore, it is necessary to develop a method for efficiently and completely hydrolyzing nucleosides by biological enzymes in an acidic environment. SUMMARY
[0005] In view of the above technical problems in the prior art, the present application provides a method for hydrolyzing nucleosides by biological enzymes, which can solve the technical problem that the conversion rate of hydrolyzing nucleosides is difficult to exceed 95% in the prior art, and increases the difficulty of downstream separation and purification.
[0006] The present application provides a method for hydrolyzing nucleosides by biological enzymes, which uses purine nucleosides or pyrimidine nucleosides as raw materials, and reacts under the catalysis of nucleoside hydrolytic enzyme to obtain corresponding bases, the temperature in the reaction process is 20-50℃, the pH is 3.0-6.0, the reaction is carried out in the presence of CaCl2 or Ca(HCO3)2, the concentration of CaCl2 or Ca(HCO3)2 is 5-50mM, and the concentration of the purine nucleosides or pyrimidine nucleosides is 100-400mM.
[0007] The gene sequence of the nucleoside hydrolytic enzyme is as shown in any one of (1)-(3) as follows:
[0008] (1) the nucleotide sequence shown in SEQ ID NO. 1;
[0009] (2) the nucleotide sequence shown in SEQ ID NO. 2;
[0010] (3) a DNA molecule having at least 80% homology with the nucleotide sequence defined in (1) or (2) and encoding a protein having the same function.
[0011] The specific forms of various enzymes used in the present application include enzyme liquid, enzyme freeze-dried powder, enzyme-containing cells, and various immobilized enzymes and immobilized enzyme cells, which can be in the form of crude enzyme without purification, or in the form of partially purified or completely purified enzyme.
[0012] The nucleosides in the present application refer to purine nucleosides or pyrimidine nucleosides, including adenosine, guanosine, inosine, cytidine, and uridine.
[0013] The nucleoside hydrolase homologous sequence of the present application also includes at least 83%, 91%, 97% or 98% sequence similarity with the gene sequence disclosed in the present application. The percentage of sequence similarity can be obtained by known bioinformatics algorithms, including Myers and Miller algorithm, Needleman-Wunsch global alignment method, Smith-Waterman local alignment method, Pearson and Lipman similarity search method, Karlin and Altschul's algorithm, which are known to those skilled in the art. Although not all sources of nucleoside hydrolase have the effect claimed in the present application, two different sources of nucleoside hydrolase from Trypanosoma cruzi strain CL Brener and Trypanosoma conorhini have been confirmed to have effects, and those skilled in the art can know that the nucleotide sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2 disclosed in the present application and the DNA molecules having at least 80% homology with the nucleotide sequences defined in (1) or (2) and encoding proteins having the same function have good catalytic efficiency.
[0014] The present application first screened two acidophilic nucleoside hydrolases with excellent hydrolysis conversion rate and catalytic activity from Trypanosoma cruzi strain CL Brener and Trypanosoma conorhinia. The inventors compared the activities of nucleoside hydrolases from various microorganisms and confirmed that various nucleoside hydrolases having more than 75% amino acid sequence similarity with the nucleoside hydrolase from Trypanosoma conorhinia can catalyze the hydrolysis reaction, but the hydrolysis conversion rates are different.
[0015] In one embodiment of the nucleoside hydrolase required by the present application, the preparation method is as follows:
[0016] (1) The nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2 is connected to a plasmid to obtain a recombinant plasmid, which is then transformed into BL21(DE3) to obtain a recombinant bacteria;
[0017] (2) The recombinant bacteria are cultured, and the recombinant protein is induced and expressed. The bacteria are collected by high-pressure homogenizer crushing, and the protein is purified by nickel ion affinity chromatography column.
[0018] In one embodiment of the present application, the recombinant bacteria use pET-28a(+) as an expression vector.
[0019] In one embodiment of the present application, the recombinant bacteria use BL21 or Rosetta as a host bacteria.
[0020] The method constructed by the present application realizes complete hydrolysis of purine nucleosides to corresponding bases under acidic conditions, and the hydrolysis rate of pyrimidine nucleosides is also more than 95%.
[0021] The advantage of the present application is that the nucleoside hydrolytic enzyme of the present application can completely catalyze the hydrolysis of various nucleosides to form corresponding bases in an acidic environment, and the solubility of the substrate is increased. The enzyme addition amount, reaction temperature, pH and metal ion concentration of the system are optimized to establish the best reaction conditions and improve the yield. The biological enzyme method for hydrolyzing nucleosides of the present application can shorten the production cycle, and the product can be obtained in only 6-12h, and can avoid the problems of low product concentration, great difficulty in separation and purification, long production cycle and low product purity. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 Liquid chromatogram of hypoxanthine standard.
[0023] Figure 2 Liquid chromatogram of guanine standard.
[0024] Figure 3 Expression and purification of enzyme. DETAILED DESCRIPTION
[0025] The technical solutions in the embodiments of the present application will be described clearly and completely in combination with specific embodiments. In the following examples, the test methods used are conventional methods, and the materials, reagents, etc. used are commercially available unless otherwise specified. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application.
[0026] Example 1
[0027] The two nucleoside hydrolytic enzymes used in the following examples are respectively from Trypanosoma cruzi strain CLBrener and Trypanosoma conorhinia (SEQ ID NO. 1 and SEQ ID NO. 2). The respective genes are respectively connected to the pET28a expression vector to obtain recombinant plasmids pET28a-SEQ ID NO. 1 and pET28a-SEQ ID NO. 2, which are respectively transformed into competent Escherichia coli BL21 (DE3) to obtain positive clones, which are cultured to OD600 of 0.6-0.8, and then 0.2mM of IPTG is added, and the culture is induced at 18℃, 220rpm for 16h to obtain recombinant bacteria pET28a-SEQ ID NO. 1 / BL21 (DE3) and pET28a-SEQ ID NO. 2 / BL21 (DE3)
[0028] Example 2
[0029] The purification of the in vitro synthesized related enzymes was carried out according to the following specific steps:
[0030] The two recombinant bacteria of Example 1 were respectively inoculated into 50 ml LB containing 50 mg / L kanamycin, and cultured at 37°C, 220 rpm for 6-8 h, then inoculated into 100 ml LB at 2% inoculation amount, and cultured at 37°C, when the OD600 reached 0.6-0.8, 0.2 mM IPTG was added, and the induction was carried out at 18°C, 220 rpm for 16-18 h. The bacterial cells were collected by centrifugation, and the supernatant was discarded. An appropriate amount of Tris-HCl buffer (pH 8.0) containing 10 mM imidazole and 500 mM NaCl was added to resuspend the bacterial cells. The resuspended bacterial cells were added to a pressure crusher for crushing, and the pressure was 700-800 bar until the bacterial solution became clear. The crushed bacterial cells were collected, and the supernatant was obtained by centrifugation. The supernatant was poured into a nickel column, and eluted using Tris-HCl buffer containing different concentrations of imidazole. The eluate at a concentration of 200 mM imidazole was collected. The eluate was ultrafiltrated and concentrated until the remaining volume reached about 0.5 ml. 50% molecular grade glycerol was added at a volume ratio of 1:1, mixed well, and then divided into aliquots, and stored at -80°C for standby. The purified protein was analyzed by SDS-PAGE, and the results are shown in Figure 3 Lane 1 is protein marker; lane 2 is Trypanosoma cruzi strain CL Brener-derived nucleoside hydrolase; and lane 3 is Trypanosoma conorhinia-derived nucleoside hydrolase.
[0031] Example 3
[0032] The enzymatic hydrolysis of inosine was carried out according to the following specific steps:
[0033] The reaction system and reaction conditions were as follows: the reaction system included 5 mM CaCl2, 400 mM inosine, Trypanosoma cruzi strain CL Brener-derived nucleoside hydrolase at a concentration of 0.3-0.5 g / L, a total volume of 20 mL, 30-40°C, pH 4.0, and a reaction time of 6 h, and the product hypoxanthine was obtained.
[0034] The content of hypoxanthine was detected by high performance liquid chromatography according to the system of Example 2, and the final yield was 399 mM, and the hydrolysis conversion rate was 99.8% (as shown in Figure 1 ).
[0035] Example 4
[0036] The enzymatic hydrolysis of guanosine was carried out according to the following specific steps:
[0037] Reaction system and reaction conditions: the reaction system includes 5 mM CaCl2, 200 mM guanosine, Trypanosoma conorhinia-derived nucleoside hydrolase 0.5-1.0 g / L, total volume 20 mL, 40-50 °C, pH 5.0, reaction time 12 h, to obtain the product guanine.
[0038] According to the system of Example 3, the content of guanine is detected by high performance liquid chromatography, and the final yield is 199 mM, and the hydrolysis conversion rate is 99.5%. Figure 2
[0039] Example 5
[0040] Crude enzyme hydrolysis of inosine is as follows:
[0041] Reaction system and reaction conditions: the reaction system includes 200 mM inosine, 20 OD of E. coli cells expressing Trypanosoma cruzi strain CL Brener-derived nucleoside hydrolase after being broken, total volume 50 mL, 30-40 °C, pH 4.0, reaction time 6 h, to obtain the product hypoxanthine.
[0042] According to the system of Example 4, the content of hypoxanthine is detected by high performance liquid chromatography, and the final yield is 197 mM, and the hydrolysis conversion rate is 98.5%.
[0043] Example 6
[0044] Crude enzyme hydrolysis of guanosine is as follows:
[0045] Reaction system and reaction conditions: the reaction system includes 200 mM guanosine, 20 OD of E. coli cells expressing Trypanosoma conorhinia-derived nucleoside hydrolase after being broken, total volume 50 mL, 40-50 °C, pH 5.0, reaction time 6 h, to obtain the product guanine.
[0046] According to the system of Example 5, the content of guanine is detected by high performance liquid chromatography, and the final yield is 199 mM, and the hydrolysis conversion rate is 99.5%.
[0047] Example 7
[0048] Biological enzymatic hydrolysis of various purine bases and pyrimidine bases is as follows:
[0049]
[0050]
[0051] The above merely describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
[0052] SEQUENCE LISTING
[0053] <110>SHANGHAI RUISI BIOTECHNOLOGY CO., LTD., EAST CHINA UNIVERSITY OF TECHNOLOGY
[0054] <120>Method for hydrolyzing nucleosides by biological enzymes
[0055] <130>November 13, 2022
[0056] <160>2
[0057] <170>PatentIn version 3.5
[0058] <210>1
[0059] <211>981
[0060] <212>DNa
[0061] <213>Artificial sequence
[0062] <400>1
[0063] atgccgaaag cggttatcct ggatcaggat ggtaaccacg atgatatcat cagcctggcg 60
[0064] ctgctgctgg cgtggccgga aaaagttagc gtgatcggtt gcatctgcac cgacgcggat 120
[0065] tgcttcgttg cagatgcgtt caacatcacc ggtaaactga tgtgcctgct gaacaaacgt 180
[0066] gcgaaccgtc cgctgttccc gatcggcatc tcttctttcc acggcgttaa cccgttcccg 240
[0067] atggaatggc gttgcagcgc gaaaaacatg gatgatctgc cgagcctgaa catcccggaa 300
[0068] CACAACCGAAAATGGGAAAAACTGAAACCGGAATACGAAAAACTGGTGGGTGAAGA ACTG 360
[0069] CTGGCGGATCTGGTTATGAACTCTCCGGA AAAAGTTACC ATCTGC GTGACC GGCCCGCTG 420
[0070] AGCAACGTTCGTGGTGATCGAAAAATACGGTCGT CGTTTCACC GACAAGTTGAAGAA 480
[0071] TGC GTTATCATGGGTGGTGCA GTTGATGTTGGTGGTAACGTTTTCCTGCCGGGTACC GAT 540
[0072] GGCACC GC GGAATGGAACATCTACTGGGACCCGCCGGCGCGAAAACC GTTCTGGAATGC 600
[0073] CCGCACATCCGTAACGTTCTGTTCAGCCTGAACAGCACCAACACC GTTCCG GTTTGCAGC 660
[0074] AGCCTGGTTAAACGTTTCGGTGC GCAGAACGAATACCTGCTGTCTCAGTT CGTTGGTAGC 720
[0075] ACCTGGGCAATGTGCACCACCACGTTCTGCTGC GTCCGGGTGATGGTTACTACGC GTGG 780
[0076] GATAGCCTGACC GC GCGTACGTTATCGACAACAACCTGGCGGATCTGGAACC GATGGCG 840
[0077] CTGGAAGTTGAAATCAACAAAACCAAAGATGAAGGCCGTACCTTCCGTTCTACCCAGG GT 900
[0078] cgtacctgca cctacgttgc gaaaaacacc aacgcggaac tgttctacga tatggttctg 960
[0079] tctagcatgc gtatctgcta a 981
[0080] <210>2
[0081] <211>978
[0082] <212>DNa
[0083] <213>Artificial sequence
[0084] <400>2
[0085] atgccgtctt ctgttatcct ggaccacgac ggtggtcacg acgacctgct ggcgctggcg 60
[0086] ctgctgctgg cgcacccgga aaaagttcgt ctgatcggtt gcatctgcac cgacgcggac 120
[0087] tgcttcgttg acgacgcgtt ctctgttacc ggtaaagtta tgtctctggt tcacacccgt 180
[0088] gcgaaagttc cgctgttccc gatcggtgtt tcttctttcc gtggtgttaa cccgttcccg 240
[0089] tctctgtggc gttctcacgc gaaaaacatg gacgacctgc cgtgcctgaa cctgccggaa 300
[0090] cacgttgcgc tgtgggacaa agttaaagcg gaaaaccgta aactggttgg tgaacagctg 360
[0091] ctggcggacc tggttatgaa ctctccggaa aaagttacca tctgcgttac cggtccgctg 420
[0092] TCTAACGTTG CGTGGTCATC GAAAAATACG GTTCTAAATT CACC GACAAGT TAAAGAA 480
[0093] TGC GTTTAT GG GTGGTGC G GTTGAC GTT G GTGGTAAC GTTTTC G AATC TACCTCTGAC 540
[0094] GGTACC GC GGAATGGAACATCTACTGGGACCCGCCGGCGCGAAAGTTGTTC TGGC GTGC 600
[0095] CCGCACATGCTTCTGTTCTGTTCTCTCTGGACTCTACC AAC CACGTTCCG GTTACCTCT 660
[0096] TCTCTGGTTC AGC GTTTCG GTTCTC AGAAC GAATGCCTGCTGTCTC AGTT CGC GG GTTCT 720
[0097] GC GTGGGC GAT GTC AC CCACTACGAACTGATCCGTCCGG GTGACGGTTACTACGC GTGG 780
[0098] GACGTTCTGACC GC GCGTACGTTCTGGACCACAACCTGGCGGAAGTTGAA CCGATCGCG 840
[0099] CTGGAAGTTGAAACCAACAACCAAA TCTGAAGGTCGTACCTTCCGTTCTACCCAGG GT 900
[0100] GGTCCGTGCACCTACGTTGC GAAACACGTTAAAGC GGACAT GTTCTACGAT CATGGTTCTG 960
[0101] TCTTCTATGCTTGCTGC 978
Claims
1. A method for hydrolyzing a nucleoside by a biological enzyme, characterized by, A pyrimidine nucleoside is used as a raw material to produce a corresponding base under the catalysis of a nucleoside hydrolase, the reaction temperature is 20-50°C, the pH is 3.0-6.0, the reaction is carried out in the presence of CaCl2 or Ca(HCO3)2, the concentration of CaCl2 or Ca(HCO3)2 is 5-50 mM, and the concentration of the pyrimidine nucleoside is 100-400 mM; The method for preparing the recombinant bacteria secreting the nucleoside hydrolase is as follows: the genes from the strains CL Brener and Y strain, respectively, are connected to the pET28a expression vector, the sequence from the strain CL Brener is SEQ ID NO. 1, and the recombinant plasmid pET28a-SEQ ID NO. 1 is obtained, which is transformed into the competent Escherichia coli BL21, and the obtained positive clone is cultured to OD600 of 0.6-0.8, and then IPTG with a final concentration of 0.2 mM is added to induce the culture, and the recombinant bacteria pET28a-SEQ ID NO. 1 / BL21 are obtained. Trypanosoma cruzi The sequence from the strain CL Brener is SEQ ID NO. 1, and the recombinant plasmid pET28a-SEQ ID NO. 1 is obtained, which is transformed into the competent Escherichia coli BL21, and the obtained positive clone is cultured to OD600 of 0.6-0.8, and then IPTG with a final concentration of 0.2 mM is added to induce the culture, and the recombinant bacteria pET28a-SEQ ID NO. 1 / BL21 are obtained. Trypanosoma cruzi The sequence from the strain CL Brener is SEQ ID NO. 1, and the recombinant plasmid pET28a-SEQ ID NO. 1 is obtained, which is