L-threonine 3-dehydrogenase and uracil permease mutants and their applications

Abstract

This invention provides mutants of L-threonine 3-dehydrogenase and uracil permease, and their applications. This invention achieves mutation of L-threonine 3-dehydrogenase by modifying the tdh gene to mutate the 282nd amino acid from V to another amino acid (such as E, A, or G); and / or, by modifying the pyrP gene to mutate the 283rd amino acid of uracil permease from V to another amino acid (such as M, A, or L), thereby increasing the nucleoside production capacity of microorganisms. The L-threonine 3-dehydrogenase mutant strains and / or uracil permease mutant strains provided by this invention have a significant promoting effect on the production of the target products adenosine and inosine. These L-threonine 3-dehydrogenase mutants and / or uracil permease mutants and their recombinant microorganisms provide a reference for the construction of production strains that produce adenosine, inosine, and derivatives using these as precursors.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and microbial fermentation technology, specifically, it relates to L-threonine 3-dehydrogenase and uracil permease mutants and their applications. Background Technology

[0002] Nucleosides are a general term for a class of glycosides. They are components of nucleic acids and nucleotides. Nucleosides are formed by the condensation of D-ribose or D2-deoxyribose with pyrimidine or purine bases. Nucleosides are generally colorless crystals, insoluble in common organic solvents, readily soluble in hot water, and have a melting point of 160–240℃. Nucleosides formed from D-ribose are called ribonucleosides and participate in the composition of RNA; nucleosides formed from D-α-deoxyribose are called deoxyribonucleosides and participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine, or uracil to form the corresponding adenine ribonucleosides, guanine ribonucleosides, cytosine ribonucleosides, thymine ribonucleosides, and uracil ribonucleosides, which are abbreviated as adenosine (A), guanine (G), cytosine (C), thymine (T), and uridine (U), respectively.

[0003] Guanosine and inosine have wide applications in the food and pharmaceutical industries. In the food sector, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively. Disodium guanylate and disodium inosinate are used in combination as flavor enhancers, widely applied in condiments such as chicken essence and soy sauce. In the pharmaceutical sector, guanosine and inosine serve as intermediates for various antiviral drugs, such as acyclic guanosine, triazole nucleoside, and guanosine triphosphate sodium, all of which require guanosine as a raw material for synthesis. Inosine is an important precursor of inosine monophosphate, which in turn serves as a precursor for the synthesis of adenosine monophosphate (AMP) and guanosine monophosphate (GMP). It is suitable for treating leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, and other conditions caused by various reasons. Furthermore, it can be used to treat central retinitis and optic nerve atrophy.

[0004] Currently, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens, and Bacillus pumilus. In the selection and modification of growth strains, high-yielding nucleosides are selectively bred using ultraviolet mutagenesis and chemical mutagenesis (such as diethyl sulfate); or, based on a thorough understanding of the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, the genetic background and characteristics of the strains are analyzed, and metabolic engineering is used to purposefully modify the strains to obtain high-yielding nucleosides with superior traits. However, the fermentation performance of current nucleoside strains is still relatively poor, and the conversion rate of nucleosides remains low, which cannot meet the needs of large-scale industrial production. Summary of the Invention

[0005] The purpose of this invention is to provide mutants of L-threonine 3-dehydrogenase and uracil permease and their applications.

[0006] Another objective of this invention is to provide genetically engineered bacteria that produce nucleosides and nucleoside derivatives, their construction methods, and applications.

[0007] The inventors unexpectedly discovered that by modifying the L-threonine 3-dehydrogenase (encoded by the tdh gene) and / or uracil permease (encoded by the pyrP gene) of Bacillus species (such as Bacillus subtilis and Bacillus amyloliquefaciens), the microorganisms were able to efficiently produce adenosine or inosine, and a new microorganism capable of efficiently producing nucleosides was successfully constructed, thus completing this invention.

[0008] To achieve the objectives of this invention, in a first aspect, this invention provides an L-threonine 3-dehydrogenase mutant, said mutant comprising a mutation in the 282nd amino acid of L-threonine 3-dehydrogenase from V to an amino acid other than V, preferably a mutation from V to E, A or G.

[0009] In this invention, the reference sequence number of L-threonine 3-dehydrogenase on NCBI is WP_003244880.1.

[0010] In a second aspect, the present invention provides a uracil permease mutant, the mutant comprising a mutation in the uracil permease at amino acid position 283 from V to an amino acid other than V, preferably a mutation from V to M, A or L.

[0011] In this invention, the reference sequence number of uracil permease on NCBI is WP_003221479.1.

[0012] Thirdly, the present invention provides nucleic acid molecules encoding the L-threonine 3-dehydrogenase mutant and / or the uracil permease mutant.

[0013] Fourthly, the present invention provides biological materials containing the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, or engineered bacteria.

[0014] Fifthly, the present invention provides any of the following applications of the nucleic acid molecule or biological materials containing the nucleic acid molecule:

[0015] (1) Used for the fermentation production of nucleosides and nucleoside derivatives;

[0016] (2) Used to construct genetically engineered bacteria that produce nucleosides and nucleoside derivatives.

[0017] Preferably, the nucleoside is adenosine or inosine.

[0018] Sixthly, the present invention provides a method for constructing genetically engineered bacteria that produce nucleosides and nucleoside derivatives, wherein the method is selected from any one of ① to ③:

[0019] ① Using genetic engineering techniques, mutations are introduced into the genome of bacteria capable of nucleoside production, so that the L-threonine 3-dehydrogenase they encode contains V282E, V282A or V282G mutation sites.

[0020] ② Using genetic engineering techniques, mutations are introduced into the genome of bacteria capable of nucleoside production, so that the uracil permease they encode contains V283M, V283A, or V283L mutation sites.

[0021] ③ Using genetic engineering techniques, mutations are introduced into the genomes of bacteria capable of nucleoside production, so that the L-threonine 3-dehydrogenase it encodes contains V282E, V282A, or V282G mutation sites, and the uracil permease it encodes contains V283M, V283A, or V283L mutation sites.

[0022] In this invention, the bacteria are Bacillus species, such as Bacillus subtilis, Bacillus amyloliquefaciens, or Bacillus pumilus, with Bacillus subtilis A1 (strain A1, see CN110257315B) being preferred.

[0023] In a seventh aspect, the present invention provides genetically engineered bacteria constructed according to the method.

[0024] Eighthly, the present invention provides any of the following applications of the genetically engineered bacteria:

[0025] 1) Used for the fermentation production of nucleosides and nucleoside derivatives;

[0026] 2) Used to increase the fermentation yield of nucleosides and nucleoside derivatives.

[0027] Preferably, the nucleoside is adenosine or inosine.

[0028] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0029] Mutating the amino acid at position 282 of L-threonine 3-dehydrogenase by replacing valine (V) with other amino acids, such as glutamic acid (E), alanine (A), or glycine (G), increases the production of adenosine and inosine, with the best effect observed after valine (V) is mutated to glutamic acid (E). The L-threonine 3-dehydrogenase mutant strain tdh V282ECompared with the original strain A1, adenosine production increased from 1.3 g / L to 1.8 g / L, and inosine production increased from 0.5 g / L to 0.9 g / L.

[0030] Mutating the 283rd amino acid of uracil permease by replacing valine (V) with other amino acids, such as methionine (M), alanine (A), or leucine (L), significantly increased the production of adenosine and inosine, indicating that this mutation site is beneficial to the production of adenosine and inosine, especially the mutation from valine (V) to methionine (M). The uracil permease mutant strain pyrP V283M Compared with the starting strain A1, adenosine production increased from 1.3 g / L to 2.9 g / L, and inosine production increased from 0.5 g / L to 1.1 g / L.

[0031] L-threonine 3-dehydrogenase mutant tdh V282E With uracil permease mutant (pyrP) V283M pyrP V283A or pyrP V283L The combined effect is even more pronounced, with the optimal production results being: adenosine production increased from 1.3 g / L to 3.6 g / L, and inosine production increased from 0.5 g / L to 1.9 g / L.

[0032] The above-mentioned mutation sites can be applied to Bacillus subtilis, but are not limited to Bacillus subtilis, such as Bacillus amyloliquefaciens and Bacillus pumilus, for the production of nucleosides such as adenosine, inosine, and guanosine or their corresponding nucleoside derivatives, such as hypoxanthine, inosine, guanine, guanylic acid, riboflavin, and diacetylguanylic acid. Detailed Implementation

[0033] One of the technical solutions of the present invention provides a Bacillus subtilis in which the 282nd amino acid of the L-threonine 3-dehydrogenase encoded by the tdh gene in the cell is mutated from valine (V) to glutamic acid (E), alanine (A) or glycine (G), and the corresponding base sequence is mutated from GTG to GAG, GCG or GGG, respectively.

[0034] The tdh gene encodes L-threonine 3-dehydrogenase, which catalyzes the dehydrogenation of L-threonine to L-2-amino-3-oxobutyrate, accompanied by oxidized nicotinamide adenine dinucleotide (NAD). + The tdh gene is converted into reduced nicotinamide adenine dinucleotide (NADH). This invention, through modification of the tdh gene, mutates L-threonine 3-dehydrogenase, enhancing the microorganism's ability to produce nucleosides compared to unmodified strains, ultimately increasing the production of adenosine and inosine.

[0035] The second technical solution of the present invention provides a Bacillus subtilis in which the 283rd amino acid of the uracil permease encoded by the pyrP gene in the cell is mutated from valine (V) to methionine (M), alanine (A) or leucine (L), and the corresponding base sequence is mutated from GTG to ATG, GCG or CTG.

[0036] The pyrP gene encodes a uracil permease, which plays a role in transporting pyrimidines in and out of cells. This invention modifies the pyrP gene to mutate the uracil permease. After mutating amino acid position 283 in the microorganism, its ability to produce nucleosides is enhanced, ultimately increasing the production of adenosine and inosine.

[0037] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions.

[0038] The primer information involved in the following examples is shown in Table 1.

[0039] Table 1 Primer Information

[0040] Primer Name Primer Sequence (5′-3′) <![CDATA[tdh V282E -UP-1F]]> GAAACACACATTGTCTGTGGT <![CDATA[tdh V282E -UP-1R]]> GGATGGTAAGCCCTTTAAATACCTCTTTATTCGTCAAATCAATTG <![CDATA[tdh V282E -DN-2F]]> CAATTGATTTGACGAATAAAGAGGTATTTAAAGGGCTTACCATCC <![CDATA[tdh V282E -DN-2R]]> AAAGGCTGCCAGCTTTTTCTC <![CDATA[tdh V282A -UP-1R]]> GGATGGTAAGCCCTTTAAATACCGCTTTATTCGTCAAATCAATTG <![CDATA[tdh V282A -DN-2F]]> CAATTGATTTGACGAATAAAGCGGTATTTAAAGGGCTTACCATCC <![CDATA[tdh V282G -UP-1R]]> GGATGGTAAGCCCTTTAAATACCCCTTTATTCGTCAAATCAATTG <![CDATA[tdh V282G -DN-2F]]> CAATTGATTTGACGAATAAAGGGGTATTTAAAGGGCTTACCATCC <![CDATA[pyrP V283M -UP-1F]]> GCTGATTGCCTTATTGATTAG <![CDATA[pyrP V283M -UP-1R]]> CAGGGAAGCGAGGATTGTCGCCATACTGTCACCCATAATAGAGCG <![CDATA[pyrP V283M -DN-2F]]> CGCTCTATTATGGGTGACAGTATGGCGACAATCCTCGCTTCCCTG <![CDATA[pyrP V283M -DN-2R]]> TCACTCATCGTCGTTAAATGC <![CDATA[pyrP V283A -UP-1R]]> CAGGGAAGCGAGGATTGTCGCCGCACTGTCACCCATAATAGAGCG <![CDATA[pyrP V283A -DN-2F]]> CGCTCTATTATGGGTGACAGTGCGGCGACAATCCTCGCTTCCCTG <![CDATA[pyrP V283L -UP-1R]]> CAGGGAAGCGAGGATTGTCGCCAGACTGTCACCCATAATAGAGCG <![CDATA[pyrP V283L -DN-2F]]> CGCTCTATTATGGGTGACAGTCTGGCGACAATCCTCGCTTCCCTG

[0041] Example 1: L-threonine 3-dehydrogenase mutant strain tdh V282E Construction

[0042] Using the genome of strain B. subtilis A1 as a template, primer tdh V282E -UP-1F / tdh V282E -UP-1R and tdh V282E -DN-2F / tdh V282E -DN-2R, two fragments were amplified using Phusion ultrafidelity polymerase (New England BioLabs). Primers tdh were used. V282E -UP-1F / tdh V282E -DN-2R fuses two fragments to obtain the recombinant fragment. The nucleotide sequence of the ORF region is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:2. tdh V282EAfter assembly and transformation of the fragment with the pKSU plasmid (the pKSU plasmid was kindly provided by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production[J], Applied Microbiology and Biotechnology, 2014, 98(21):8963-8973. Zhang W, Gao W, Feng J, et al DOI:10.1007 / s00253-014-5824-2), the recombinant plasmid pKSU-tdh was obtained. V282E Transformed into *B. subtilis* A1 strain, transformants were screened on LB agar plates containing 2.5 μg / mL chloramphenicol at 30°C. The transformed strains were inoculated into 5 mL LB liquid medium, incubated at 42°C and 200 rpm for 12 h, and passaged. The transformed strains were then diluted and plated onto LB agar plates containing 5 μg / mL chloramphenicol to obtain primary recombinants. These primary recombinants were then inoculated into 5 mL LB liquid medium, incubated at 42°C and 200 rpm for 12 h, and passaged. The transformed strains were then diluted and plated onto LB agar plates containing 0.8 μM 5-FU to screen for secondary recombinants, yielding tdh. V282E The point mutant strain was named B. subtilis A1-tdh V282E abbreviated as TDH V282E .

[0043] Example 2: L-threonine 3-dehydrogenase mutant strain tdh V282A and tdh V282G Construction

[0044] The specific construction method is the same as in Example 1, using the L-threonine 3-dehydrogenase mutant strain tdh V282A The primer used was tdh V282E -UP-1F / tdh V282A -UP-1R and tdh V282A -DN-2F / tdh V282E -DN-2R was used to obtain the nucleotide sequence of the ORF region of the recombinant fragment as shown in SEQ ID NO:3, and the amino acid sequence as shown in SEQ ID NO:4. The resulting plasmid was pKSU-tdh. V282A The obtained strain was named B. subtilis A1-tdh V282A abbreviated as TDH V282A .

[0045] L-threonine 3-dehydrogenase mutant strain tdh V282G The primer used was tdh V282E -UP-1F / tdh VV282G -UP-1R and tdh V282G -DN-2F / tdh V282E -DN-2R was used to obtain the nucleotide sequence of the ORF region of the recombinant fragment as shown in SEQ ID NO:5, and the amino acid sequence as shown in SEQ ID NO:6. The resulting plasmid was pKSU-tdh. V282G The obtained strain was named B. subtilis A1-tdh V282G abbreviated as TDH V282G .

[0046] Example 3: Uracil permease mutant strain pyrP V283M pyrP V283A and pyrP V283L Construction

[0047] The specific construction method is the same as in Example 1, using the uracil permease mutant strain pyrP. V283M The primer used was pyrP V283M -UP-1F / pyrP V283M -UP-1R and pyrP V283M -DN-2F / pyrP V283M -DN-2R was used to obtain the nucleotide sequence of the ORF region of the recombinant fragment, which is shown in SEQ ID NO:7, and the amino acid sequence, which is shown in SEQ ID NO:8. The resulting plasmid was pKSU-pyrP. V283M The obtained strain was named B. subtilis A1-pyrP V283M hereinafter referred to as pyrP V283M .

[0048] Uracil permease mutant strain pyrP V283A The primer used was pyrP V283M -UP-1F / pyrP V283A -UP-1R and pyrP V283A -DN-2F / pyrP V283M -DN-2R was used to obtain the nucleotide sequence of the ORF region of the recombinant fragment (SEQ ID NO:9) and the amino acid sequence (SEQ ID NO:10). The resulting plasmid was pKSU-pyrP. V283A The obtained strain was named B. subtilisA1-pyrP V283A abbreviated as pyrP V283A .

[0049] Uracil permease mutant strain pyrP V283L The primer used was pyrP V283M -UP-1F / pyrP V283L -UP-1R and pyrP V283L -DN-2F / pyrP V283M -DN-2R was used to obtain the nucleotide sequence of the ORF region of the recombinant fragment (SEQ ID NO:11) and the amino acid sequence (SEQ ID NO:12). The resulting plasmid was pKSU-pyrP. V283L The obtained strain was named B. subtilisA1-pyrP V283L abbreviated as pyrP V283L .

[0050] Example 4: Construction of a double mutant strain containing L-threonine 3-dehydrogenase and uracil permease

[0051] In the L-threonine 3-dehydrogenase mutant strain B. subtilis A1-tdh V282E The superimposed uracil permease mutant pyrP V283M pyrP V283A pyrP V283L .

[0052] With strain B. subtilis A1-tdh V282E Using the genome as a template, the specific construction method is the same as in Example 3. The strains obtained from the construction were named B. subtilis A1-tdh. V282E pyrP V283M B. subtilis A1-tdh V282E pyrP V283A B. subtilis A1-tdh V282E pyrP V283L abbreviated as TDH V282E pyrP V283M ,tdh V282E pyrP V283A ,tdh V282E pyrP V283L .

[0053] Example 5: Ability of engineered strains to produce nucleosides through fermentation

[0054] 1. Culture medium

[0055] (1) Seed culture medium formula (g / L): glucose 20, yeast powder 5, corn steep liquor powder 5, potassium dihydrogen phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0~7.2, sterilized at 121℃ for 20min.

[0056] (2) Fermentation medium formula (g / L): glucose 60, yeast powder 3.5, potassium dihydrogen phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, monosodium glutamate 10, corn steep liquor powder 15, calcium carbonate 25, pH 7.0~7.2, sterilized at 121℃ for 20min.

[0057] 2. Cultivation Methods

[0058] (1) Streak the strain in three zones on LB plates and incubate overnight at 37°C;

[0059] (2) Pick a single colony and inoculate it into 30 mL of seed culture medium. Incubate at 110 rpm and 36 °C for 7–8 h.

[0060] (3) Transfer 10% of the inoculum to 30 ml of fermentation medium, shake at 120 rpm, and incubate at 36°C for 36 h.

[0061] 3. Detection and Results

[0062] The bacterial cell concentration was detected using a spectrophotometer at a wavelength of 562 nm (OD). 562 The nucleosides in the fermentation broth were detected using high performance liquid chromatography (HPLC), and the results are shown in Table 2.

[0063] Table 2. Evaluation results of the yield capacity of engineered bacteria in shake-flask fermentation (mean of three replicates)

[0064] Strain <![CDATA[OD 562 ]]> Adenosine Yield (g / L) Inosine Yield (g / L) A1 25.3 1.3 0.5 <![CDATA[tdh V282E ]]> 24.8 1.8* 0.9* <![CDATA[tdh V282A ]]> 25.1 1.6* 1.0* <![CDATA[tdh V282G ]]> 24.6 1.7* 0.8* <![CDATA[pyrP V283M ]]> 24.9 2.9* 1.1* <![CDATA[pyrP V283A ]]> 24.5* 2.5* 1.3* <![CDATA[pyrP V283L ]]> 24.2* 2.2* 1.5* <![CDATA[tdh V282E pyrP V283M ]]> 25.4 3.6* 1.6* <![CDATA[tdh V282E pyrP V283A ]]> 25.0 3.0* 1.8* <![CDATA[tdh V282E pyrP V283L ]]> 24.7* 2.8* 1.9*

[0065] Note: * indicates a significant difference compared to the starting strain, P<0.05.

[0066] The above experimental results show that the L-threonine 3-dehydrogenase mutant (tdh) V282E ,tdh V282A and tdh V282G ), uracil permease mutant (pyrP) V283M pyrP V283A and pyrP V283L It has a positive effect on increasing the production of adenosine and inosine, and the combined effect of mutations in the two enzymes is even more prominent, increasing adenosine production from 1.3 g / L to 3.6 g / L and inosine production from 0.5 g / L to 1.9 g / L.

[0067] Mutating the amino acid at position 282 of L-threonine 3-dehydrogenase by replacing valine (V) with glutamic acid (E), alanine (A), or glycine (G) all increased adenosine production, with the best effect observed after valine (V) was replaced with glutamic acid (E). The L-threonine 3-dehydrogenase mutant strain tdh... V282ECompared with the original strain A1, adenosine production increased from 1.3 g / L to 1.8 g / L, and inosine production increased from 0.5 g / L to 0.9 g / L.

[0068] Mutating the 283rd amino acid of uracil permease from valine (V) to methionine (M), alanine (A), or leucine (L) significantly increased the production of adenosine and inosine, indicating that this mutation site is beneficial to the production of adenosine and inosine, especially the mutation from valine (V) to methionine (M). The uracil permease mutant strain pyrP V283M Compared with the starting strain A1, adenosine production increased from 1.3 g / L to 2.9 g / L, and inosine production increased from 0.5 g / L to 1.1 g / L.

[0069] L-threonine 3-dehydrogenase mutant tdh V282E With uracil permease mutant (pyrP) V283M pyrP V283A or pyrP V283L The combined effect is even more pronounced, with the optimal production results being: adenosine production increased from 1.3 g / L to 3.6 g / L, and inosine production increased from 0.5 g / L to 1.9 g / L.

[0070] Therefore, the L-threonine 3-dehydrogenase mutant strains and / or uracil permease mutant strains provided by this invention have a significant promoting effect on the production of the target products adenosine and inosine. These L-threonine 3-dehydrogenase mutants and / or uracil permease mutants and their recombinant microorganisms provide a reference for the construction of production strains that produce adenosine, inosine, and derivatives using these as precursors.

[0071] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Langfang Meihua Biotechnology Development Co., Ltd. <120> L-threonine 3-dehydrogenase and uracil permease mutants and their applications <130> KHP211124097.7 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1044 <212> DNA <213> Artificial Sequence <400> 1 atgcagagtg gaaagatgaa agctctaatg aaaaaggacg gggcgttcgg tgctgtgctg 60 actgaagttc ccattcctga gattgataaa catgaagtcc tcataaaagt gaaagccgct 120 tccatatgcg gcacggatgt ccacatttat aattgggatc aatgggcacg tcagagaatc 180 aaaacaccct atgttttcgg ccatgagttc agcggcatcg tagagggcgt gggagagaat 240 gtcagcagtg taaaagtggg agagtatgtg tctgcggaaa cacacattgt ctgtggtgaa 300 tgtgtccctt gcctaacagg aaaatctcat gtgtgtacca atactgctat aatcggagtg 360 gacacggcag gctgttttgc ggagtatgta aaagttccag ctgataacat ttggagaaat 420 cccgctgata tggacccgtc gattgcttcc attcaagagc ctttaggaaa tgcagttcat 480 accgtactcg agagccagcc tgcaggagga acgactgcag tcattggatg cggaccgatt 540 ggtcttatgg ctgttgcggt tgcaaaagca gcaggagctt ctcaggtgat agcgattgat 600 aagaatgaat acaggctgag gcttgcaaaa caaatgggag cgacttgtac tgtttctatt 660 gaaaaagaag acccgctcaa aattgtaagc gctttaacga gtggagaagg agcagatctt 720 gtttgtgaga tgtcgggcca tccctcagcg attgcccaag gtcttgcgat ggctgcgaat 780 ggcggaagat ttcatattct cagcttgccg gaacatccgg tgacaattga tttgacgaat 840 aaagaggtat ttaaagggct taccatccaa ggaatcacag gaagaaaaat gttttcaaca 900 tggcgccagg tgtctcagtt gatcagttca aacatgatcg atcttgcacc tgttattacc 960 catcagtttc cattagagga gtttgaaaaa ggtttcgaac tgatgagaag cgggcagtgc 1020 ggaaaagtaa ttttaattcc ataa 1044 <210> 2 <211> 347 <212> PRT <213> Artificial Sequence <400> 2 Met Gln Ser Gly Lys Met Lys Ala Leu Met Lys Lys Asp Gly Ala Phe 1 5 10 15 Gly Ala Val Leu Thr Glu Val Pro Ile Pro Glu Ile Asp Lys His Glu 20 25 30 Val Leu Ile Lys Val Lys Ala Ala Ser Ile Cys Gly Thr Asp Val His 35 40 45 Ile Tyr Asn Trp Asp Gln Trp Ala Arg Gln Arg Ile Lys Thr Pro Tyr 50 55 60 Val Phe Gly His Glu Phe Ser Gly Ile Val Glu Gly Val Gly Glu Asn 65 70 75 80 Val Ser Ser Val Lys Val Gly Glu Tyr Val Ser Ala Glu Thr His Ile 85 90 95 Val Cys Gly Glu Cys Val Pro Cys Leu Thr Gly Lys Ser His Val Cys 100 105 110 Thr Asn Thr Ala Ile Ile Gly Val Asp Thr Ala Gly Cys Phe Ala Glu 115 120 125 Tyr Val Lys Val Pro Ala Asp Asn Ile Trp Arg Asn Pro Ala Asp Met 130 135 140 Asp Pro Ser Ile Ala Ser Ile Gln Glu Pro Leu Gly Asn Ala Val His 145 150 155 160 Thr Val Leu Glu Ser Gln Pro Ala Gly Gly Thr Thr Ala Val Ile Gly 165 170 175 Cys Gly Pro Ile Gly Leu Met Ala Val Ala Val Ala Lys Ala Ala Gly 180 185 190 Ala Ser Gln Val Ile Ala Ile Asp Lys Asn Glu Tyr Arg Leu Arg Leu 195 200 205 Ala Lys Gln Met Gly Ala Thr Cys Thr Val Ser Ile Glu Lys Glu Asp 210 215 220 Pro Leu Lys Ile Val Ser Ala Leu Thr Ser Gly Glu Gly Ala Asp Leu 225 230 235 240 Val Cys Glu Met Ser Gly His Pro Ser Ala Ile Ala Gln Gly Leu Ala 245 250 255 Met Ala Ala Asn Gly Gly Arg Phe His Ile Leu Ser Leu Pro Glu His 260 265 270 Pro Val Thr Ile Asp Leu Thr Asn Lys Glu Val Phe Lys Gly Leu Thr 275 280 285 Ile Gln Gly Ile Thr Gly Arg Lys Met Phe Ser Thr Trp Arg Gln Val 290 295 300 Ser Gln Leu Ile Ser Ser Asn Met Ile Asp Leu Ala Pro Val Ile Thr 305 310 315 320 His Gln Phe Pro Leu Glu Glu Phe Glu Lys Gly Phe Glu Leu Met Arg 325 330 335 Ser Gly Gln Cys Gly Lys Val Ile Leu Ile Pro 340 345 <210> 3 <211> 1044 <212> DNA <213> Artificial Sequence <400> 3 atgcagagtg gaaagatgaa agctctaatg aaaaaggacg gggcgttcgg tgctgtgctg 60 actgaagttc ccattcctga gattgataaa catgaagtcc tcataaaagt gaaagccgct 120 tccatatgcg gcacggatgt ccacatttat aattgggatc aatgggcacg tcagagaatc 180 aaaacaccct atgtttttcgg ccatgagttc agcggcatcg tagagggcgt gggagagaat 240 gtcagcagtg taaaagtggg agagtatgtg tctgcggaaa cacacattgt ctgtggtgaa 300 tgtgtccctt gcctaacagg aaaatctcat gtgtgtacca atactgctat aatcggagtg 360 gacacggcag gctgttttgc ggagtatgta aaagttccag ctgataacat ttggagaaat 420 cccgctgata tggacccgtc gattgcttcc attcaagagc ctttaggaaa tgcagttcat 480 accgtactcg agagccagcc tgcaggagga acgactgcag tcattggatg cggaccgatt 540 ggtcttatgg ctgttgcggt tgcaaaagca gcaggagctt ctcaggtgat agcgattgat 600 aagaatgaat acaggctgag gcttgcaaaa caaatgggag cgacttgtac tgtttctatt 660 gaaaaagaag acccgctcaa aattgtaagc gctttaacga gtggagaagg agcagatctt 720 gtttgtgaga tgtcgggcca tccctcagcg attgcccaag gtcttgcgat ggctgcgaat 780 ggcggaagat ttcatattct cagcttgccg gaacatccgg tgacaattga tttgacgaat 840 aaagcggtat ttaaagggct taccatccaa ggaatcacag gaagaaaaat gttttcaaca 900 tggcgccagg tgtctcagtt gatcagttca aacatgatcg atcttgcacc tgttattacc 960 catcagtttc cattagagga gtttgaaaaa ggtttcgaac tgatgagaag cgggcagtgc 1020 ggaaaagtaa ttttaattcc ataa 1044 <210> 4 <211> 347 <212> PRT <213> Artificial Sequence <400> 4 Met Gln Ser Gly Lys Met Lys Ala Leu Met Lys Lys Asp Gly Ala Phe 1 5 10 15 Gly Ala Val Leu Thr Glu Val Pro Ile Pro Glu Ile Asp Lys His Glu 20 25 30 Val Leu Ile Lys Val Lys Ala Ala Ser Ile Cys Gly Thr Asp Val His<00​​​​​​Val Phe Gly His Glu Phe Ser Gly Ile Val Glu Gly Val Gly Glu Asn 65 70 75 80 Val Ser Ser Val Lys Val Gly Glu Tyr Val Ser Ala Glu Thr His Ile 85 90 95 Val Cys Gly Glu Cys Val Pro Cys Leu Thr Gly Lys Ser His Val Cys 100 105 110 Thr Asn Thr Ala Ile Ile Gly Val Asp Thr Ala Gly Cys Phe Ala Glu 115 120 125 Tyr Val Lys Val Pro Ala Asp Asn Ile Trp Arg Asn Pro Ala Asp Met 130 135 140 Asp Pro Ser Ile Ala Ser Ile Gln Glu Pro Leu Gly Asn Ala Val His 145 150 155 160 Thr Val Leu Glu Ser Gln Pro Ala Gly Gly Thr Thr Ala Val Ile Gly 165 170 175 Cys Gly Pro Ile Gly Leu Met Ala Val Ala Val Ala Lys Ala Ala Gly 180 185 190 Ala Ser Gln Val Ile Ala Ile Asp Lys Asn Glu Tyr Arg Leu Arg Leu 195 200 205 Ala Lys Gln Met Gly Ala Thr Cys Thr Val Ser Ile Glu Lys Glu Asp 210 215 220 Pro Leu Lys Ile Val Ser Ala Leu Thr Ser Gly Glu Gly Ala Asp Leu 225 230 235 240 Val Cys Glu Met Ser Gly His Pro Ser Ala Ile Ala Gln Gly Leu Ala 245 250 255 Met Ala Ala Asn Gly Gly Arg Phe His Ile Leu Ser Leu Pro Glu His 260 265 270[[ID=-11]] Pro Val Thr Ile Asp Leu Thr Asn Lys Ala Val Phe Lys Gly Leu Thr 275 280 285 Ile Gln Gly Ile Thr Gly Arg Lys Met Phe Ser Thr Trp Arg Gln Val 290 295 300 Ser Gln Leu Ile Ser Ser Asn Met Ile Asp Leu Ala Pro Val Ile Thr 305 310 315 320 His Gln Phe Pro Leu Glu Glu Phe Glu Lys Gly Phe Glu Leu Met Arg 325 330 335 Ser Gly Gln Cys Gly Lys Val Ile Leu Ile Pro 340 345 <210> 5 <211> 1044 <212> DNA <213> Artificial Sequence <400> 5 atgcagagtg gaaagatgaa agctctaatg aaaaaggacg gggcgttcgg tgctgtgctg 60 actgaagttc ccattcctga gattgataaa catgaagtcc tcataaaagt gaaagccgct 120 tccatatgcg gcacggatgt ccacatttat aattgggatc aatgggcacg tcagagaatc 180 aaaacaccct atgtttttcgg ccatgagttc agcggcatcg tagagggcgt gggagagaat 240 gtcagcagtg taaaagtggg agagtatgtg tctgcggaaa cacacattgt ctgtggtgaa 300 tgtgtccctt gcctaacagg aaaatctcat gtgtgtacca atactgctat aatcggagtg 360 gacacggcag gctgttttgc ggagtatgta aaagttccag ctgataacat ttggagaaat 420 cccgctgata tggacccgtc gattgcttcc attcaagagc ctttaggaaa tgcagttcat 480 accgtactcg agagccagcc tgcaggagga acgactgcag tcattggatg cggaccgatt 540 ggtcttatgg ctgttgcggt tgcaaaagca gcaggagctt ctcaggtgat agcgattgat 600 aagaatgaat acaggctgag gcttgcaaaa caaatgggag cgacttgtac tgtttctatt 660 gaaaaagaag acccgctcaa aattgtaagc gctttaacga gtggagaagg agcagatctt 720 gtttgtgaga tgtcgggcca tccctcagcg attgcccaag gtcttgcgat ggctgcgaat 780 ggcggaagat ttcatattct cagcttgccg gaacatccgg tgacaattga tttgacgaat 840 aaaggggtat ttaaagggct taccatccaa ggaatcacag gaagaaaaat gttttcaaca 900 tggcgccagg tgtctcagtt gatcagttca aacatgatcg atcttgcacc tgttattacc 960 catcagtttc cattagagga gtttgaaaaa ggtttcgaac tgatgagaag cgggcagtgc 1020 ggaaaagtaa ttttaattcc ataa 1044 <210> 6 <211> 347 <212> PRT <213> Artificial Sequence <400> 6 Met Gln Ser Gly Lys Met Lys Ala Leu Met Lys Lys Asp Gly Ala Phe 1 5 10 15 Gly Ala Val Leu Thr Glu Val Pro Ile Pro Glu Ile Asp Lys His Glu 20 25 30 Val Leu Ile Lys Val Lys Ala Ala Ser Ile Cys Gly Thr Asp Val His 35 40 45 Ile Tyr Asn Trp Asp Gln Trp Ala Arg Gln Arg Ile Lys Thr Pro Tyr 50 55 60 Val Phe Gly His Glu Phe Ser Gly Ile Val Glu Gly Val Gly Glu Asn 65 70 75 80 Val Ser Ser Val Lys Val Gly Glu Tyr Val Ser Ala Glu Thr His Ile 85 90 95 Val Cys Gly Glu Cys Val Pro Cys Leu Thr Gly Lys Ser His Val Cys 100 105 110 Thr Asn Thr Ala Ile Ile Gly Val Asp Thr Ala Gly Cys Phe Ala Glu 115 120 125 Tyr Val Lys Val Pro Ala Asp Asn Ile Trp Arg Asn Pro Ala Asp Met 130 135 140 Asp Pro Ser Ile Ala Ser Ile Gln Glu Pro Leu Gly Asn Ala Val His 145 150 155 160 Thr Val Leu Glu Ser Gln Pro Ala Gly Gly Thr Thr Ala Val Ile Gly 165 170 175 Cys Gly Pro Ile Gly Leu Met Ala Val Ala Val Ala Lys Ala Ala Gly 180 185 190 Ala Ser Gln Val Ile Ala Ile Asp Lys Asn Glu Tyr Arg Leu Arg Leu 195 200 205 Ala Lys Gln Met Gly Ala Thr Cys Thr Val Ser Ile Glu Lys Glu Asp 210 215 220 Pro Leu Lys Ile Val Ser Ala Leu Thr Ser Gly Glu Gly Ala Asp Leu 225 230 235 240 Val Cys Glu Met Ser Gly His Pro Ser Ala Ile Ala Gln Gly Leu Ala 245 250 255 Met Ala Ala Asn Gly Gly Arg Phe His Ile Leu Ser Leu Pro Glu His 260 265 270 Pro Val Thr Ile Asp Leu Thr Asn Lys Gly Val Phe Lys Gly Leu Thr 275 280 285 Ile Gln Gly Ile Thr Gly Arg Lys Met Phe Ser Thr Trp Arg Gln Val 290 295 300 Ser Gln Leu Ile Ser Ser Asn Met Ile Asp Leu Ala Pro Val Ile Thr 305 310 315 320 His Gln Phe Pro Leu Glu Glu Phe Glu Lys Gly Phe Glu Leu Met Arg 325 330 335 Ser Gly Gln Cys Gly Lys Val Ile Leu Ile Pro 340 345 <210> 7 <211> 1308 <212> DNA <213> Artificial Sequence <400> 7 atgagtaaga aaaaagtaaa tttaggggtc agggatgtcc cgacaccttt ctcttgggtt 60 tcattcagcc ttcagcattt gtttgccatg tttggctcaa ccattttggt tccgaagctc 120 gtcggaatga gtcctgctgt ggcgttggtg acaagcggca tcggaacact ggcgtacctt 180 cttattacca aaggacaaat tccggcgtat ctcggttcat ccttcgcctt tatttctccg 240 atcattctgg taaaagcgac cggcgggccg ggagcggcaa tggttggagc gtttcttgca 300 gggctggtgt acgggctgat tgccttattg attaggcagc ttggaacagg atggctgatg 360 aagattctcc cgcctgtagt cgtagggcct gttattatcg tcatcgggct gggactggca 420 agcactgcag taaacatggc gatgtatgct gatccgaacg cgagtgagtt ggtctacagc 480 ttaaagcact ttagtgtcgc aggagttacg ctggcaatta cgattatttg tgcgattttc 540 ttacgagggt ttttaagcct gattccggtt ctgatcggaa tcatcggcgg atacctgttt 600 gcccttactc aagggattgt caacttccag ccggtgcttg acgcgaaatg gtttgcagtg 660 cctgaattta tcattccgtt caaagattat tcaccgtcag ttacgctcgg catcgcagcc 720 gcaatggttc ctgtcgcatt tgtcacaatg tcagagcata tcggccacca aatggtgctg 780 agcaaggttg tcggacaaga cttcattaaa aagccaggtc ttcatcgctc tattatgggt 840 gacagtgtgg cgacaatcct cgcttccctg atcggcggcc ctccgacaac gacttacgga 900 gaaaacattg gcgtgctggc catcacaaga gtattcagcg tctttgtcat cgggggcgcg 960 gcagtgattg ccctttgctt cggctttatc ggcaaaattt cagcgctgat cagttcagtg 1020 ccgtcagcgg tcatgggagg cgtctccttc ctgctgttcg gaatcattgc ttcaagcggc 1080 ctgagaatgc tgattgacaa caaaattgat tatgaaaaca acagaaacct cattattaca 1140 tcagttatcc ttgtcatcgg tgtaggaggc gcttttatcc aagtgtctca gggcggattc 1200 caagtgtcag gaatggcgct tgccgcaatt gtcggtgtca tcttaaacct gattcttccg 1260 caggcgaagg aagagcaggc agacacatct gaacaacatc atatttaa 1308 <210> 8 <211> 435 <212> PRT <213> Artificial Sequence <400> 8 Met Ser Lys Lys Lys Val Asn Leu Gly Val Arg Asp Val Pro Thr Pro 1 5 10 15 Phe Ser Trp Val Ser Phe Ser Leu Gln His Leu Phe Ala Met Phe Gly 20 25 30 Ser Thr Ile Leu Val Pro Lys Leu Val Gly Met Ser Pro Ala Val Ala 35 40 45 Leu Val Thr Ser Gly Ile Gly Thr Leu Ala Tyr Leu Leu Ile Thr Lys 50 55 60 Gly Gln Ile Pro Ala Tyr Leu Gly Ser Ser Phe Ala Phe Ile Ser Pro 65 70 75 80 Ile Ile Leu Val Lys Ala Thr Gly Gly Pro Gly Ala Ala Met Val Gly 85 90 95 Ala Phe Leu Ala Gly Leu Val Tyr Gly Leu Ile Ala Leu Leu Ile Arg 100 105 110 Gln Leu Gly Thr Gly Trp Leu Met Lys Ile Leu Pro Pro Val Val Val 115 120 125 Gly Pro Val Ile Ile Val Ile Gly Leu Gly Leu Ala Ser Thr Ala Val 130 135 140 Asn Met Ala Met Tyr Ala Asp Pro Asn Ala Ser Glu Leu Val Tyr Ser 145 150 155 160 Leu Lys His Phe Ser Val Ala Gly Val Thr Leu Ala Ile Thr Ile Ile 165 170 175 Cys Ala Ile Phe Leu Arg Gly Phe Leu Ser Leu Ile Pro Val Leu Ile 180 185 190 Gly Ile Ile Gly Gly Tyr Leu Phe Ala Leu Thr Gln Gly Ile Val Asn 195 200 205 Phe Gln Pro Val Leu Asp Ala Lys Trp Phe Ala Val Pro Glu Phe Ile 210 215 220 Ile Pro Phe Lys Asp Tyr Ser Pro Ser Val Thr Leu Gly Ile Ala Ala 225 230 235 240 Ala Met Val Pro Val Ala Phe Val Thr Met Ser Glu His Ile Gly His 245 250 255 Gln Met Val Leu Ser Lys Val Val Gly Gln Asp Phe Ile Lys Lys Pro 260 265 270 Gly Leu His Arg Ser Ile Met Gly Asp Ser Met Ala Thr Ile Leu Ala 275 280 285 Ser Leu Ile Gly Gly Pro Pro Thr Thr Thr Tyr Gly Glu Asn Ile Gly 290 295 300 Val Leu Ala Ile Thr Arg Val Phe Ser Val Phe Val Ile Gly Gly Ala 305 310 315 320 Ala Val Ile Ala Leu Cys Phe Gly Phe Ile Gly Lys Ile Ser Ala Leu 325 330 335 Ile Ser Ser Val Pro Ser Ala Val Met Gly Gly Val Ser Phe Leu Leu 340 345 350 Phe Gly Ile Ile Ala Ser Ser Gly Leu Arg Met Leu Ile Asp Asn Lys 355 360 365 Ile Asp Tyr Glu Asn Asn Arg Asn Leu Ile Ile Thr Ser Val Ile Leu 370 375 380 Val Ile Gly Val Gly Gly Ala Phe Ile Gln Val Ser Gln Gly Gly Phe 385 390 395 400 Gln Val Ser Gly Met Ala Leu Ala Ala Ile Val Gly Val Ile Leu Asn 405 410 415 Leu Ile Leu Pro Gln Ala Lys Glu Glu Gln Ala Asp Thr Ser Glu Gln 420 425 430 His His Ile 435 <210> 9 <211> 1308 <212> DNA <213> Artificial Sequence <400> 9 atgagtaaga aaaaagtaaa tttaggggtc agggatgtcc cgacaccttt ctcttgggtt 60 tcattcagcc ttcagcattt gtttgccatg tttggctcaa ccattttggt tccgaagctc 120 gtcggaatga gtcctgctgt ggcgttggtg acaagcggca tcggaacact ggcgtacctt 180 cttattacca aaggacaaat tccggcgtat ctcggttcat ccttcgcctt tatttctccg 240 atcattctgg taaaagcgac cggcgggccg ggagcggcaa tggttggagc gtttcttgca 300 gggctggtgt acgggctgat tgccttattg attaggcagc ttggaacagg atggctgatg 360 aagattctcc cgcctgtagt cgtagggcct gttattatcg tcatcgggct gggactggca 420 agcactgcag taaacatggc gatgtatgct gatccgaacg cgagtgagtt ggtctacagc 480 ttaaagcact ttagtgtcgc aggagttacg ctggcaatta cgattatttg tgcgattttc 540 ttacgagggt ttttaagcct gattccggtt ctgatcggaa tcatcggcgg atacctgttt 600 gcccttactc aagggattgt caacttccag ccggtgcttg acgcgaaatg gtttgcagtg 660 cctgaattta tcattccgtt caaagattat tcaccgtcag ttacgctcgg catcgcagcc 720 gcaatggttc ctgtcgcatt tgtcacaatg tcagagcata tcggccacca aatggtgctg 780 agcaaggttg tcggacaaga cttcattaaa aagccaggtc ttcatcgctc tattatgggt 840 gacagtgtgg cgacaatcct cgcttccctg atcggcggcc ctccgacaac gacttacgga 900 gaaaacattg gcgtgctggc catcacaaga gtattcagcg tctttgtcat cgggggcgcg 960 gcagtgattg ccctttgctt cggctttatc ggcaaaattt cagcgctgat cagttcagtg 1020 ccgtcagcgg tcatgggagg cgtctccttc ctgctgttcg gaatcattgc ttcaagcggc 1080 ctgagaatgc tgattgacaa caaaattgat tatgaaaaca acagaaacct cattattaca 1140 tcagttatcc ttgtcatcgg tgtaggaggc gcttttatcc aagtgtctca gggcggattc 1200 caagtgtcag gaatggcgct tgccgcaatt gtcggtgtca tcttaaacct gattcttccg 1260 caggcgaagg aagagcaggc agacacatct gaacaacatc atatttaa 1308 <210> 10 <211> 435 <212> PRT <213> Artificial Sequence[[ID=十九]] [[ID=二十]]<400> 10[[ID=二十一]] [[ID=二十二]]Met Ser Lys Lys Lys Val Asn Leu Gly Val Arg Asp Val Pro Thr Pro[[ID=二十三]] [[ID=二十四]]1 5 10 15[[ID=二十五]] [[ID=二十六]]Phe Ser Trp Val Ser Phe Ser Leu Gln His Leu Phe Ala Met Phe Gly[[ID=二十七]] [[ID=二十八]]20 25 30[[ID=二十九]] [[ID=三十]]Ser Thr Ile Leu Val Pro Lys Leu Val Gly Met Ser Pro Ala Val Ala[[ID=三十一]] [[ID=三十二]]35 40 45[[ID=三十三]] [[ID=三十四]]Leu Val Thr Ser Gly Ile Gly Thr Leu Ala Tyr Leu Leu Ile Thr Lys[[ID=三十五]] [[ID=三十六]]五十 五十五 六十 Gly Gln Ile Pro Ala Tyr Leu Gly Ser Ser Phe Ala Phe Ile Ser Pro 65 70 75 80 Ile Ile Leu Val Lys Ala Thr Gly Gly Pro Gly Ala Ala Met Val Gly 85 90 95 Ala Phe Leu Ala Gly Leu Val Tyr Gly Leu Ile Ala Leu Leu Ile Arg 100 105 110 Gln Leu Gly Thr Gly Trp Leu Met Lys Ile Leu Pro Pro Val Val Val 115 120 125 Gly Pro Val Ile Ile Val Ile Gly Leu Gly Leu Ala Ser Thr Ala Val 130 135 140 Asn Met Ala Met Tyr Ala Asp Pro Asn Ala Ser Glu Leu Val Tyr Ser 145 150 155 160 Leu Lys His Phe Ser Val Ala Gly Val Thr Leu Ala Ile Thr Ile Ile 165 170 175 Cys Ala Ile Phe Leu Arg Gly Phe Leu Ser Leu Ile Pro Val Leu Ile 180 185 190 Gly Ile Ile Gly Gly Tyr Leu Phe Ala Leu Thr Gln Gly Ile Val Asn 195 200 205 Phe Gln Pro Val Leu Asp Ala Lys Trp Phe Ala Val Pro Glu Phe Ile 210 215 220 Ile Pro Phe Lys Asp Tyr Ser Pro Ser Val Thr Leu Gly Ile Ala Ala 225 230 235 240 Ala Met Val Pro Val Ala Phe Val Thr Met Ser Glu His Ile Gly His 245 250 255 Gln Met Val Leu Ser Lys Val Val Gly Gln Asp Phe Ile Lys Lys Pro 260 265 270 Gly Leu His Arg Ser Ile Met Gly Asp Ser Ala Ala Thr Ile Leu Ala 275 280 285 Ser Leu Ile Gly Gly Pro Pro Thr Thr Thr Tyr Gly Glu Asn Ile Gly 290 295 300 Val Leu Ala Ile Thr Arg Val Phe Ser Val Phe Val Ile Gly Gly Ala 305 310 315 320 Ala Val Ile Ala Leu Cys Phe Gly Phe Ile Gly Lys Ile Ser Ala Leu 325 330 335 Ile Ser Ser Val Pro Ser Ala Val Met Gly Gly Val Ser Phe Leu Leu 340 345 350 Phe Gly Ile Ile Ala Ser Ser Gly Leu Arg Met Leu Ile Asp Asn Lys 355 360 365 Ile Asp Tyr Glu Asn Asn Arg Asn Leu Ile Ile Thr Ser Val Ile Leu 370 375 380 Val Ile Gly Val Gly Gly Ala Phe Ile Gln Val Ser Gln Gly Gly Phe 385 390 395 400 Gln Val Ser Gly Met Ala Leu Ala Ala Ile Val Gly Val Ile Leu Asn 405 410 415 Leu Ile Leu Pro Gln Ala Lys Glu Glu Gln Ala Asp Thr Ser Glu Gln 420 425 430 His His Ile 435 <210> 11 <211> 1308 <212> DNA <213> Artificial Sequence <400> 11 atgagtaaga aaaaagtaaa tttaggggtc agggatgtcc cgacaccttt ctcttgggtt 60 tcattcagcc ttcagcattt gtttgccatg tttggctcaa ccattttggt tccgaagctc 120 gtcggaatga gtcctgctgt ggcgttggtg acaagcggca tcggaacact ggcgtacctt 180 cttattacca aaggacaaat tccggcgtat ctcggttcat ccttcgcctt tatttctccg 240 atcattctgg taaaagcgac cggcgggccg ggagcggcaa tggttggagc gtttcttgca 300 gggctggtgt acgggctgat tgccttattg attaggcagc ttggaacagg atggctgatg 360 aagattctcc cgcctgtagt cgtagggcct gttattatcg tcatcgggct gggactggca 420 agcactgcag taaacatggc gatgtatgct gatccgaacg cgagtgagtt ggtctacagc 480 ttaaagcact ttagtgtcgc aggagttacg ctggcaatta cgattatttg tgcgattttc 540 ttacgagggt ttttaagcct gattccggtt ctgatcggaa tcatcggcgg atacctgttt 600 gcccttactc aagggattgt caacttccag ccggtgcttg acgcgaaatg gtttgcagtg 660 cctgaattta tcattccgtt caaagattat tcaccgtcag ttacgctcgg catcgcagcc 720 gcaatggttc ctgtcgcatt tgtcacaatg tcagagcata tcggccacca aatggtgctg 780 agcaaggttg tcggacaaga cttcattaaa aagccaggtc ttcatcgctc tattatgggt 840 gacagtgtgg cgacaatcct cgcttccctg atcggcggcc ctccgacaac gacttacgga 900 gaaaacattg gcgtgctggc catcacaaga gtattcagcg tctttgtcat cgggggcgcg 960 gcagtgattg ccctttgctt cggctttatc ggcaaaattt cagcgctgat cagttcagtg 1020 ccgtcagcgg tcatgggagg cgtctccttc ctgctgttcg gaatcattgc ttcaagcggc 1080 ctgagaatgc tgattgacaa caaaattgat tatgaaaaca acagaaacct cattattaca 1140 tcagttatcc ttgtcatcgg tgtaggaggc gcttttatcc aagtgtctca gggcggattc 1200 caagtgtcag gaatggcgct tgccgcaatt gtcggtgtca tcttaaacct gattcttccg 1260 caggcgaagg aagagcaggc agacacatct gaacaacatc atatttaa 1308 <210> 12 <211> 435 <212> PRT <213> Artificial Sequence <400> 12 Met Ser Lys Lys Lys Val Asn Leu Gly Val Arg Asp Val Pro Thr Pro 1 5 10 15 Phe Ser Trp Val Ser Phe Ser Leu Gln His Leu Phe Ala Met Phe Gly 20 25 30 Ser Thr Ile Leu Val Pro Lys Leu Val Gly Met Ser Pro Ala Val Ala 35 40 45 Leu Val Thr Ser Gly Ile Gly Thr Leu Ala Tyr Leu Leu Ile Thr Lys 50 55 60 Gly Gln Ile Pro Ala Tyr Leu Gly Ser Ser Phe Ala Phe Ile Ser Pro 65 70 75 80 Ile Ile Leu Val Lys Ala Thr Gly Gly Pro Gly Ala Ala Met Val Gly 85 90 95 Ala Phe Leu Ala Gly Leu Val Tyr Gly Leu Ile Ala Leu Leu Ile Arg 100 105 110 Gln Leu Gly Thr Gly Trp Leu Met Lys Ile Leu Pro Pro Val Val Val 115 120 125 Gly Pro Val Ile Ile Val Ile Gly Leu Gly Leu Ala Ser Thr Ala Val 130 135 140 Asn Met Ala Met Tyr Ala Asp Pro Asn Ala Ser Glu Leu Val Tyr Ser 145 150 155 160 Leu Lys His Phe Ser Val Ala Gly Val Thr Leu Ala Ile Thr Ile Ile 165 170 175 Cys Ala Ile Phe Leu Arg Gly Phe Leu Ser Leu Ile Pro Val Leu Ile 180 185 190 Gly Ile Ile Gly Gly Tyr Leu Phe Ala Leu Thr Gln Gly Ile Val Asn 195 200 205 Phe Gln Pro Val Leu Asp Ala Lys Trp Phe Ala Val Pro Glu Phe Ile 210 215 220 Ile Pro Phe Lys Asp Tyr Ser Pro Ser Val Thr Leu Gly Ile Ala Ala 225 230 235 240 Ala Met Val Pro Val Ala Phe Val Thr Met Ser Glu His Ile Gly His 245 250 255 Gln Met Val Leu Ser Lys Val Val Gly Gln Asp Phe Ile Lys Lys Pro 260 265 270 Gly Leu His Arg Ser Ile Met Gly Asp Ser Leu Ala Thr Ile Leu Ala 275 280 285 Ser Leu Ile Gly Gly Pro Pro Thr Thr Thr Tyr Gly Glu Asn Ile Gly 290 295 300 Val Leu Ala Ile Thr Arg Val Phe Ser Val Phe Val Ile Gly Gly Ala 305 310 315 320 Ala Val Ile Ala Leu Cys Phe Gly Phe Ile Gly Lys Ile Ser Ala Leu 325 330 335 Ile Ser Ser Val Pro Ser Ala Val Met Gly Gly Val Ser Phe Leu Leu 340 345 350 Phe Gly Ile Ile Ala Ser Ser Gly Leu Arg Met Leu Ile Asp Asn Lys 355 360 365 Ile Asp Tyr Glu Asn Asn Arg Asn Leu Ile Ile Thr Ser Val Ile Leu 370 375 380 Val Ile Gly Val Gly Gly Ala Phe Ile Gln Val Ser Gln Gly Gly Phe 385 390 395 400 Gln Val Ser Gly Met Ala Leu Ala Ala Ile Val Gly Val Ile Leu Asn 405 410 415 Leu Ile Leu Pro Gln Ala Lys Glu Glu Gln Ala Asp Thr Ser Glu Gln 420 425 430 His His Island 435

Claims

1. A method for constructing genetically engineered bacteria that produce nucleosides and nucleoside derivatives, characterized in that, The method is selected from any one of ① to ③: ① Using genetic engineering techniques, a mutation was introduced into the genome of a bacterium capable of nucleoside production, causing the 282nd amino acid of the L-threonine 3-dehydrogenase encoded by sequence number WP_003244880.1 to be mutated from V to E, A, or G; ② Using genetic engineering techniques, a mutation was introduced into the genome of a bacterium capable of nucleoside production, causing the amino acid at position 283 of the uracil permease encoded by sequence number WP_003221479.1 to be mutated from V to M, A, or L; ③ Using genetic engineering techniques, mutations were introduced into the genome of bacteria capable of nucleoside production, causing the 282nd amino acid of L-threonine 3-dehydrogenase encoded by WP_003244880.1 to be mutated from V to E, A, or G. At the same time, the 283rd amino acid of uracil permease encoded by WP_003221479.1 was mutated from V to M, A, or L. The bacteria is Bacillus subtilis (Bacillus subtilis) Bacillus subtilis ).

2. The method according to claim 1, characterized in that, The bacteria in question is Bacillus subtilis A1.

3. The genetically engineered bacteria constructed according to the method described in claim 1 or 2.

4. Any of the following applications of the genetically engineered bacteria according to claim 3: 1) Used for the fermentation production of nucleosides and nucleoside derivatives; 2) Used to increase the fermentation yield of nucleosides and nucleoside derivatives; in, The nucleoside is adenosine or inosine.