Application of Aspergillus niger in promoting phosphorus release from phosphate rock and promoting straw degradation

Abstract

The present invention relates to the field of microbial technology, in particular to the application of Aspergillus niger in promoting the release of phosphorus in phosphate rock and promoting straw degradation. The Aspergillus niger provided by the present invention is preserved in the China General Microbiological Culture Collection Center, with the preservation number of CGMCC No. 23272. The Aspergillus niger provided by the present invention can secrete a large amount of H2C2O4, and promote the dissolution of phosphorus in phosphate rock by acidifying the medium. It can not only promote the release of phosphorus in high-grade phosphate rock raw ore with high phosphorus content, but also promote the release of phosphorus in low-grade phosphate rock raw ore with a phosphorus content of 0.4 wt.% and phosphorus tailings with a phosphorus content of 2% - 9%. Thereby improving the utilization rate of phosphorus tailings, reducing the environmental pollution caused by phosphorus tailings, and realizing the efficient utilization of phosphorus tailings.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and particularly to the application of Aspergillus niger in promoting the release of phosphorus in phosphate rock and promoting straw degradation. Background Art

[0002] Phosphorus is an important component of the cell nucleus of organisms and is an essential basic substance for all organisms. The average content of total phosphorus in soil is about 0.05%, and it can be divided into two types according to its storage form in soil: inorganic phosphorus and organic phosphorus. In most soils, inorganic phosphorus content dominates, accounting for 50% - 90% of the total phosphorus. Almost all of the inorganic phosphorus compounds in soil are orthophosphates, and the vast majority exist in soil in the form of adsorbed state and various solid mineral forms, among which the content of available inorganic phosphorus is very small, generally not exceeding 5% of the total soil phosphorus. The phosphorus forms that can be directly absorbed and utilized by plants are mainly HPO4 2- and H2PO 4- which are known as "available phosphorus". Since their chemical concentration in the soil solution is very low, generally only 1.5 μM, far from being able to fully meet the requirements of normal plant growth and development, therefore, in many soils, phosphorus is a major factor limiting the normal growth and development of plants.

[0003] China is a large country of phosphorus resources, and the reserves of phosphate rock resources rank second in the world. There are more impurities in medium and low-grade phosphate rocks, and a large amount of by-products will be generated during the mining process of phosphate rock. Phosphorus tailings are by-products discharged after phosphate rock processing and production, containing about 7 wt.% phosphorus. At present, the utilization rate of phosphorus tailings is relatively low, and the total amount of their stockpiles is large. Long-term stacking not only causes waste of resources, but also brings environmental pollution. Summary of the Invention

[0004] In order to solve the above problems, the present invention provides the application of Aspergillus niger in promoting the release of phosphorus in phosphate rock and promoting straw degradation. The Aspergillus niger provided by the present invention can promote the release of phosphorus in phosphorus tailings, improve the utilization rate of phosphorus tailings, reduce the environmental pollution caused by phosphorus tailings, and realize the efficient utilization of phosphorus tailings.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides the application of Aspergillus niger in promoting the release of phosphorus in phosphate rock, and the Aspergillus niger is preserved in the China General Microbiological Culture Collection Center with the preservation number of CGMCC No. 23272.

[0007] The present invention also provides the application of Aspergillus niger combined with phosphate rock in promoting straw degradation. The Aspergillus niger is preserved in the China General Microbiological Culture Collection Center with the preservation number CGMCC No. 23272.

[0008] Preferably, the phosphate rock includes phosphate rock with a P2O5 content ≥ 0.4 wt.%.

[0009] Preferably, the phosphate rock includes phosphate rock with a P2O5 content ≥ 7 wt.%.

[0010] Preferably, the straw includes wheat straw and / or corn straw.

[0011] The present invention also provides a method for promoting straw degradation, which includes the following steps:

[0012] Mix the Aspergillus niger agent, phosphate rock and straw to obtain a mixture containing degraded straw; the Aspergillus niger is preserved in the China General Microbiological Culture Collection Center with the preservation number CGMCC No. 23272.

[0013] Preferably, the spore concentration of Aspergillus niger in the Aspergillus niger agent is 1×10 7 ~9×10 7 CFU / mL.

[0014] Preferably, the dosage ratio of the Aspergillus niger agent, phosphate rock and straw is 1 - 2 mL: 0.5 - 1 g: 0.5 - 1 g.

[0015] Preferably, the phosphate rock includes phosphate rock with a P2O5 content ≥ 0.4 wt.%.

[0016] Preferably, the straw includes wheat straw and / or corn straw.

[0017] Beneficial effects:

[0018] The present invention provides the application of Aspergillus niger in promoting the release of phosphorus in phosphate rock. The Aspergillus niger is preserved in the China General Microbiological Culture Collection Center with the preservation number CGMCC No. 23272. The Aspergillus niger provided by the present invention can secrete a large amount of H2C2O4, promote the dissolution of phosphorus in phosphate rock by acidifying the medium, and can not only promote the release of phosphorus in high-grade phosphate rock raw ore with high phosphorus content, but also promote the release of phosphorus in low-grade phosphate rock raw ore with a phosphorus content of 0.4 wt.% and phosphorus tailings with a phosphorus content of 2% - 9%. Thus, the utilization rate of phosphorus tailings is improved, the environmental pollution caused by phosphorus tailings is reduced, and the efficient utilization of phosphorus tailings is realized.

[0019] Biological preservation description

[0020] Aspergillus niger, with the Latin name Aspergillus niger, was deposited at the China General Microbiological Culture Collection Center on September 30, 2021. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC No. 23272. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0022] Figure 1 It is the colony map and microscope image of Aspergillus niger provided by the present invention;

[0023] Figure 2 It is the phylogenetic tree analysis diagram of Aspergillus niger provided by the present invention;

[0024] Figure 3 It is the phosphorus concentration results of each treatment after 7 days of cultivation in Example 2;

[0025] Figure 4 It is the phosphorus concentration results of each treatment after 7 days of cultivation in Example 3;

[0026] Figure 5 It is the straw degradation rate results of each treatment after 7 days of cultivation in Example 3;

[0027] Figure 6 It is the measurement results of different parameters of different treatment groups in Example 4. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0028] The present invention provides the application of Aspergillus niger in promoting the release of phosphorus in phosphate rock. The Aspergillus niger is deposited at the China General Microbiological Culture Collection Center, and the deposit number is CGMCC No. 23272. The Aspergillus niger of the present invention can secrete a large amount of H2C2O4. By mixing Aspergillus niger and phosphate rock, the phosphorus in the phosphate rock can be released by the phosphorus solubilization effect, which can not only promote the release of phosphorus in high-grade phosphate rock raw ore with high phosphorus content, but also promote the release of phosphorus in low-grade phosphate rock raw ore with a phosphorus content of 0.4 wt.% and phosphorus tailings with a phosphorus content of 2% - 9%.

[0029] The present invention also provides the application of Aspergillus niger combined with phosphate rock in promoting straw degradation. The Aspergillus niger is deposited at the China General Microbiological Culture Collection Center, and the deposit number is CGMCC No. 23272.

[0030] The colony of Aspergillus niger in the present invention is carbon black, flat, granular on the colony surface, with concentric ring patterns; the cell wall is smooth, the vesicle is spherical, and the conidial chain is in a tightly elliptical shape (see Figure 1 ).

[0031] In the present invention, the ITS sequence of Aspergillus niger is preferably as shown in SEQ ID NO.1.

[0032] In the present invention, the phosphate rock preferably includes phosphate rock with a P2O5 content ≥ 0.4 wt.%, more preferably phosphate rock with a P2O5 content ≥ 7 wt.%, still more preferably phosphate rock with a P2O5 content of 7 - 9 wt.%, and most preferably phosphate rock with a P2O5 content of 7 wt.%.

[0033] In the present invention, the straw preferably includes wheat straw and / or corn straw.

[0034] Aspergillus niger in the present invention can secrete cellulase, hemicellulase, etc., which can promote the degradation of components such as cellulose and hemicellulose in straw and the release of phosphorus. It can be seen from the examples that after being cultured in PVK medium for 20 days, the total organic acid secretion amount of Aspergillus niger is 5214.85 mg / L, among which the oxalic acid (OA) secretion amount is 1448.96 mg / L and the citric acid (CA) secretion amount is 1158.46 mg / L; after being cultured in PVK medium for 30 days, the degradation rate of Aspergillus niger to wheat straw reaches 29.85%, and the enzyme activities of cellulase (CL) and lignin peroxidase (LP) are 6916.54 nmol / min / mg and 5839.80 U / g respectively.

[0035] Therefore, Aspergillus niger in the present invention can be used in multiple ways, giving full play to the maximum efficiency of the strain. On the one hand, it can promote the dissolution of phosphorus in phosphate rock and the activation of soil phosphorus, promote crop growth, increase crop yield, and achieve the resource utilization of phosphorus-containing solid waste and the improvement of the ecological environment; on the other hand, it can accelerate cellulose degradation, promote the decomposition of straw, and vigorously promote straw returning to the field, having the potential to be used as a functional microbial fertilizer and contributing to the promotion of green agricultural development.

[0036] The present invention also provides a method for promoting straw degradation, including the following steps:

[0037] Mix Aspergillus niger inoculant, phosphate rock and straw to obtain a mixture containing degraded straw; the Aspergillus niger is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No.23272.

[0038] The preparation method of the Aspergillus niger inoculant in the present invention preferably includes the following steps:

[0039] Inoculate the Aspergillus niger strain on a potato dextrose agar medium (PDA) and culture it at 28°C for 5 days to obtain spores.

[0040] Dilute the spores with 0.85 wt.% sterile saline to obtain the Aspergillus niger agent.

[0041] In the present invention, the spore concentration of Aspergillus niger in the Aspergillus niger agent is preferably 1×10 7 ~9×10 7 CFU / mL, more preferably 1×10 7 CFU / mL.

[0042] In the present invention, the dosage ratio of the Aspergillus niger agent, phosphate rock and straw is preferably 1 - 2 mL: 0.5 - 1 g: 0.5 - 1 g, more preferably 1 mL: 0.5 g: 0.5 g.

[0043] In the present invention, the phosphate rock preferably includes phosphate rock with a P2O5 content ≥ 0.4 wt.%, further preferably phosphate rock with a P2O5 content ≥ 7 wt.%, more preferably phosphate rock with a P2O5 content of 7 - 9 wt.%, and most preferably phosphate rock with a P2O5 content of 7 wt.%.

[0044] In the present invention, the straw preferably includes wheat straw and / or corn straw.

[0045] The present invention combines the Aspergillus niger agent and phosphate rock, which can significantly improve the degradation rate of straw compared with using only the Aspergillus niger agent. This is mainly because the phosphate rock can stimulate or induce Aspergillus niger to secrete more organic acids (such as oxalic acid) to obtain phosphorus. On the one hand, the released phosphorus can promote the growth of Aspergillus niger. On the other hand, the increase in oxalic acid secreted by Aspergillus niger can accelerate the degradation in the straw, destroy its structure, thereby promoting the straw returning efficiency to the field, reducing environmental pollution, and achieving increased crop yields.

[0046] To further illustrate the present invention, the application of Aspergillus niger provided by the present invention in promoting the release of phosphorus in phosphate rock and promoting straw degradation will be described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0047] Example 1

[0048] 1. Reagent preparation:

[0049] Meng Jinna (PVK) medium: 10 g of glucose, 0.5 g of ammonium sulfate, 0.2 g of sodium chloride, 0.25 g of magnesium sulfate heptahydrate, 0.03 g of ferric sulfate heptahydrate, 0.2 g of potassium chloride, and 0.03 g of manganese sulfate tetrahydrate, made up to 1000 mL with deionized water, and the pH value is 7.0.

[0050] PDA medium: Wash fresh potatoes, peel them, weigh 200 g, cut them into small pieces, boil them until soft for 30 min, filter with eight layers of gauze, add 20 g of glucose and 20 g of agar powder while it is still hot, stir well. After the medium cools down, add deionized water to make up to 1000 mL, and the pH value is 7.0.

[0051] PDB medium: Wash fresh potatoes, peel them, weigh 200 g, cut them into small pieces, boil them until soft for 30 min, filter with eight layers of gauze, add 20 g of glucose while it is still hot, stir well. After the medium cools down, add deionized water to make up to 1000 mL, and the pH value is 7.0.

[0052] 2. Strain screening

[0053] Weigh 10 g of soil sample from the wheat soil in northern Anhui, inoculate it into 90 mL of sterile water, shake it on a shaker at 28 °C and 180 rpm for 30 min. In a sterile operation bench, take the supernatant and dilute it successively by 10 -3 、10 -4 、10 -5 、10 -6 . Take 0.1 ml of the diluted supernatant and spread it on the PVK plate. The PVK plate is added with tricalcium phosphate (concentration: 0.5 g / 1000 ml PVK) as the insoluble phosphorus source; conduct 3 parallel repeated experiments for each concentration, culture at 28 °C for 3 - 5 d, pick the single colonies with obvious phosphorus dissolution circles, and streak-culture them on the PDA solid medium. Through the above screening, a strain that can degrade insoluble phosphate is obtained, named AH-F-1-2.

[0054] 3. Identification of the strain

[0055] Culture the AH-F-1-2 strain on the PDA solid medium at 28 °C, and observe the colony morphology and microscopic characteristics. The colony structure is as Figure 1As shown, the colony is charcoal black, flat, granular on the colony surface, with concentric ring patterns; the cell wall is smooth, the vesicle is spherical, and the conidial chain is a tightly packed ellipse. Under sterile conditions, genomic DNA was extracted using a fungal DNA extraction kit. After the extraction product was amplified by PCR, it was detected by agarose gel electrophoresis. The gel product was cut, recovered, purified, and then sequenced. The sequencing result was as follows: The ITS sequence of strain AH-F-1-2 is shown in SEQ ID NO.1: 5’-GCCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGNACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA-3’;

[0056] The PCR amplification primers are ITS1 and ITS4; the sequence of ITS1 is shown in SEQ ID NO.2: 5’-TCCGTAGGTGAACCTGCGG-3’; the sequence of ITS4 is shown in SEQ ID NO.3: 5’-TCCTCCGCTTATTGATATGC-3’.

[0057] PCR amplification system (25 μl): 12.5 μl PCR MasterMix, 1.0 μl ITS1, 1.0 μl ITS4, 2 μl DNA fragment, and 8.5 μl dH2O.

[0058] PCR reaction procedure: pre-denaturation at 95°C for 5 min; one cycle consists of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 90 s, with 35 cycles in total; extension at 72°C for 5 min, and incubation at 4°C for 30 min.

[0059] In the GenBank database, the ITS sequence of strain AH-F-1-2 was retrieved using BLAST. It was found to have a high homology with Penicillium chrysogenum. Strains with a homology higher than 99% were selected for phylogenetic tree construction. The results showed that strain AH-F-1-2 clustered with Aspergillus niger in the same branch and was identified as Aspergillus niger (as Figure 2 shown).

[0060] The AH-F-1-2 strain screened and obtained in the present invention was identified as Aspergillus niger and taxonomically named Aspergillus niger. The strain was deposited at the China General Microbiological Culture Collection Center on September 30, 2021. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC No. 23272.

[0061] Example 2

[0062] Aspergillus niger secretes oxalic acid to promote the release of phosphorus in phosphate rock

[0063] Preparation of spore suspension

[0064] Under the condition of 28°C, the Aspergillus niger strain preserved in Example 1 was cultured in a potato dextrose agar medium (PDA) in an incubator for 5 days to obtain spores. Then, in a sterile operation table, it was washed with sterile water, and the fungal spores were carefully scraped off with a sterile inoculation loop to obtain a spore suspension. Finally, the spore suspension was filtered through three layers of gauze to remove broken hyphal fragments, and the spore concentration was measured with a hemocytometer. The spore concentration was diluted to 10 7 CFU / mL.

[0065] Treatment of phosphate rock samples

[0066] After the phosphate rock was collected, it was first subjected to crushing treatment, ground into powder by a ball mill, and passed through an 80-mesh sieve for storage for later use.

[0067] Eight groups of treatments were set up in the experiment, namely phosphate tailings with 2% P2O5 (HPT), phosphate tailings with 7% P2O5 (NPT), phosphate tailings with 8% P2O5 (DPT), phosphate tailings with 9% P2O5 (LPT), high-grade phosphate ore raw ore with 32% P2O5 (HPO), low-grade phosphate ore raw ore with 0.4% P2O5 (NLPO), low-grade phosphate ore raw ore with 18% P2O5 (NPO), and low-grade phosphate ore raw ore with 12% P2O5 (LPO). The following treatments were carried out on the eight treatment groups:

[0068] 100 mL of PVK medium containing ammonium sulfate as the sole nitrogen source was placed in a 250 mL Erlenmeyer flask and sterilized at 121 °C for 20 min; the spore suspension was inoculated according to an inoculation amount of 1% (V / V), and 0.5 g of the above phosphate ore powder was added respectively. The culture was carried out on a shaker at 28 °C and 180 rpm. Samples were taken on the 7th day to observe and measure the growth of the strain. A treatment without adding the spore suspension was set as a control for each treatment group, and three parallel repeated experiments were carried out for each treatment and the control group. The available phosphorus content in the culture solution of each treatment was measured by ICP-OES, and the measurement results are shown in Table 1 and Figure 3 .

[0069] Table 1 Available phosphorus content (mg / L) in the culture solutions of different treatment groups

[0070]

[0071] Note: Figure 3 In, a, b, c, d represent significant differences between treatments (p < 0.05), and the same applies to the following tables or figures. N.A. indicates below the detection limit.

[0072] As can be seen from Table 1 and Figure 3 it can be seen that adding Aspergillus niger can promote the release of phosphorus in phosphate ore. Among them, after 7 days of culture, the phosphorus content released from the high-grade phosphate ore raw ore (HPO) with 32% P2O5 was the highest, up to 321.09 mg / L, which was significantly higher than the phosphorus release amount of other phosphate ore raw ores; among the phosphate tailings, the phosphorus release amount of the phosphate tailings with 7% P2O5 (NPT) was the highest, which was 126.66 mg / L. The lowest phosphorus content was the low-grade phosphate ore raw ore with 0.4% P2O5 (NLPO), and the phosphorus release amount was only 28.08 mg / L. It can be seen that the Aspergillus niger provided by the present invention can not only promote the release of phosphorus in high-grade phosphate ore raw ores with high phosphorus content, but also promote the release of phosphorus in low-grade phosphate ore raw ores with a phosphorus content of 0.4 wt.% and phosphate tailings with a phosphorus content of 2% - 9%, thereby improving the utilization rate of phosphate tailings, reducing the environmental pollution caused by phosphate tailings, and realizing the efficient utilization of phosphate tailings.

[0073] Example 3

[0074] Effect of Aspergillus niger complex phosphate rock on the degradation of corn and rice straw

[0075] The experimental phosphate rock samples selected were phosphate tailings with 8% P2O5 (DPT) and high-grade phosphate rock ore with 32% P2O5 (HPO). The straws selected were rice straw and corn straw. All the straws used in the experiment were at the mature stage, obtained from the Northern Anhui Comprehensive Experimental Station of Anhui Agricultural University in 2020, air-dried naturally and cut into lengths of 1 - 2 cm, and used after drying at 75°C. The preparation method of the spore suspension was the same as that in Example 2, and the treatment method of the phosphate rock samples was the same as that in Example 2.

[0076] Six treatments were set up in the experiment, namely corn straw + Aspergillus niger (MST + ANG), rice straw + Aspergillus niger (RST + ANG), 8% P2O5 phosphate tailings + corn straw + Aspergillus niger (DPT + MST + ANG), 8% P2O5 phosphate tailings + rice straw + Aspergillus niger (DPT + RST + ANG), 32% P2O5 phosphate rock ore + corn straw + Aspergillus niger (HPO + MST + ANG), and 32% P2O5 phosphate rock ore + rice straw + Aspergillus niger (HPO + RST + ANG). The six treatment groups were processed as follows:

[0077] 100 mL of PVK medium with ammonium sulfate as the sole nitrogen source was placed in a 250 mL Erlenmeyer flask, and the bacterial suspension was inoculated according to an inoculation amount of 1% (V / V). Except for the MST + ANG group and the RST + ANG group which only added 0.5 g of straw, the other four groups were added with 0.5 g of ore sample and 0.5 g of straw respectively, and cultured on a shaker at 28°C and 180 rpm. Samples were taken on the 7th day of culture to observe and measure the straw decomposition and strain growth. Each treatment was carried out with 3 parallel repeated experiments; Degradation rate of wheat straw: R wst =(M0 - M t ) / M0×100%; In the formula, R wst is the residual rate of wheat straw (%); M0 is the initial mass (g) of wheat straw before degradation; M t is the mass (g) of straw after degradation for t d; t is the degradation time (d). The available phosphorus content in the culture solution of each treatment was measured by ICP - OES, and the measurement results are shown in Table 2 Figure 4 and Figure 5 .

[0078] Table 2 Available phosphorus content (mg / L) and straw decomposition rate (%) in the culture solution of different treatment groups

[0079]

[0080] From Table 2 and Figure 4It can be seen that after adding corn and rice straws, Aspergillus niger still has the ability to dissolve phosphorus, and the phosphorus release amounts from the phosphate rock containing 32% P2O5 are 160.85 mg / L and 151.28 mg / L respectively (since the straw has a certain adsorption capacity and can adsorb phosphorus elements in the solution, the phosphorus content in the solution under short-term culture is relatively lower than that in the HPO treatment group in Table 1), both of which are higher than the phosphorus release amounts of 129.70 mg / L and 135.93 mg / L from the phosphate tailings containing 7% P2O5. For the phosphate rock, the phosphorus release amount with the addition of corn straw is higher than that of rice straw, while for the phosphate tailings, the opposite is true, and the phosphorus release amount with the addition of corn straw is lower than that of rice straw.

[0081] It can be seen from Table 2 and Figure 5 that adding Aspergillus niger and phosphate rock can promote straw degradation. Among them, the degradation rate of NPT+ANG+RST is the highest, with a degradation rate of 14%; compared with the treatment with corn straw added, the degradation rates of NPT+ANG+MST and HPO+ANG+MST are 6% and 7.33% respectively, both of which are higher than the 5% of the treatment with only Aspergillus niger added; compared with the treatment with rice straw added, the degradation rate of 14% of NPT+ANG+RST is significantly higher than 6% of ANG+MST and 2% of HPO+ANG+MST.

[0082] Example 4

[0083] The straws used in the experiment were all winter wheat straws at the mature stage, obtained from the Northern Anhui Comprehensive Experiment Station of Anhui Agricultural University in 2020, naturally air-dried and cut into 1 cm lengths, and then dried at 75°C. The experiment included three treatments: Aspergillus niger (ANG), wheat straw (WST), and wheat straw + Aspergillus niger (WST+ANG). Add 0.5 g of wheat straw to a 250 mL conical flask, and add 100 mL of PVK medium, sterilize at 121°C for 20 min; inoculate the bacterial suspension according to an inoculation amount of 1% (V / V), culture on a shaker at 28°C and 180 rpm, take dynamic samples at 1 d, 5 d, 10 d, 20 d, and 30 d respectively, observe and measure the growth of the strains, and conduct 3 parallel repeated experiments for each treatment group. The results of culturing for 20 days and 30 days are shown in Figure 6 .

[0084] It can be seen from Figure 6 that after culturing Aspergillus niger in PVK medium for 20 days, the total organic acid secretion amount is 5214.85 mg / L, among which the oxalic acid (OA) secretion amount is 1448.96 mg / L, and the citric acid (CA) secretion amount is 1158.46 mg / L; after culturing in PVK medium for 30 days, the degradation rate of Aspergillus niger to wheat straw reaches 29.85%, and the enzyme activities of cellulase (CL) and lignin peroxidase (LP) are 6916.54 nmol / min / mg and 5839.80 U / g respectively.

[0085] In summary, the present invention provides an Aspergillus niger strain that combines the abilities of phosphate solubilization and straw degradation, and also has the ability to produce oxalic acid. It can accelerate the decay of straw, improve the cellulose degradation rate, thereby promoting the efficiency of straw returning to the field, reducing environmental pollution, and achieving an increase in crop yield.

[0086] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of Aspergillus niger in promoting straw degradation in combination with phosphate rock, wherein the Aspergillus niger is preserved in the China General Microbiological Culture Collection Center with the preservation number CGMCC No. 23272; The phosphate rock includes phosphate rock with a P2O5 content of ≥ 7 wt.%.

2. The application according to claim 1, wherein The straw includes wheat straw and / or corn straw.

3. A method for promoting straw degradation, characterized in that It includes the following steps: Mix the Aspergillus niger agent, phosphate rock and straw to obtain a mixture containing degraded straw; the Aspergillus niger is preserved in the China General Microbiological Culture Collection Center with the preservation number CGMCC No. 23272.

4. The method according to claim 3, wherein The spore concentration of Aspergillus niger in the Aspergillus niger agent is 1×10 7 ~9×10 7 CFU / mL.

5. The method according to claim 3 or 4, characterized in that, The dosage ratio of the Aspergillus niger agent, phosphate rock and straw is 1 - 2 mL: 0.5 - 1 g: 0.5 - 1 g.

6. The method according to claim 3 or 4, characterized in that The phosphate rock includes phosphate rock with a P2O5 content of ≥ 7 wt.%.

7. The method according to claim 3 or 4, characterized in that, The straw includes wheat straw and / or corn straw.

Images