Preparation method and detection method of a hydrogel-based nucleic acid sensing platform
By anchoring an array of PEG hydrogel microspheres on a superhydrophobic substrate and combining it with graphene oxide, the problem of low detection efficiency in DNA fluorescence biosensors was solved, achieving high sensitivity and rapid DNA detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- UNIV OF SCI & TECH BEIJING
- Filing Date
- 2021-12-17
- Publication Date
- 2026-07-03
AI Technical Summary
Existing DNA fluorescence biosensors suffer from problems such as laborious and time-consuming sample pretreatment, low DNA recognition efficiency, and insufficient signal readout during the detection process, resulting in insufficient detection sensitivity.
A hydrogel-based nucleic acid sensing platform was adopted. A superhydrophobic substrate was prepared and modified with superhydrophilic sites to anchor a PEG hydrogel microsphere array. DNA detection was performed by combining it with graphene oxide. The microsphere array was formed by ultraviolet light irradiation, and DNA fluorescence detection was performed using a capture probe and graphene oxide.
It enables rapid and low-cost DNA detection, with a detection speed approximately 300 times faster than traditional methods. It features high sensitivity and good biocompatibility, and can rapidly concentrate reaction solutions and provide sensitive fluorescence signal readout.
Smart Images
Figure CN116265586B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of materials preparation and sensing technology, and relates to a preparation method and detection method of a hydrogel-based nucleic acid sensing platform. Background Technology
[0002] Deoxyribonucleic acid (DNA) is a crucial component of living organisms, responsible for storing genetic information. Abnormal expression of specific DNA sequences is associated with various human diseases, thus serving as valuable biomarkers in DNA diagnostics and gene analysis. In recent years, research on DNA-based biosensors has deepened, resulting in the development of various sensors, including DNA fluorescence biosensors, electrochemical biosensors, and SERS biosensors. Among these, DNA fluorescence biosensors play a unique role in biological and medical detection due to their advantages of continuous and rapid detection. However, improving the sensitivity of DNA detection presents specific technical challenges due to numerous drawbacks, such as laborious and time-consuming sample pretreatment, low DNA recognition efficiency, and insufficient signal readout. Therefore, developing a sensitive and universal biosensor for rapid monitoring of ultra-low amounts of DNA is imperative. Summary of the Invention
[0003] This invention discloses a method for preparing and detecting a hydrogel-based nucleic acid sensing platform to solve any of the above-mentioned and other potential problems in the prior art.
[0004] To solve the above-mentioned technical problems, the technical solution of the present invention is: a method for preparing a nucleic acid sensing platform based on hydrogel, the method specifically including the following steps:
[0005] S1) Preparation of superhydrophobic substrate;
[0006] S2) Superhydrophilic points were prepared by modifying the superhydrophobic substrate;
[0007] S3) The hydrogel is anchored on the superhydrophilic point obtained in S2), and after being irradiated with ultraviolet light, a PEG hydrogel microsphere array is generated.
[0008] S4) Mix the precursor mixture with the PEG hydrogel microsphere array obtained in S3) to obtain the hydrogel nucleic acid sensing platform (the steps in S1)-S4) must be strictly performed in sequence and cannot be substituted).
[0009] Furthermore, the specific steps of S1) are as follows:
[0010] S1.1) Dissolve tetraethyl orthosilicate in ethanol, mix with concentrated hydrochloric acid solution and stir for 3-5 hours, and age at room temperature for 4 days to obtain acid-catalyzed sol;
[0011] S1.2) Then disperse SiO2 in ethanol and stir for 1.5-3 hours, then add acid-catalyzed silica sol to obtain SiO2 suspension;
[0012] S1.3) The substrate is ultrasonically cleaned and dried. The substrate is then dipped in the SiO2 suspension obtained in S1.2) and then placed in the acid catalytic sol obtained in S1.1) for a certain period of time. After heating and curing, the superhydrophobic substrate is obtained.
[0013] Furthermore, the ratio of TEOS, ethanol, and concentrated hydrochloric acid solution in S1.1) is 1:520:4200;
[0014] In S1.2), the mass ratio of SiO2 to ethanol is 1:40;
[0015] In step S1.3), the SiO2 suspension spin coating is performed no less than 10 times, and the soaking time is 25-35 minutes.
[0016] Furthermore, the thermosetting process in S1.3) is as follows: after rinsing with anhydrous ethanol, it is heated and cured at 75-85°C for 15-25 minutes.
[0017] Furthermore, the specific process of S3 is as follows:
[0018] S3.1) Prepare a hydrogel prepolymer solution and drop the obtained hydrogel prepolymer solution into the superhydrophilic point;
[0019] S3.2) Irradiate with ultraviolet light at a wavelength of 365nm for 8-15s to form a PEG hydrogel microsphere array.
[0020] Furthermore, the hydrogel prepolymer solution in S3.1) comprises: polyethylene glycol, polyethylene glycol diacrylate, deionized water, acrylate-polyethylene glycol-carboxyl aqueous solution and 2-hydroxy-2-methyl-phenylacetone ethanol solution, with a volume ratio of 4:2:2:1:1.
[0021] Furthermore, the molecular weight of the polyethylene glycol is 200; the molecular weight of the polyethylene glycol diacrylate is 700; the concentration of the acrylate-polyethylene glycol-carboxyl aqueous solution is 20 mM, the molecular weight of the acrylate-polyethylene glycol-carboxyl solution is 3400; and the concentration of the 2-hydroxy-2-methyl-phenylacetone ethanol solution is 655 mM.
[0022] Furthermore, S4 specifically includes the following steps:
[0023] Add 1.5-2 μL of the precursor mixture to the hydrogel microspheres at room temperature and mix for 18-23 minutes to obtain the nucleic acid sensing platform of the hydrogel.
[0024] Furthermore, the precursor mixture contains a capture probe and graphene oxide, wherein the graphene oxide content is 80-100 mg / mL and the capture probe content is 100 nM / mL.
[0025] This invention also provides a nucleic acid sensing platform for DNA fluorescence detection using a hydrogel prepared by the above-described method, specifically comprising the following steps:
[0026] First, the target DNA is diluted and dissolved with Tris-HCl buffer. The dissolved DNA solution is then heated at 90-100℃ for 3-8 minutes and then gradually cooled to room temperature.
[0027] Then, target DNA solutions of different concentrations were added to the nucleic acid sensing platform of the hydrogel, and the fluorescence signal was detected by fluorescence microscopy and a fluorescence relationship curve was plotted to obtain the detection result.
[0028] The beneficial effects of this invention are as follows: This invention proposes a method for constructing a nucleic acid sensing platform based on hydrogel, which firmly anchors the hydrogel on a superhydrophobic-superhydrophilic platform. This hydrogel has advantages such as a dense surface structure, good biocompatibility, and high swelling ratio. It also has the advantage of absorbing water to concentrate the reaction solution without losing the solution phase environment, providing a sensitive and universal platform for the rapid concentration and enrichment of the reaction solution on its surface. This allows for rapid and low-cost detection of target DNA. The method of first preparing the superhydrophobic-superhydrophilic array and then dropping the prepolymer onto the hydrophilic points is more convenient, avoids wasting the hydrogel prepolymer, and the detection speed is approximately 300 times faster than traditional solution-phase detection methods. Attached image description:
[0029] Figure 1 This is a schematic diagram illustrating the preparation method of a hydrogel-based nucleic acid sensing platform according to the present invention.
[0030] Figure 2 This is a schematic diagram of a hydrogel array on a superhydrophobic hydrophilic substrate.
[0031] Figure 3 To test the stability of the hydrogel anchored on the superhydrophobic substrate: (a) is a water-rinsing experiment of the hydrogel array; (b) is a contact angle image of the hydrogel and the superhydrophobic substrate (i) WCA=0° (ii) WCA=154.7±2.1°; (c) is a scanning electron microscope surface image of the hydrogel; (d) is a scanning electron microscope cross-sectional image of the hydrogel.
[0032] Figure 4 Characterization of the morphology and wettability of the superhydrophobic hydrophilic substrate and hydrogel: (a) is a water-washing hydrogel array experiment; (b) is a hydrogel inversion experiment fixed on the superhydrophobic substrate.
[0033] Figure 5 The optimization of DNA reaction conditions on the hydrogel surface is as follows: (a) is a schematic diagram of the reaction on the hydrogel surface; (b) is an electrophoresis diagram of the DNA reaction; (c) is the optimal concentration selection for FAM-DNA quenching with graphene oxide (scale bar: 500 μm); (d) is the optimal time selection for DNA quenching with graphene oxide (scale bar: 500 μm).
[0034] Figure 6 The sensor performance analysis includes: (a) a magnified view of the fluorescence recovery time of FAM-DNA on the hydrogel surface (scale bar: 500 μm); (b) a comparison of the fluorescence recovery intensity of different concentrations of target DNA; and (c) an analysis of the detection specificity of the nucleic acid sensor. Detailed implementation method:
[0035] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0036] like Figure 1 As shown, the present invention discloses a method for preparing a hydrogel-based nucleic acid sensing platform, the method specifically comprising the following steps:
[0037] S1) Preparation of superhydrophobic substrate;
[0038] S2) Superhydrophilic points were prepared by modifying the superhydrophobic substrate;
[0039] S3) The hydrogel is anchored on the superhydrophilic point obtained in S2), and after being irradiated with ultraviolet light, a PEG hydrogel microsphere array is generated.
[0040] S4) Mix the precursor mixture with the PEG hydrogel microsphere array obtained in S3) to obtain the hydrogel nucleic acid sensing platform (S1)-S4) must be performed in sequence and cannot be substituted.
[0041] The specific steps of S1 are as follows:
[0042] S1.1) Dissolve tetraethyl orthosilicate in ethanol, mix with concentrated hydrochloric acid solution and stir for 3-5 hours, and age at room temperature for 4 days to obtain acid-catalyzed sol;
[0043] S1.2) Then disperse SiO2 in ethanol and stir for 1.5-3 hours, then add acid-catalyzed silica sol to obtain SiO2 suspension;
[0044] S1.3) The substrate is ultrasonically cleaned and dried. The substrate is then dipped in the SiO2 suspension obtained in S1.2) and then placed in the acid catalytic sol obtained in S1.1) for a certain period of time. After heating and curing, the superhydrophobic substrate is obtained.
[0045] The ratio of TEOS, ethanol, and concentrated hydrochloric acid solution in S1.1) is 1: 520: 4200;
[0046] In S1.2), the mass ratio of SiO2 to ethanol is 1:40;
[0047] In step S1.3), the SiO2 suspension spin coating is performed no less than 10 times, and the soaking time is 25-35 minutes.
[0048] The thermosetting process in S1.3) is as follows: after rinsing with anhydrous ethanol, heat and cure at 75-85℃ for 15-25 minutes.
[0049] The specific process of S3 is as follows:
[0050] S3.1) Prepare a hydrogel prepolymer solution and drop the obtained hydrogel prepolymer solution into the superhydrophilic point;
[0051] S3.2) Irradiate with ultraviolet light at a wavelength of 365nm for 8-15s to form a PEG hydrogel microsphere array.
[0052] The hydrogel prepolymer solution in S3.1) includes: polyethylene glycol, polyethylene glycol diacrylate, deionized water, acrylate-polyethylene glycol-carboxyl aqueous solution and 2-hydroxy-2-methyl-phenylacetone ethanol solution, with a volume ratio of 4:2:2:1:1.
[0053] The polyethylene glycol has a molecular weight of 200; the polyethylene glycol diacrylate has a molecular weight of 700; the acrylate-polyethylene glycol-carboxyl aqueous solution has a concentration of 20 mM; the acrylate-polyethylene glycol-carboxyl aqueous solution has a molecular weight of 3400; and the 2-hydroxy-2-methyl-phenylacetone ethanol solution has a concentration of 655 mM.
[0054] S4 specifically includes the following steps:
[0055] Add 1.5-2 μL of the precursor mixture to the hydrogel microspheres at room temperature and mix for 18-23 minutes to obtain the nucleic acid sensing platform of the hydrogel.
[0056] The precursor mixture contains a capture probe and graphene oxide, wherein the graphene oxide content is 80-100 mg / mL and the capture probe content is 100 nM / mL.
[0057] A nucleic acid sensing platform for DNA fluorescence detection using a hydrogel prepared by the above method includes the following steps:
[0058] First, the target DNA is diluted and dissolved with Tris-HCl buffer. The dissolved DNA solution is then heated at 90-100℃ for 3-8 minutes and then gradually cooled to room temperature.
[0059] Then, target DNA solutions of different concentrations were added to the nucleic acid sensing platform of the hydrogel, and the fluorescence signal was detected by fluorescence microscopy and a fluorescence relationship curve was plotted to obtain the detection result.
[0060] Example 1
[0061] 6.5 g of tetraethyl orthosilicate (TEOS) was dissolved in 53.25 g of ethanol and mixed with 0.0125 g of concentrated HCl solution to prepare an acid-catalyzed silica sol. The solution was left in a sealed flask, stirred for 4 hours, and aged at room temperature for 4 days. 2 g of SiO2 was dispersed in 80 mL of ethanol and stirred for 2 hours. Then, 20 μL of acid-catalyzed silica sol (ASCC) was added to the mixed solution, and the mixture was stirred for another 1 hour to obtain a SiO2 suspension. The glass slide was ultrasonically cleaned successively in acetone, ethanol, and deionized water, and then dried with nitrogen. After plasma treatment, the glass was repeatedly dipped into the above SiO2 suspension coating 10 times. The glass was then immersed in a 1H,1H,2H,2H-perfluorodecyltrichlorosilane (FDTS) solution (FDTS: anhydrous toluene = 1:1000) at room temperature for 30 minutes, rinsed with ethanol, and cured at 80°C for 20 minutes. FDTS-modified superhydrophobic substrates are treated with oxygen plasma through a photomask for 30 seconds to form superwetting microchips, such as... Figure 2 As shown.
[0062] The hydrogel prepolymer solution comprises: polyethylene glycol, polyethylene glycol diacrylate, deionized water, acrylate-polyethylene glycol-carboxyl aqueous solution, and 2-hydroxy-2-methyl-phenylacetone ethanol solution, with a volume ratio of 4:2:2:1:1; the molecular weight of polyethylene glycol is 200; the molecular weight of polyethylene glycol diacrylate is 700; the concentration of the acrylate-polyethylene glycol-carboxyl aqueous solution is 20 mM, the molecular weight of the acrylate-polyethylene glycol-carboxyl solution is 3400; and the concentration of the 2-hydroxy-2-methyl-phenylacetone ethanol solution is 655 mM.
[0063] Add 2 μL of the above hydrogel prepolymer to the superhydrophilic point. The entire platform is then cooled using 365 nm UV (60 mW / cm²). 2 Irradiation for 10 seconds forms a PEG hydrogel microsphere array. The prepared hydrogel array is kept in deionized water or a high-humidity environment until use (e.g., Figure 3 (As shown).
[0064] Hydrogel arrays prepared by rinsing with water were found to be firmly fixed on a superhydrophobic-superhydrophilic substrate, demonstrating the robustness of the hydrogel arrays. (e.g.) Figure 4 (As shown)
[0065] A capture probe (TAACG TGTGT TTGCA CTATG CTTTC A-FAM) was simultaneously loaded onto the hydrogel surface along with graphene oxide. Graphene oxide has proven to be one of the best choices for label-free quenchers in constructing bioelectronic devices and advanced biosensors due to its large surface area, physiological stability, and the ability to quench fluorescence via remote FRET. Single-stranded DNA interacts with graphene oxide through π-π stacking interactions, while double-stranded DNA is readily detached from the graphene oxide surface. FAM-labeled single-stranded DNA (FAM-DNA) was drop-added onto the hydrogel along with graphene oxide to serve as a detection platform. By selecting single-stranded DNA as the target probe, it hybridizes with FAM-DNA to form a double-stranded FAM-DNA / target DNA structure. The sequence of the target probe is AATATTGAAAGCAGATTGCAAAACCAAGTAGCGGGTGGGTGGGT GGG. Simultaneously, the degree of fluorescence quenching with increasing graphene oxide concentration and real-time data of fluorescence quenching were measured. The results showed that the best quenching results were achieved at a graphene oxide concentration of 80 μg / mL, and the maximum quenching value was reached at a quenching time of 20 minutes. Figure 5 (As shown). Fluorescence signals were detected using a fluorescence microscope, and fluorescence curves were plotted. All DNA strands were purchased from Sangon Biotech Co., Ltd.
[0066] When no target probe is present on the platform, FAM-DNA adsorbs onto graphene oxide, causing fluorescence quenching. Upon addition of the target probe, the formed double strand detaches from the graphene oxide, and fluorescence rapidly recovers. The feasibility of the DNA detection platform was validated by fluorescence responses of target DNA at different concentrations (50, 75, 100, 150, 200, 300, 400 nM) and for single-base mismatched target DNA (MT1), two-base mismatched target DNA (MT2), and three-base mismatched target DNA (MT3). Fluorescence intensity increased linearly with target DNA concentration from 50 nM to 400 nM, with a logarithmic increase in fluorescence recovery intensity. Simultaneously, compared to target DNA (T), MT1, MT2, and MT3 showed lower fluorescence responses at the same concentration. These results indicate that the sensor has good specificity for detecting target DNA. (e.g.) Figure 6 (As shown)
[0067] Example 2
[0068] Two substrates each of conductive glass and ordinary glass were used, and each substrate underwent the same treatment. The glass slides were ultrasonically cleaned sequentially in acetone, ethanol, and deionized water, and then dried with nitrogen. After plasma treatment, the glass was repeatedly dipped into the SiO2 suspension coating 10 times. The glass was then immersed in an FDTS solution (FDTS: anhydrous toluene = 1:1000) at room temperature for 30 minutes, rinsed with ethanol, and cured at 80°C for 20 minutes. The FDTS-modified superhydrophobic substrate was then treated with oxygen plasma through a photomask for 30 seconds to form a superwetting microchip.
[0069] The hydrogel prepolymer solution comprises: polyethylene glycol, polyethylene glycol diacrylate, deionized water, an aqueous solution of acrylate-polyethylene glycol-carboxyl groups, and an ethanol solution of 2-hydroxy-2-methyl-phenylacetone, with a volume ratio of 4:2:2:1:1. The molecular weight of polyethylene glycol is 200; the molecular weight of polyethylene glycol diacrylate is 700; the concentration of the acrylate-polyethylene glycol-carboxyl group aqueous solution is 20 mM, and the molecular weight of the acrylate-polyethylene glycol-carboxyl group is 3400; the concentration of the 2-hydroxy-2-methyl-phenylacetone ethanol solution is 655 mM. 2 μL of the above hydrogel prepolymer solution is added to the superhydrophilic point. The entire platform is tested using 365 nm UV (60 mW / cm²). 2 Irradiation for 10 seconds forms a PEG hydrogel microsphere array. The prepared hydrogel array is kept in deionized water or a high-humidity environment until use (e.g., Figure 3 (As shown).
[0070] Hydrogel arrays prepared by rinsing with water were found to be firmly fixed on a superhydrophobic-superhydrophilic substrate, demonstrating the robustness of the hydrogel arrays. (e.g.) Figure 4As shown, the capture probe FAM-DNA (TAACG TGTGT TTGCA CTATGCTTTC A-FAM) was simultaneously loaded onto the hydrogel surface along with graphene oxide. Graphene oxide has proven to be one of the best choices for label-free quenchers in constructing bioelectronic devices and advanced biosensors due to its large surface area, physiological stability, and the advantage of quenching fluorescence via remote FRET. Single-stranded DNA interacts with graphene oxide through π-π stacking interactions, while double-stranded DNA is readily detached from the graphene oxide surface. FAM-labeled single-stranded DNA (FAM-DNA) was loaded onto the hydrogel along with graphene oxide as a pristine platform. By selecting single-stranded DNA as the target probe, hybridization with FAM-DNA can form a double-stranded FAM-DNA / target DNA structure. The sequence of the target probe is AATATTGAAAGCAGATTGCAAAACCAAGTAGCGGGTGGGTGGGGG. Simultaneously, the degree of fluorescence quenching with increasing graphene oxide concentration and real-time data of fluorescence quenching were measured. The results showed that the best quenching results were achieved at a graphene oxide concentration of 80 μg / mL, and the maximum quenching value was reached at a quenching time of 20 minutes. Figure 5 (As shown). Fluorescence signals were detected using a fluorescence microscope, and fluorescence curves were plotted. All DNA strands were purchased from Sangon Biotech Co., Ltd.
[0071] When no target probe is present on the platform, FAM-DNA adsorbs onto graphene oxide, causing fluorescence quenching. Upon addition of the target probe, the formed double strand detaches from the graphene oxide, and fluorescence rapidly recovers. The feasibility of the DNA detection platform was validated by fluorescence responses of target DNA at different concentrations (50, 75, 100, 150, 200, 300, 400 nM) and for single-base mismatched target DNA (MT1), two-base mismatched target DNA (MT2), and three-base mismatched target DNA (MT3). Fluorescence intensity increased linearly with target DNA concentration from 50 nM to 400 nM, with a logarithmic increase in fluorescence recovery intensity. Simultaneously, compared to target DNA (T), MT1, MT2, and MT3 showed lower fluorescence responses at the same concentration. These results indicate that the sensor has good specificity for detecting target DNA. (e.g.) Figure 6 (As shown)
[0072] The preparation and detection methods of a hydrogel-based nucleic acid sensing platform provided in the embodiments of this application have been described in detail above. The descriptions of the embodiments above are only for the purpose of helping to understand the methods and core ideas of this application; at the same time, those skilled in the art will recognize that, based on the ideas of this application, there will be changes in the specific implementation methods and application scope. Therefore, the content of this specification should not be construed as a limitation of this application.
[0073] Certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that hardware manufacturers may use different names to refer to the same component. This specification and claims do not distinguish components based on differences in name, but rather on differences in function. The terms "comprising" and "including" used throughout the specification and claims are open-ended and should be interpreted as "comprising / including but not limited to". "Approximately" means that within an acceptable margin of error, those skilled in the art can solve the technical problem and substantially achieve the technical effect within a certain margin of error. The following descriptions in the specification are preferred embodiments for carrying out this application; however, these descriptions are for the purpose of illustrating the general principles of this application and are not intended to limit the scope of this application. The scope of protection of this application shall be determined by the appended claims.
[0074] It should also be noted that the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a product or system comprising a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a product or system. Without further limitation, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the product or system that includes said element.
[0075] It should be understood that the term "and / or" used in this article is merely a description of the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, and B existing alone. Additionally, the character " / " in this article generally indicates that the preceding and following related objects have an "or" relationship.
[0076] The foregoing description illustrates and describes several preferred embodiments of this application. However, as previously stated, it should be understood that this application is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the application concept described herein through the foregoing teachings or techniques or knowledge in related fields. Any modifications and variations made by those skilled in the art that do not depart from the spirit and scope of this application should be within the protection scope of the appended claims.
Claims
1. A method for preparing a hydrogel-based nucleic acid sensing platform, characterized in that, The method specifically includes the following steps: S1) preparing a superhydrophobic substrate; the specific steps are: S1.1) dissolving tetraethyl orthosilicate in ethanol, mixing and stirring with concentrated hydrochloric acid solution for 3-5 hours, and aging at room temperature for 4 days to obtain an acid-catalyzed sol; the ratio of tetraethyl orthosilicate, ethanol and concentrated hydrochloric acid solution is 1:520:4200; S1.2) Then disperse SiO2 in ethanol and stir for 1.5-3 hours, then add acid-catalyzed silica sol to obtain SiO2 suspension; the mass ratio of SiO2 to ethanol is 1:
40. S1.3) The substrate is ultrasonically cleaned and dried. The substrate is then dip-coated with the SiO2 suspension obtained in S1.2), and then placed in a 1H,1H,2H,2H-perfluorodecyltrichlorosilane solution for 25-35 minutes for modification. After heating and curing, a superhydrophobic substrate is obtained. The SiO2 suspension spin coating is repeated no less than 10 times. S2) Superhydrophilic points were prepared by modifying a superhydrophobic substrate; S3) Anchor the hydrogel to the superhydrophilic point obtained in S2), and after ultraviolet light irradiation, a polyethylene glycol hydrogel microsphere array is generated; the specific process is as follows: S3.1) Prepare the hydrogel prepolymer solution and drop the obtained hydrogel prepolymer solution into the superhydrophilic point; The hydrogel prepolymer solution comprises: polyethylene glycol, polyethylene glycol diacrylate, deionized water, acrylate-polyethylene glycol-carboxyl aqueous solution and 2-hydroxy-2-methyl-phenylacetone ethanol solution, with a volume ratio of 4:2:2:1:
1. S3.2) Place it under ultraviolet light with a wavelength of 365nm for 8-15s to form a polyethylene glycol hydrogel microsphere array; S4) The precursor mixture is mixed with the polyethylene glycol hydrogel microsphere array obtained in S3) to obtain a hydrogel nucleic acid sensing platform; the precursor mixture contains a capture probe and graphene oxide, wherein the graphene oxide content is 80-100 mg / mL and the capture probe content is 100 nM / mL.
2. The method according to claim 1, characterized in that, The thermosetting process in S1.3) is as follows: after rinsing with anhydrous ethanol, heat and cure at 75-85℃ for 15-25 minutes.
3. The method according to claim 1, characterized in that, The polyethylene glycol has a molecular weight of 200; the polyethylene glycol diacrylate has a molecular weight of 700; the acrylate-polyethylene glycol-carboxyl aqueous solution has a concentration of 20 mM; the acrylate-polyethylene glycol-carboxyl aqueous solution has a molecular weight of 3400; and the 2-hydroxy-2-methyl-phenylacetone ethanol solution has a concentration of 655 mM.
4. The method according to claim 1, characterized in that, The specific steps of S4 include: adding 1.5-2 μL of the precursor mixture to the hydrogel microspheres at room temperature and mixing for 18-23 minutes to obtain the nucleic acid sensing platform of the hydrogel.