Brassica rapa var. parachinensis BrAL3 gene and its application in promoting bolting and flowering of cruciferous plants

Abstract

The present invention discloses the Brassica rapa var. parachinensis BrAL3 gene and its application in promoting the bolting and flowering processes of cruciferous plants, belonging to the field of biotechnology. Overexpression of the Brassica rapa var. parachinensis BrAL3 gene can promote the bolting and flowering processes of cruciferous plants. In the present invention, the Brassica rapa var. parachinensis BrAL3 gene is introduced into cruciferous plants by the Agrobacterium-mediated method to obtain transgenic lines with overexpression of the Brassica rapa var. parachinensis BrAL3 gene. The results show that the expression change of the Brassica rapa var. parachinensis BrAL3 gene can significantly change the bolting and flowering time of plants. Among them, the cruciferous plants can be Arabidopsis thaliana, Brassica rapa var. parachinensis or other variants of Brassica napus, as well as other cruciferous vegetables. That is, this gene can be applied to the variety breeding of early-bolting Chinese cabbage vegetables such as Brassica rapa var. parachinensis and Brassica rapa var. utilis, etc., and has good application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to the BrAL3 gene of Brassica parachinensis and its application in promoting the bolting and flowering processes of cruciferous plants. Background Art

[0002] Flowering Chinese cabbage, also known as flowering Chinese cabbage stem, is a variant of Brassica rapa subsp. pekinensis in the Brassica genus of the Brassicaceae family, which originated in southern China and is mainly distributed in Guangdong, Guangxi, Fujian and other places. The main edible parts of flowering Chinese cabbage are the flower stems or the leaves of the stems. The stems are tender, juicy, have a unique flavor and are rich in nutrients. The growth cycle of flowering Chinese cabbage is short, and it can bolt and flower without the vernalization process, and can be planted in multiple crops in a year.

[0003] Bolting and flowering are important signs for annual or biennial herbaceous plants to enter reproductive growth, and are affected by many endogenous factors and exogenous environmental factors. Taking Arabidopsis thaliana as an example, the flowering process is affected by photoperiod, hormones, vernalization, autonomous and age pathways, etc., and is regulated according to a series of secondary factors such as external temperature, light quality, soil salinity, its own sugar accumulation and the age of the plant. Generally speaking, the germinated seeds of Chinese cabbage can bolt and flower after a period of low-temperature treatment (vernalization process).

[0004] For types such as flowering Chinese cabbage that use the stems as edible organs, it is best to breed varieties that bolt earlier in a timely manner to shorten the growth cycle. However, if the bolting time is too early, it will affect the vegetative development process and lead to a decline in quality. Therefore, studying the bolting and flowering processes of flowering Chinese cabbage helps to lay a foundation for the creation of new materials and the breeding of new varieties of flowering Chinese cabbage and other variants of the Brassica genus.

[0005] There are 7 AL family members (AL1 - AL7) in Arabidopsis thaliana, all of which can bind to the H3K4me3 polypeptide. AL3 is a transcriptional repressor that can regulate the auxin signaling pathway by inhibiting the expression of ARF7 and ARF8 genes, control plant root development and shoot apical meristem development, and thus change plant traits such as plant morphology. In addition, there have been many studies on the flowering process. Taking patent applications as an example, the Chinese patent document with the publication number CN104388447A discloses the application of the Arabidopsis thaliana cell cycle - dependent protein kinase gene AtCDKG2 in regulating the flowering time conversion of plants. After the deletion mutation of the AtCDKG2 gene, the flowering time of Arabidopsis thaliana is advanced. After overexpressing the AtCDKG2 gene in Arabidopsis thaliana using transgenic technology, the flowering time of the overexpressed transgenic lines is significantly delayed; the Chinese patent document with the publication number CN112877337A discloses that the rapeseed BnaA09WRKY6 gene can significantly promote the bolting and flowering of the Arabidopsis thaliana wrky6 mutant and has been well applied in the flowering process of Brassica napus. These genes have obvious functions in promoting the bolting and flowering of cruciferous plants and have certain practical application values in the breeding of cruciferous plants for bolting and flowering.

[0006] At present, there is no prior art report on the functional research of the Brassica parachinensis BrAL3 gene. Therefore, using modern biotechnology means to study the potential relationship between the Brassica parachinensis BrAL3 gene and flowering development is of great significance and practical application value for the development of new germplasms and the improvement of the quality of Brassica parachinensis. Summary of the Invention

[0007] The present invention provides the application of the Brassica parachinensis BrAL3 gene in promoting the bolting and flowering of cruciferous plants. Overexpressing the Brassica parachinensis BrAL3 gene in recipient plants can promote the bolting and flowering of recipient plants, providing a valuable resource for breeding new plant varieties.

[0008] The specific technical solutions adopted are as follows:

[0009] The present invention first provides the application of the Brassica parachinensis BrAL3 gene in promoting the bolting and flowering of cruciferous plants, wherein the nucleotide sequence of the Brassica parachinensis BrAL3 gene is as shown in SEQ ID NO.1.

[0010] By using the Agrobacterium - mediated method to introduce this gene into cruciferous plants, transgenic lines overexpressing the Brassica parachinensis BrAL3 gene are obtained. It is found that the expression change of the Brassica parachinensis BrAL3 gene can significantly change the bolting and flowering time of plants. Among them, the cruciferous plants can be Arabidopsis thaliana, Brassica parachinensis or other variants of Brassica species, non - vernalized rapeseed or other cruciferous vegetables. That is, applying this gene to the breeding of Brassica parachinensis or other cruciferous vegetables has good application prospects.

[0011] Overexpression of the Brassica parachinensis BrAL3 gene can promote the bolting and flowering processes of cruciferous plants.

[0012] Further preferably, the cruciferous plant is Brassica parachinensis. Experiments have proven that overexpression of the Brassica parachinensis BrAL3 gene can significantly promote the bolting and flowering processes of Brassica parachinensis, which helps to lay a foundation for the creation of new Brassica parachinensis materials and the breeding of new varieties.

[0013] The Brassica parachinensis BrAL3 gene is ligated into a plant overexpression vector to construct a recombinant overexpression vector, and then the recombinant overexpression vector is transformed into a recipient plant. Among them, the recombinant overexpression vector is pAC004 - BrAL3. The recombinant overexpression vector is transformed into Agrobacterium tumefaciens, and then the obtained recombinant Agrobacterium tumefaciens is used to infect the recipient plant.

[0014] The present invention also provides the application of the Brassica parachinensis BrAL3 gene in plant breeding, screening plants with overexpression of the Brassica parachinensis BrAL3 gene, and the breeding purpose is to advance the bolting and flowering time.

[0015] The present invention also provides a method for promoting the early bolting and flowering of cruciferous plants, including the following steps:

[0016] (1) Ligating the Brassica parachinensis BrAL3 gene into a plant overexpression vector to construct a recombinant overexpression vector;

[0017] (2) Transforming the recombinant overexpression vector constructed in step (1) into a cruciferous plant as the recipient plant.

[0018] Among them, the recombinant overexpression vector is pAC004 - BrAL3.

[0019] In step (2), the recombinant overexpression vector is transformed into Agrobacterium tumefaciens, and then the obtained recombinant Agrobacterium tumefaciens is used to infect the recipient plant cells.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] In the present invention, by cloning the Brassica parachinensis BrAL3 gene and performing genetic transformation in cruciferous plants to overexpress the exogenous Brassica parachinensis BrAL3 gene, it can significantly promote the bolting and flowering of cruciferous plants such as Brassica parachinensis. By means of genetic engineering technology, the Brassica parachinensis BrAL3 gene is overexpressed in the recipient plant to promote the flowering process, which helps to shorten the production cycle. Experiments have proven that the method of the present invention can promote the bolting and flowering processes of Brassica parachinensis, indicating that the Brassica parachinensis BrAL3 gene has certain application potential in promoting the bolting and flowering processes of cruciferous plants. Brief Description of the Drawings

[0022] Figure 1 It is the PCR electrophoresis map for cloning the Brassica parachinensis BrAL3 gene, where the M lane is the DNA marker.

[0023] Figure 2 This is the result of the analysis of the expression characteristics of the Brassica parachinensis BrAL3 gene.

[0024] Figure 3 This is a schematic diagram of the recombinant overexpression vector pAC004-BrAL3.

[0025] Figure 4 In [description], A shows the positive detection of the Brassica parachinensis BrAL3 transgenic plants; B shows the BrAL3 expression of three transgenic lines, where 1, 2, and 3 represent the three transgenic lines respectively, CK represents the control, and ** indicates significant differences at the 1% level.

[0026] Figure 5 This is the observation and time statistics of the bolting and flowering of the transgenic line (35S::BrAL3) and the control plants. Among them, A is the phenotype diagram, B is the statistical chart, and b and c indicate significant differences at the 5% level. Specific implementation mode

[0027] The present invention will be further clarified below in conjunction with the embodiments and the accompanying drawings. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0028] Example 1 Construction of the overexpression vector of the Brassica parachinensis BrAL3 gene

[0029] (1) Take the leaf tissue sample of Brassica parachinensis ('Youqing 49' or a variety that can be purchased on the market), extract the total RNA with TRIzol reagent, and complete the synthesis of cDNA with the TAKARA reverse transcription kit. The specific method is as follows: 2 μL of 5×gDNA Eraser Buffer, 1 μL of gDNA Eraser, 1 μg of RNA, make up to 10 μL with RNase Free H2O, incubate at 42 °C for 2 min to remove genomic DNA. Then add 4 μL of 5×Primer Script Buffer, 1 μL of RT Primer Mix, 1 μL of Primer Script RT Enzyme Mix, and 4 μL of RNase Free H2O to the above reaction solution. After pipetting and mixing evenly, react at 37 °C for 20 min and then at 85 °C for 5 s to complete the synthesis of cDNA. The cDNA is stored in a -20 °C refrigerator.

[0030] (2) Using the Brassica parachinensis leaf cDNA as a template, perform PCR amplification with the primers in Table 1 through a high-fidelity enzyme to obtain the PCR product ( Figure 1), that is, the cloning of the Brassica parachinensis BrAL3 gene was obtained, and the expression characteristics of the BrAL3 gene in different tissues and organs were analyzed. The results showed that the expression abundance of the BrAL3 gene was the highest in the inflorescence and the second highest in the stem( Figure 2 ).

[0031] Table 1 Primers used for PCR amplification of the CDS sequence of the Brassica parachinensis BrAL3 gene

[0032] Primer Name Primer Sequence (5’-3’) BrAL3_CDS_F ATGGAAGGAGGAGCTGGTCT BrAL3_CDS_R AGGTCGTGCTCTTTTGT

[0033] (3) After recovering the target fragment in Figure 1 , it was ligated to pMD18T and sequenced. The BrAL3 gene sequence is shown in SEQ ID NO.1. After amplifying and recovering it again using this as a template, it was digested with the corresponding restriction endonucleases. The digestion system was as follows: 4 μL of Buffer, approximately 2 μg of the recovered PCR product, 2 μL each of KpnI and SaII enzymes, and double-distilled water was added to make up to 40 μL. After incubating in a water bath at 37 °C for 1 h, the digested product was recovered; the pAC004 vector was also digested and recovered in the same way, and then reacted and ligated with the digested product of the gene. The reaction system was as follows: 1 μL of 10×Buffer, 1 μL of T4 ligase. The molar ratio of the gene fragment recovered after digestion to the pAC004 vector fragment recovered after digestion was approximately 3:1, and the total amount was approximately 0.5 μg. Double-distilled water was added to make up to 10 μL. After ligating overnight at 4 °C, it was transformed into Escherichia coli. After taking positive colonies for PCR detection and sequencing to prove correct ligation, the bacterial solution was expanded and the plasmid was extracted( Figure 3 ), and the recombinant overexpression vector pAC004-BrAL3 was obtained and stored at -20 °C for standby.

[0034] Example 2 Genetic transformation of Brassica parachinensis was carried out using the vacuum infiltration method

[0035] (1) Transformation of the recombinant overexpression vector into Agrobacterium

[0036] The vector pAC004-BrAL3 and the empty pAC004 vector obtained in Example 1 were transferred into Agrobacterium tumefaciens GV3101. The specific method was as follows: Take the thawed Agrobacterium competent cells and mix them with 5 μL of the plasmid obtained in Example 1, then incubate on ice for 10 min, react in liquid nitrogen for 5 min, and incubate in a water bath at 28 °C for 5 min; Add 1 mL of liquid LB medium without any antibiotics on the ultra-clean workbench and culture it on a shaker at 28 °C at 200 rpm for 4 - 5 h; Centrifuge at 10000 rpm for 1 min, discard most of the supernatant, and resuspend the bacterial pellet with the remaining approximately 100 μL and spread it on a medium containing Rif (rifampicin, 50 mg·L -1 ) and Kan (kanamycin, 50 mg·L -1) on the solid LB plate; After placing it upright at 28 °C for 30 min, incubate it in an inverted position for 1 - 2 d. After the positive colonies are detected correctly by PCR, the strain is resuspended with 25% glycerol LB, and the Agrobacterium tumefaciens GV3101 strains containing the pAC004 - BrAL3 plasmid and the pAC004 empty vector plasmid are stored at -75 °C for later use.

[0037] (2) Transformation of flowering Chinese cabbage by the floral dip method

[0038] Two days before infection, take out the Agrobacterium tumefaciens GV3101 strains containing the pAC004 - BrAL3 plasmid and the pAC004 empty vector plasmid from the ultra - low - temperature freezer. On the ultra - clean workbench, use an inoculation loop to inoculate the strains onto a solid LB screening plate containing the final concentration of rifampicin (Rif, 50 mg·L -1 ), kanamycin (50 mg·L -1 ) to activate the strains. After inoculation, seal it and place it upside - down in an incubator at 28 °C for 36 h. Pick a single colony and transfer it to 15 mL of liquid medium containing the final concentration of rifampicin (50 mg·L -1 ), kanamycin (50 mg·L -1 ). Place it on a shaker at 28 °C and culture it at 200 rpm for 12 h to prepare the Agrobacterium mother liquor, and store it at 4 °C. One day before infection, take 1 mL of the mother liquor and culture it in 50 mL of liquid LB medium (containing antibiotics) at 28 °C until the OD value reaches 1.0.

[0039] On the day of infection, remove the open flowers of the flowering Chinese cabbage after bolting and flowering, and remove the flower buds of the unopened flowers; Centrifuge the bacterial solution at room temperature (4000 rpm, 10 min), add 50 mL of 1 mM MgCl2 and 5% (mass fraction) sucrose solution, add 40 μL of surfactant Silwet77 to a final volume fraction of 0.02%, mix well and transfer it to a 50 mL centrifuge tube.

[0040] During infection, immerse the inflorescence of the flowering Chinese cabbage into the centrifuge tube containing the above - mentioned bacterial solution, evacuate it in a vacuum pump for 10 minutes, and release the air once in the middle. After removing the inflorescence, dry the bacterial solution, place it horizontally in a plug tray lined with wet paper towels, place it in the dark for 24 h, after pollination, place it upright back into the artificial climate chamber, stop watering and bag the seeds for harvesting about 30 days after placing it upright. Collect the seeds according to the plants and number them.

[0041] (3) Screening and detection of transgenic positive flowering Chinese cabbage plants

[0042] Sampling: Sow the seeds of the flowering Chinese cabbage treated in step (2) in the substrate. After one true leaf grows, take half of the cotyledon for DNA extraction.

[0043] DNA extraction: The DNA was extracted using a simple DNA extraction method. First, prepare the DNA extraction buffer by taking 0.5 mL of 20% (mass fraction) SDS solution, 0.5 mL of 0.5 mol·L -1 EDTA aqueous solution, 2 mL of 1 mol·L -1 Tris-HCl buffer (pH 9.0), 2 mL of 2 mol·L -1 LiCl solution, and make up to 10 mL with double-distilled water. Mix well for use. Then, take about 0.1 g of the sample and put it into a 2 mL centrifuge tube. Add 200 μL of the extraction buffer and 1 magnetic bead, and grind it in a grinding machine (65 Hz, 120 s). After taking out the magnetic bead in the centrifuge tube, centrifuge at 13000 rpm for 5 min; transfer 100 μL of the supernatant to a new 1.5 mL centrifuge tube, add 100 μL of isopropanol, and quickly and gently invert and mix well. Let it stand at room temperature for 5 min, then centrifuge at 13,000 rpm for 10 min; discard the supernatant, wash the precipitate with 1 mL of 70% (volume fraction) ethanol, then centrifuge at 13000 rpm for 3 min and discard the supernatant; repeat the washing once, place the centrifuge tube upside down on the absorbent paper, dry the ethanol, and add 50 μL of double-distilled water to dissolve the DNA.

[0044] Detection of transgenic positive plants: PCR detection was carried out using specific primers for the overexpression vector (Table 2). The PCR system is as follows: 12.5 μL of T5 Mix, 0.5 μL of each forward and reverse primer (see Table 2), 2 μL of DNA template, and make up to 25 μL with double-distilled water. Incubate at 98 °C for 3 min, then perform 35 cycles (98 °C for 10 s, 55 °C for 10 s, 72 °C for 15 s), 72 °C for 3 min, and keep at 4 °C. The length of the amplified fragment of the PCR product was identified by 1.2% agarose gel electrophoresis, and only the positive plants were used for subsequent experiments.

[0045] Table 2 Primers used for PCR detection of transgenic flowering Chinese cabbage

[0046] Primer Name Primer Sequence (5’-3’) BrAL3_004_detect_F CGGGAAACCTCCTCGGATTC BrAL3_004_detect_R GCCTAAAGCTGGCTCTGGAA 004_F CAATGACCGCTGTTATGCGG 004_R TAAATAGCTGCGCCGATGGT

[0047] Real-time fluorescence quantitative PCR analysis of the relative expression level of BrAL3 gene in transgenic positive flowering Chinese cabbage plants: Take the leaves of the positive lines detected by PCR after transplantation, put them into 1.5 mL EP tubes, make marks, and quickly place them in liquid nitrogen for fixation. After all the materials are taken, extract total RNA and synthesize cDNA, and then perform qRT-PCR analysis. The primers used for qRT-PCR analysis were designed by Primer Premier 5 and are shown in Table 3. The reaction system was 15 μL: 7.5 μL of SYBR Green Master Mix, 0.3 μL each of forward and reverse primers, 1 μL of template, and 5.9 μL of double-distilled water. The qRT-PCR reaction procedure: 95 °C: 30 s, 40 cycles (95 °C: 5 s, 55 °C: 45 s). Determine the specificity of the reaction through the melting curve. The internal reference gene is BrUBC10, and the relative expression level of the gene is calculated by 2 -ΔΔCt method.

[0048] Table 3 Primers used for qRT-PCR analysis of transgenic flowering Chinese cabbage lines

[0049] Primer Name Primer Sequence (5’-3’) BrAL3_qRT_F GTTACCAAACGAACAATGGGAA BrAL3_qRT_R AGTAAAAAGAGACGGAGAGCAA BrUBC10_F GGGTCCTACAGACAGTCCTTAC BrUBC10_R ATGGAACACCTTCGTCCTAAA

[0050] The results are as shown in Figure 4 A and B, indicating that overexpression of the BrAL3 gene occurred in the transgenic lines (35S::BrAL3).

[0051] Example 3 Statistics of the bolting and flowering time of transgenic lines (35S::BrAL3)

[0052] After the seeds of the BrAL3 overexpression transgenic plants obtained in Example 2 were germinated overnight at 28 °C, they were sown in 72-well trays and transferred to 15-well trays at 15 days. The growth days when the bolting height reached 1 cm after budding were used as the bolting and flowering time, and the bolting and flowering time of transgenic plants was statistically analyzed. The transgenic flowering Chinese cabbage plants transformed with the pAC004 vector were used as control plants (CK). The results are as shown in Figure 5 A and B, and the bolting and flowering time of BrAL3 overexpression transgenic plants was significantly advanced.

[0053] The above-described embodiments have described the technical solutions of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, supplements, or similar replacements made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Flowering Chinese cabbage BrAL3 Application of gene in promoting bolting and flowering of cruciferous plants, characterized in that Flowering Chinese Cabbage BrAL3 The base sequence of the gene is as shown in SEQ ID NO.1, and the cruciferous plant is Flowering Chinese Cabbage.

2. The application according to claim 1, characterized in that Overexpress flowering Chinese cabbage in cruciferous plants BrAL3 gene.

3. The application according to claim 2, characterized in that, Link the bok choy BrAL3 gene into a plant overexpression vector to construct a recombinant overexpression vector, and then transform the recombinant overexpression vector into a recipient plant.

4. The application according to claim 3, characterized in that The recombinant overexpression vector is pAC004- BrAL3 .

5. The application according to claim 3, wherein Transform the recombinant overexpression vector into Agrobacterium tumefaciens, and then infect the recipient plant with the obtained recombinant Agrobacterium tumefaciens.

6. Flowering Chinese Cabbage BrAL3 Application of the gene in breeding of flowering Chinese cabbage, characterized in that Screened flowering Chinese cabbage BrAL3 Flowering Chinese cabbage with gene overexpression, the flowering Chinese cabbage BrAL3 The base sequence of the gene is shown in SEQ ID NO.

1.

7. A method for promoting premature bolting and flowering of cruciferous plants, characterized in that, Comprising the following steps: (1) Insert the flowering Chinese cabbage BrAL3 gene into a plant overexpression vector to construct a recombinant overexpression vector; (2) Transform the recombinant overexpression vector constructed in step (1) into a cruciferous plant serving as the recipient plant; The cruciferous plant is flowering Chinese cabbage, and the flowering Chinese cabbage BrAL3 The base sequence of the gene is as shown in SEQ ID NO.

1.

8. The method according to claim 7, characterized in that, The recombinant overexpression vector is pAC004- BrAL3 .

9. The method according to claim 7, wherein Transform the recombinant overexpression vector into Agrobacterium tumefaciens, and then infect the recipient plant cells with the obtained recombinant Agrobacterium tumefaciens.

Images