A gene for promoting the growth and development of creeping bentgrass plants and its application

Abstract

The present invention discloses a gene for promoting the growth and development of creeping bentgrass plants, which relates to the technical field of genetic engineering; the nucleotide sequence of the gene is as shown in SEQ ID NO.1. Creeping bentgrass is usually propagated by seeds and stolons, and the speed of forming a turf is slow. It is difficult to form a good lawn and landscape in a short time. Therefore, it is particularly necessary to explore new germplasm resources for promoting growth. The present invention provides a gene for promoting the growth and development of creeping bentgrass plants. By constructing transgenic creeping bentgrass materials overexpressing this gene, it is confirmed that overexpressing this gene in creeping bentgrass can significantly promote the growth and development of creeping bentgrass plants. The present invention lays a foundation for exploring new germplasm resources for promoting the growth of creeping bentgrass.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a gene for promoting the growth and development of creeping bentgrass plants and an application thereof. Background Art

[0002] Creeping bentgrass is a common cool-season turfgrass with a soft texture, long green period, cold resistance, and pruning tolerance. It is often used for lawn construction on golf courses. In addition, it can also be used in green spaces such as sports fields, courtyards, and parks. Its quality and the resulting lawn landscape are of great significance to the development of greening and ecological civilization. The long growth cycle of creeping bentgrass may promote the growth of weeds, sparse vegetation, the invasion of pests and diseases, intolerance to trampling, and unsightly color, seriously affecting the quality of lawn landscape and the development of the lawn industry. Creeping bentgrass usually reproduces through seeds and runners, and the speed of lawn establishment is slow, making it difficult to form a good lawn and landscape in a short period of time. Therefore, it is particularly necessary to discover new growth-promoting germplasm resources.

[0003] Heat shock proteins (HSPs), also known as heat shock proteins, are ubiquitous in plants. They are activated and produced in large quantities within a short period of time (though only a small amount is present under normal circumstances) when plants are exposed to abiotic stresses. These proteins restore damaged proteins to their normal conformation. Since the beginning of this century, researchers have isolated a series of plant heat shock proteins and demonstrated their crucial role in plant responses to environmental stresses, including pathogen invasion, high temperatures, drought, low temperatures, and salinity.

[0004] Small heat shock proteins (sHSPs) are ancient, ubiquitous, and highly variable proteins in plants. They are involved in many biological processes and play important roles in physiological processes such as biotic and abiotic stress responses and development in plants. The basic sequence of sHSP includes a variable-length N-terminal region (average length 55 bases), a conserved C-terminal region, and a C-terminal extension region (usually less than 20 residues). The conserved C-terminal region consists of about 90 amino acids, forming multiple β-sheets, which is called the α-crystallin domain (ACD domain). Plant sHSPs are characterized by the ACD domain, and proteins containing the ACD domain are also called ACD proteins. Some ACD proteins are multi-domain proteins with other types of conserved domains, so not all ACD proteins are small heat shock proteins. Most sHSPs containing the ACD domain regulate the growth and development processes of plants and their viability under abiotic stress. The chloroplast-localized small heat shock protein CsHSP24.6 in tea plants was found to directly interact with the plastid nucleoid protein CspTAC5 and play an important role in the "etiolation-re-greening" process of photosensitive tea plants. There is currently no report on the promotion of the growth and development of creeping bentgrass plants by the small heat shock protein AsHSP26.2 in creeping bentgrass. Summary of the Invention

[0005] The object of the present invention is to provide a gene for promoting the growth and development of creeping bentgrass plants and its application to solve the problems existing in the above-mentioned prior art. The gene provided by the present invention can significantly promote the growth and development of creeping bentgrass plants.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a gene for promoting the growth and development of creeping bentgrass, and the nucleotide sequence of the gene is as shown in SEQ ID NO.1.

[0008] The present invention also provides a recombinant expression vector, including the above-mentioned gene.

[0009] Further, the expression vector is a eukaryotic expression vector.

[0010] Further, the eukaryotic expression vector is pCAMBIA1390.

[0011] The present invention also provides a recombinant microbial strain, including the above-mentioned recombinant expression vector.

[0012] The present invention also provides the application of the above-mentioned gene, recombinant expression vector or recombinant microbial strain in promoting the growth and development of creeping bentgrass.

[0013] The present invention also provides a method for cultivating growth-promoting creeping bentgrass, which includes the step of genetically transforming the above-mentioned gene into creeping bentgrass to construct transgenic creeping bentgrass.

[0014] The present invention discloses the following technical effects:

[0015] The present invention provides a small heat shock protein AsHSP26.2 gene that promotes the growth and development of creeping bentgrass plants. By constructing transgenic materials of creeping bentgrass overexpressing the small heat shock protein AsHSP26.2 gene, it is confirmed that overexpressing the small heat shock protein AsHSP26.2 gene of creeping bentgrass in creeping bentgrass can significantly promote the growth and development of creeping bentgrass plants. The present invention lays a foundation for exploring new germplasm resources for promoting the growth of creeping bentgrass. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0017] Figure 1 It is a diagram showing the growth differences of wild-type creeping bentgrass (WT) and three transgenic lines of creeping bentgrass prepared in Example 3 on the 0th day (A), 10th day (B), 20th day (C), 30th day (D), and 40th day (E, F) of cultivation.

[0018] Figure 2 It is the unit result of measuring the fresh weight (A), dry weight (B), and length (C) of the above-ground and underground parts of wild-type creeping bentgrass (WT) and three transgenic lines of creeping bentgrass prepared in Example 3 on the 40th day of cultivation. DETAILED DESCRIPTION OF THE INVENTION

[0019] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0022] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0023] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0024] The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0025] The experimental materials used in the following examples are as follows:

[0026] Plant material: creeping bentgrass variety "A4".

[0027] Strains and vectors: Escherichia coli DH5α competent cells (CB101) were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. The T-cloning vector pGEM-T easy was purchased from Promega (Beijing) Biotechnology Co., Ltd. Agrobacterium tumefaciens EHA105 and the creeping bentgrass transgenic vector pCAMBIA1390 have been disclosed in the literature "Xinbo Sun, Ning Huang, Xin Li, Junfei Zhu, Xiuju Bian, Huibin Li, Lihong Wang, Qian Hu, Hong Luo, A chloroplast heat shock protein modulates growth and abiotic stress response in creeping bentgrass. Plant Cell and Environment, 2021, 44: 1769 - 1787".

[0028] Main reagents: Agarose was purchased from SIGMA; Premix Taq (Taq Version 2.0), restriction endonucleases EcoRⅠ, NcoⅠ and reverse transcription kit were purchased from Takara Biotechnology (Beijing) Co., Ltd.; Sucrose, 50×TAE buffer, Tryptone, Yeast extract, Agar powder, etc. were purchased from Beijing Solarbio Science & Technology Co., Ltd.; Reagents such as Isopropanol, Glycerol, β-Mercaptoethanol, Sodium chloride, Sodium hydroxide, Absolute ethanol, Tris-HCl were all purchased from Baoding Vanke Chemical Reagent Business Department. AL2000 DNA Marker, TRNzol Universal Reagent, Plasmid Mini Kit, Gel Extraction and Purification Kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; qPCR Master Mix real-time fluorescence quantitative kit was purchased from Promega (Beijing) Biotechnology Co., Ltd.

[0029] Main instruments: Applied Biosystems Veriti Thermal Cycler PCR amplifier (ThermoFisher), WH-861 vortex mixer (Taicang Science and Education Instrument Factory), High-speed refrigerated centrifuge Centrifuge 5810R (Eppendorf), Mini high-speed bench centrifuge Centrifuge 5415D (Eppendorf), Ultra-clean workbench (AIR TECH), Constant temperature shaking incubator (Shanghai Sukun Industry Co., Ltd.), SX-500 autoclave (TOMY), Ice maker (SCOTSMAN), Moore elemental ultrapure water machine (Shanghai Moller Scientific Instruments Co., Ltd.), Microwave oven (Galanz), Water bath (Beijing Changfeng Instrument and Meter Co., Ltd.), Micropipette (Eppendorf) and LightCycler96 real-time fluorescence quantitative PCR instrument (Roche).

[0030] Example 1 Cloning of Agrostis stolonifera AsHSP26.2 gene

[0031] RNA Extraction from the Leaves of Agrostis stolonifera: The TRNzol method (Tiangen) was used for RNA extraction. The young leaf samples at the tips of the Agrostis stolonifera material "A4" were quickly ground into a powder in a sterilized mortar with liquid nitrogen, transferred into a sterilized 2 mL centrifuge tube, and 1 mL of TRNzol Universal Reagent was quickly added. After thorough oscillation, it was left at room temperature for 5 min. 200 μL of chloroform was added, and after thorough oscillation, it was left at room temperature for 2 min and then centrifuged at 12000 g for 15 min. The supernatant was aspirated with a pipette and transferred into a 1.5 mL centrifuge tube. 500 μL of chloroform was added, and it was centrifuged at 12000 g for 15 min. The collected supernatant was transferred into a new 1.5 mL centrifuge tube, 240 μL of isopropanol was added, mixed well, left at room temperature for 10 min, and then centrifuged at 12000 g for 10 min. The collected liquid was poured out. 1 mL of 75% ethanol was added to wash the precipitated nucleic acid, centrifuged briefly for 30 s, and the collected liquid was poured out. The above steps were repeated once, and the remaining ethanol was aspirated with a pipette. 20 μL of DEPC water was added to dissolve it. The collected RNA samples were stored, and the RNA concentration was measured using a Nanodrop ultra-micro spectrophotometer.

[0032] Reverse Transcription of cDNA from Agrostis stolonifera: The extracted RNA samples were reverse transcribed into cDNA using the PrimeScript TM Ⅱ 1st Strand cDNA Synthesis Kit reverse transcription kit (Takara Bio). All RNA samples were normalized to 1000 ng, supplemented to 8 μL with RNase free ddH2O, then 1 μL of Oligo dT Primer (50 μM) and 1 μL of dNTP Mixture (10 mM each) were added. After pipetting and mixing well, it was placed in a PCR instrument at 65 °C for 5 min and 4 °C for 2 min. Then 4 μL of 5× PrimeScript Ⅱ Buffer, 0.5 μL of RNase Inhibitor (40 U / μL), 1 μL of PrimeScript Ⅱ RTase (200 U / μL), and 4.5 μL of RNase free ddH2O were added, mixed well, and placed in the PCR instrument again at 42 °C for 60 min. It was heated at 95 °C for 5 min to inactivate the enzyme and stored at 4 °C. The obtained cDNA template was diluted with sterile water at a ratio of 1:1 and stored at -20 °C for later use.

[0033] PCR amplification: Using creeping bentgrass cDNA as a template, PCR amplification was performed with the AsHSP26 gene amplification primers AsHSP26.2-ORF-F and AsHSP26.2-ORF-R. The primer information is shown in SEQ ID NO.2-3. PCR amplification system: cDNA: 1 μL, each of F / R primers 1 μL, Premix Taq (Taq Version 2.0) 12 μL, supplemented with ddH2O to 25 μL. The PCR reaction conditions were: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing: 60°C / 30 s, extension: 72°C / 1 min, 35 cycles, and finally extension at 72°C for 10 min, and incubation at 4°C.

[0034] AsHSP26.2-ORF-F (SEQ ID NO.2): ATGGCTGCAGCGAACGCCCCCTTC;

[0035] AsHSP26.2-ORF-R (SEQ ID NO.3): TCACTGGACCTGCACGTCGATGACC.

[0036] Electrophoresis of PCR products and recovery and purification of target fragments: Prepare 1% agarose gel and 1×TAE electrophoresis buffer. The electrophoresis conditions were set as: U = 180 V, I = 300 mA, P = 80 W, Time = 20 min. Cut the target fragment with a gel cutter and recover it using a gel recovery kit (Tiangen).

[0037] Construction of cloning vector: The recovered product was ligated to the pGEM-T easy vector. The reaction system was: 5 μL 2×Rapid Ligation Buffer, 4 μL PCR product, 1 μL -T Easy Vector (50 ng), 1 μL T4 DNA Ligase. Centrifuge to fully mix each reagent and ligate overnight at 4°C.

[0038] Transformation of recombinant plasmid: Take DH5α competent cells and thaw them on ice for 5 min; add all the ligation solution, gently flick to mix, and incubate on ice for 30 min; perform heat shock at 42°C for 40 s in a water bath; add 900 μL of LB liquid medium after incubating on ice for 2 min; shake culture at 37°C and 200 rpm for 50 min; centrifuge at 3000 rpm for 1 min; aspirate the supernatant, take the remaining 100 μL and spread it on a plate (Amp-resistant solid medium) in a laminar flow hood, air dry, seal it with a sealing film, and incubate overnight in a 37°C incubator.

[0039] Screening of recombinant plasmids: Pick 10 colonies (and streak for backup), set up positive and negative controls, and perform PCR identification using universal primers T7-F / SP6-R or cross primers; pick positive colonies for streaking and inoculate them into 20 mL of Amp-resistant liquid LB medium in a 100 mL sterilized conical flask, and culture them overnight at 200 rpm in a shaker at 37 °C.

[0040] Plasmid extraction: Use the DNA plasmid miniprep kit from Tiangen Biotech Co., Ltd. to extract the plasmid. Pipette 600 μL of the cultured bacterial solution into a 2 mL centrifuge tube, then add 400 μL of 60% glycerol, and store the glycerol bacteria at -80 °C. Enrich 5 mL of the bacterial solution, centrifuge at 12000 rpm for 1 min to collect the bacteria, and pour off the supernatant. Add 250 μL of Buffer P1 (add RNaseA before use and store at 4 °C), and shake thoroughly to suspend the bacteria. Add 250 μL of Buffer P2, gently invert 6 - 8 times to mix evenly. Then use a pipette to add 350 μL of Buffer P3, invert up and down to mix evenly, and at this time, a white flocculent precipitate will appear. Centrifuge at 12000 rpm for 10 min, transfer the supernatant to the adsorption column CP3, centrifuge briefly, and discard the waste liquid. Then add 600 μL of washing buffer PW (add absolute ethanol before use) to the adsorption column, centrifuge briefly, and discard the waste liquid. Repeat the PW step once. Centrifuge the empty adsorption column for 2 min. Transfer the adsorption column to a sterilized 1.5 mL centrifuge tube, add 50 μL of Elution Buffer preheated at 60 °C in advance, let it stand at room temperature for 2 min, and centrifuge for 2 min. Store the collected DNA solution. Pipette 10 μL of the extracted plasmid and send it to Tianjin Genewiz Biotechnology Co., Ltd. for sequencing. The successfully sequenced plasmids are stored at -20 °C. The sequencing results show that the ligated T vector contains a 708 bp DNA insert fragment, which contains the ORF region of the AsHSP26.2 gene, and this fragment is shown as SEQ ID NO.1.

[0041] SEQ ID NO.1:

[0042] atggctgcagcgaacgcccccttcgctctcgtcagccgcctctcctctcctgccacgcgcctgcctgcccgcgcctggagagccgcgaggccagcgccggtggcggccgggagaacccgtccgctcaccacggcctccgcgtcgcaggaaaacagggacaactccgtcgatgtccaagtcagccagaacgggggcaaccagcagggaaatgccgtccaacgccgcccgcgccgtgccggatttgacatctctccgttcgggctggtggacccgatgtcacccatgcgaaccatgcggcagatgctggacacgatggaccggctgttcgacgacaccgtggggttccccacgacacgccgttctccggcgacggcgagcgaggcgccgcggatgccgtgggacattatggaggacgacaaggaggtgaagatgcggttcgacatgcccgggctgtcgcgggacgaggtcaaggtgatggtggaggacgacacgctcgtcatccgcggcgagcacaagaaggaggctggcgaaggccagggcgacgggtggtggaaggagcgcagcgtgagctcctacgacatgcgcctgagtctgcccgacgagtgcgacaagagccaggtgcgcgccgagctcaagaacggcgtgctgctcgtcaccgtgcccaagaccgagaccgagcgcaaggtcatcgacgtgcaggtccagtga。

[0043] Construction of the creeping bentgrass transgenic vector pCAMBIA1390 containing the AsHSP26.2 gene in Example 2

[0044] Construction of transgenic vector pCAMBIA1390 for creeping bentgrass: The recombinant plasmid AsHSP26.2-T with correct sequencing and the plasmid of pCAMBIA1390 vector were extracted, and double digestion was carried out using restriction enzymes EcoRI + NcoI. The specific digestion system was: 1 μg of plasmid, 1 μL of EcoRI (10 U / μL), 1 μL of NcoI (10 U / μL), 2 μL of 10×QuickCut Buffer, and supplemented with ddH2O to 20 μL. The digestion mixture was digested in a PCR instrument at 37 °C for 3 - 5 h. After electrophoresis detection of the digestion products, the target gene fragment and the pCAMBIA1390 vector fragment were recovered from the gel and ligated. Ligation system: 16 μL of the target fragment, 1 μL of the pCAMBIA1390 vector fragment, 2 μL of 10×T4 DNA Ligase Buffer, and 1 μL of T4DNA Ligase. Centrifuge to fully mix each reagent, and ligate overnight at 16 °C. The ligation product was transformed into Escherichia coli, detected by PCR, positive colonies were picked for shaking culture, the plasmid was extracted for double digestion detection, and the positive plasmid was sent to the company for sequencing. The AsHSP26.2-pCAMBIA1390 recombinant vector was screened and obtained.

[0045] Example 3 Preparation of transgenic creeping bentgrass plants overexpressing AsHSP26.2

[0046] Transformation of Agrobacterium competent cells with plasmid: Take the Agrobacterium competent cells EHA105 stored at -80 °C and thaw them on ice for 5 min; add 1 μg of the recombinant vector plasmid to every 100 μL of competent cells, and gently flick to mix; then let it stand on ice for 5 min, in liquid nitrogen for 5 min, in a water bath at 37 °C for 5 min, and in an ice bath for 5 min; add 700 μL of antibiotic-free YEP liquid medium on the ultra-clean workbench, and shake and culture at 28 °C for 2 h; centrifuge at 6000 rpm for 1 min, pour out the supernatant, leave 100 μL of the supernatant to resuspend the bacterial mass, and coat it on a YEP plate containing the corresponding antibiotics (Kan + Rif), and place it upside down in an incubator at 28 °C for 3 d.

[0047] Preparation of transgenic creeping bentgrass materials: Rinse the seeds of creeping bentgrass A4 with sterile water, then add 5% sodium hypochlorite on the ultra-clean workbench for disinfection for 20 min, and rinse three times with sterile water; after drying the excess water with sterilized filter paper, inoculate it onto the callus induction medium (MMSG), and culture it in the dark at 23 °C for 25 d. During this period, pay attention to observing whether there is contamination and wait for callus differentiation. Oscillate and culture the transformed single colony of Agrobacterium at 28 °C until OD 600 = 0.5, centrifuge at 4 °C and 3000 rpm for 20 min to collect the bacterial cells, and resuspend the bacterial cells with liquid MS medium until OD 600= 0.5; Soak the callus in the resuspended bacterial solution for 20 min, take out the callus and place it on the sterilized filter paper to absorb the excess bacterial solution, and inoculate the callus on the symbiotic medium (MMSG + 100 μM acetosyringone) and culture it in the dark at 25 °C for 3 d; Transfer the callus to the sterilization medium (MMSG + 250 mg / L cefotaxime) and culture it in the dark at 25 °C for 15 d to inhibit the overgrowth of Agrobacterium; Subsequently, transfer the callus to the selection medium (MMSG + 250 mg / L cefotaxime + 100 mg / L hygromycin) and culture it in the dark at 25 °C for 10 weeks, changing the medium every 21 d until obvious brown callus and normal callus appear; Transfer the normal callus to the regeneration medium and culture it in the dark at 25 °C for 7 d, and then grow it under light at 28 °C for 3 weeks to induce the callus to differentiate and germinate; Transfer the germinated callus to the rooting medium to induce rooting, and then transfer the plants with well-developed roots (3 weeks) to the soil and grow them in the greenhouse.

[0048] Extract genomic DNA by CTAB method: Take 0.05 g of fresh leaves and place them in a 1.5 mL centrifuge tube, add liquid nitrogen and grind with a grinding rod, and label the centrifuge tube; Put 600 μL of 2×CTAB buffer (2 g CTAB, 8.182 g NaCl, 10 mL 1 M Tris-HCl pH = 8.0, 1.211 g EDTA-Na2, 2 mL β-mercaptoethanol, made up to 100 mL with distilled water) into the centrifuge tube, shake it and then place it in a water bath at 65 °C for 30 min; After taking it out and cooling it to room temperature, add 500 μL of chloroform:isoamyl alcohol (24:1), mix well at room temperature on a shaker for 30 min, and centrifuge at 12000 rpm for 10 min; Then place it on ice, take 400 μL of the supernatant and put it into a 1.5 mL centrifuge tube containing 240 μL of isopropanol, mix well and let it stand at room temperature for 10 min. After taking it out, centrifuge at 12000 rpm for 10 min and pour out the supernatant; Add 500 μL of 75% (v / v) ethanol aqueous solution to wash the precipitate, centrifuge at 12000 rpm for 10 min and pour out the supernatant; Repeat the above steps once; Put the tube containing DNA in the ultra-clean workbench, open the lid and dry it for 30 min; Dissolve the DNA with 50 μL of ddH2O containing RNase A enzyme and let it stand at room temperature for about half a day, and then store it in a -20 °C refrigerator. Use the transgenic vector detection primers to perform PCR detection on the genomic DNA of the transgenic material to determine the transgenic positive plants.

[0049] Example 4 Identification of the growth and development of transgenic creeping bentgrass materials

[0050] Five shoots of the same size were selected from the wild-type creeping bentgrass (WT) and the three transgenic lines of creeping bentgrass (TG4, TG6, and TG7) prepared in Example 3, and they were placed together in a greenhouse at 24 °C for cultivation, allowing them to grow normally under the same environmental conditions for 40 days. The growth differences between the wild-type and transgenic lines of creeping bentgrass were observed. Photos were taken on the 0th, 10th, 20th, 30th, and 40th days of cultivation, and the fresh weight, dry weight, and length of the above-ground and underground parts were measured on the 40th day. The results are shown in Figure 1 and Figure 2 . The results indicate that overexpression of the small heat shock protein AsHSP26.2 gene of creeping bentgrass in creeping bentgrass can significantly promote the growth and development of creeping bentgrass plants.

[0051] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a gene promoting the growth and development of creeping bentgrass in promoting the growth and development of creeping bentgrass, characterized in that, The nucleotide sequence of the said gene is as shown in SEQ ID NO.1; By overexpressing the said gene in creeping bentgrass, the growth and development of creeping bentgrass are promoted.

2. Use of a recombinant expression vector in promoting the growth and development of creeping bentgrass, characterized in that, The said recombinant expression vector includes the gene described in Claim 1; By overexpressing the said gene in creeping bentgrass, the growth and development of creeping bentgrass are promoted.

3. The application according to claim 2, characterized in that, The said expression vector is a eukaryotic expression vector.

4. The application according to claim 3, characterized in that The said eukaryotic expression vector is pCAMBIA1390.

5. Use of a recombinant microbial strain in promoting the growth and development of creeping bentgrass, characterized in that, The said recombinant microbial strain includes the recombinant expression vector described in any one of Claims 2-4; By overexpressing the said gene in creeping bentgrass, the growth and development of creeping bentgrass are promoted.

6. A method for cultivating growth-promoting creeping bentgrass, characterized in that, It includes the step of genetically transforming the gene described in Claim 1 into creeping bentgrass to construct transgenic creeping bentgrass.

Images