Banana burrowing nematode mutarotase and use thereof
By cloning and studying the branching acid mutase RsCM of the banana nematode, transgenic plants were constructed to suppress plant defense responses, solving the problem of the pathogenicity of the banana nematode and achieving effective control over bananas and other host plants.
Patent Information
- Application Number
- CN202310333064.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2043-03-31
AI Technical Summary
The lack of effective methods for controlling banana nematode and research on its pathogenic mechanism in existing technologies makes it difficult to control the serious damage to bananas and other host plants.
The branch acid mutase gene RsCM of the banana nematode was cloned and studied. By constructing transgenic plants, the RsCM was used to inhibit the plant's defense response. The oral immune response of the RsCM protein was also investigated. Transgenic plants were constructed using RNAi technology to inhibit the plant's defense response, suppress the salicylic acid metabolic pathway, and reduce the pathogenicity of the nematode.
Successfully suppressing the plant's defense response and reducing the pathogenicity of banana nematode provides a new target for breeding nematode-resistant plant varieties and offers a new strategy for controlling banana nematode.
Smart Images

Figure CN116286908B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant disease and pest control technology, specifically relating to a branch acid mutase of the banana perforating nematode and its application. Background Technology
[0002] The banana root-piercing nematode (Radipoholus similis) is a migratory endoparasitic nematode that parasitizes the roots of plants, causing root rot and the death of the entire plant. It is one of the world's top 10 most destructive plant parasitic nematodes, with over 360 host plant species. It is particularly harmful to bananas (Musa spp.), citrus (Citrus spp.), pepper (Piper nigrum), ginger (Zingiber officinale), and ornamental plants, and is currently one of the most serious diseases affecting shade-loving ornamental plants. It causes enormous losses to crops in tropical and subtropical regions every year. Many countries and regions list it as a quarantine pest, and my country also lists it as a prohibited quarantine plant nematode. It was introduced to Guangdong with the import of foreign flowers and substrate soils, causing severe economic losses to flower enterprises in Guangdong. Currently, it poses a serious threat to the banana and citrus industries in southern China, and also threatens the domestic and international trade of shade-loving ornamental plants.
[0003] Choriminate mutases (CMs) are crucial enzymes in the shikimic acid pathway, a fundamental metabolic pathway in plants and microorganisms. They catalyze the conversion of chorionic acid, a vital linker in organisms, into essential amino acids. CMs can also be derived into salicylic acid, closely related to defense responses, and auxins, essential for plant growth and development. Therefore, CMs play a vital role in the interaction between pathogenic microorganisms and plants. In animals, no studies have reported on CMs in animals other than nematodes to date. Therefore, using CMs as targets for plant nematode control does not pose a safety concern. Thus, researching the mechanism of action of CMs in the interaction between plant nematodes and host plants is of great importance. Most of the plant nematodes reported so far are derived from sessile parasitic plant nematodes, but there are no reports on whether they participate in the pathogenic process of plant nematodes or their molecular mechanisms. Although transcripts of this gene have been found in migratory parasitic nematodes such as the coffee short-bodied nematode (Pratylenchus coffeae) and the rice root-miner nematode (Hirschmanniella oryzae), their molecular sequences and functions are still unclear. To date, there are no reports on the banana perforating nematode CM and its function.
[0004] Identifying pathogenic genes helps to reveal the pathogenic mechanism of banana nematode and the specific interaction mechanism between the host and the plant nematode, which can better control and reduce the damage of banana nematode to the host. It also has important application value for the study of banana nematode gene function and nematode-resistant breeding. Summary of the Invention
[0005] The technical problem this invention aims to solve is to overcome the shortcomings of existing banana nematode control technologies and the lack of research on the pathogenic mechanism of banana nematodes, and to provide a pathogenicity-related gene RsCM for banana nematodes and its application. This invention provides a new target for the breeding of nematode-resistant plant varieties and a new approach for the control of banana nematodes.
[0006] This invention relates to the cloning and functional analysis of RsCM from the banana nematode *Rhizoctonia solani*, providing a pathogenic factor related to *Rhizoctonia solani*. The full-length RsCM genome sequence is 1277 bp, containing 3 introns; the full-length CDS is 1334 bp, containing an open reading frame of 1125 bp, encoding 374 amino acids. The RsCM protein structure contains a conserved domain of a branched acid mutase, and the encoded protein contains a 23 amino acid signal peptide, but does not contain a transmembrane domain.
[0007] This invention provides applications of RsCM in the banana nematode *Rhizoctonia solani*. Analysis of RsCM expression patterns revealed the highest expression level in second-instar larvae. Subcellular localization showed that this gene is secreted in the cytoplasm and nucleus of plant cells. Transient expression in tobacco showed that RsCM significantly inhibited flg22-induced defense gene expression and callose deposition, and significantly suppressed BAX-induced cell necrosis, indicating that RsCM can suppress plant defense responses. Transgenic tomatoes constructed using in-planta RNAi technology showed a decrease in the pathogenicity of *Rhizoctonia solani* after inoculation with nematodes. Transgenic tomatoes overexpressing RsCM were constructed, and it was found that RsCM inhibits the plant salicylic acid metabolism pathway.
[0008] Therefore, the first objective of this invention is to provide the application of the banana nematode branch acid mutase gene RsCM in the control of banana nematode, wherein the nucleotide sequence of the banana nematode branch acid mutase gene RsCM is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0009] The amino acid sequence of the protein encoded by the banana nematode branch acid mutase gene RsCM is shown in SEQ ID NO.3.
[0010] The second objective of this invention is to provide a method for breeding nematode-resistant plant varieties that reduces the pathogenicity of banana nematode infection. This method is achieved by constructing RNAi transgenic plants that target the banana nematode branch acid mutase gene RsCM. The nucleotide sequence of the banana nematode branch acid mutase gene RsCM is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0011] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0012] This invention marks the first discovery of the branching acid mutase RsCM in the banana nematode, and its full-length gene sequence was obtained through RACE technology. By constructing an expression vector, it was revealed that RsCM inhibits the plant's defense response and participates in pathogenicity against the host plant by inhibiting the plant's salicylic acid metabolism pathway. This invention provides a new strategy for nematode control in agricultural production, offers a new target for the breeding of nematode-resistant plant varieties, and provides a new approach for the control of the banana nematode. Attached Figure Description
[0013] Figure 1 The expression level of RsCM is the relative expression level of banana nematode eggs, larvae, females, and males; where female: female, male: male, juvenile: larvae, and egg: egg; "Ⅰ" indicates the standard error of the mean (n=3), and different letters represent significant differences between treatments (p<0.05).
[0014] Figure 2 The secretory location of RsCM in nematodes; A: no hybridization signal was detected on nematodes by the sense probe; BC: hybridization signal was detected on nematode esophageal glands by the antisense probe; where eg refers to the esophageal gland and mb refers to the median bulb of esophagus.
[0015] Figure 3 Figure A shows the subcellular localization of RsCM in tobacco cells; Figure B shows the subcellular localization of RsCM in tobacco cells.
[0016] Figure 4 This is the phenotype of RsCM inhibiting plant defense responses; Figure A shows the aniline blue staining image of RsCM inhibiting callose deposition induced by flg22, with the bright spot in the middle indicating callose accumulation; Figure B shows the analysis of RsCM inhibiting BAX-induced tobacco cell necrosis, (a) indicating the inhibitory effect on cell necrosis, (b) indicating the percentage of necrotic area in tobacco leaves under different treatments, with different letters indicating significant differences between groups (p < 0.05), and (c) indicating the expression of proteins determined by Western blot, 1 for pCAMBIA1300 24hBAX, 2 for pCAMBIA1300; 3 for RsCM. ΔSP ;4 is RsCM ΔSP 24-hour BAX.
[0017] Figure 5 RsCM regulates the upregulation of expression of three defense response genes in tobacco (NbPti5, NbGras2, and Nbacre31).
[0018] Figure 6 The study investigated the influence of RsCM on the pathogenicity of banana nematode in plants. Figure (a) shows the root symptoms of T1 generation tomatoes infected with the banana nematode branch acid mutase gene RsCM 30 days after infection. Figures (b) and (c) show the reproductive pathogenicity and reproductive capacity of banana nematode in T1 generation tomatoes infected with the banana nematode branch acid mutase gene RsCM. Figure (b) shows the pathogenicity as reflected by root fresh weight, and Figure (c) shows the reproductive capacity as reflected by the number of nematodes after inoculation compared with the control. Detailed Implementation
[0019] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0020] All raw materials and equipment used in this invention are commercially available products that can be directly purchased from the market, and the primer sequences used are synthesized by Shanghai Sangon Biotech Co., Ltd.
[0021] Example 1: Cloning and sequence analysis of the full-length RsCM gene of the banana nematode.
[0022] Total RNA was extracted from *Nematodea bananaensis* using the Trizol Reagent procedure from Invitrogen. First-strand cDNA was synthesized using the one-step gDNA Removal and cDNA Synthesis Kit from Beijing TransGen Biotechnology Co., Ltd. A 947bp sequence was selected from the *Nematodea bananaensis* transcriptome database (Unigene7287_All) for cloning. Using the obtained cDNA as a template, a primer pair T-CMF(5′-GATCTGGCGCGCGATGTG-3′) / T-CMR(5′-GAGGCCTTCCCCTGCCC-3′) was designed for amplification. Primers for amplifying the full-length RsCM gene sequence were designed based on the obtained sequence. The primer for the 5′ race was cm-GSP1(5′-CCGCGACCACCTGCTCCAA). The primers used for the 3′ race are cm-GSP2 (5′-GCACTGGCGTCGGTGGAGGAGGT-3′) and cm-NGSP2 (5′-CAACGAGTCGGGCAGGGAGAAGG-3′). The specific steps are as follows:
[0023] 1. 5'RACE
[0024] (1) The first round of primer amplification consisted of the following reaction system: 2.5 μL cDNA template, 2.5 μL each of upstream and downstream primers UPM and cm-GSP1 (10 μM), 10 μL dNTPs (2 mM), 25 μL 2×KOD PCR buffer, 1 μL KOD FX (1 U / μL), and ddH2O added to a final volume of 50 μL. The amplification conditions were: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 68℃ extension for 1 min, for 35 cycles; and a final extension at 68℃ for 5 min to obtain the template for the second round of amplification.
[0025] (2) The second round of amplification consisted of the following reaction system: 2.5 μL of the first round amplification product, 2.5 μL each of forward and reverse primers NUP and cm-NGSP1 (10 μM), 10 μL of dNTPs (2 mM), 25 μL of 2×KOD PCR buffer, 1 μL of KOD FX (1 U / μL), and ddH2O added to a final volume of 50 μL. Amplification conditions were the same as for the first round of primer amplification. After detecting the amplified product, the remaining product was stored at -20℃ for later use.
[0026] 2, 3′ RACE amplification
[0027] The first round of primers used UPM and cm-GSP2, and the second round of primers used NUP and cm-NGSP2. The amplification reaction system and amplification conditions were the same as those for the corresponding 5′RACE amplification.
[0028] 3. Obtaining the full-length RsCM sequence
[0029] After ligating the 5′RACE amplification products and 3′RACE amplification products to the pEASY-Blunt Cloning vector, positive single-clone bacterial cultures were selected for sequencing to obtain the 5′ and 3′ end sequences of RsCM. Using DNAMAN software, the RsCM clone sequence, 5′ end sequence, and 3′ end sequence were spliced together to obtain the full-length RsCM mRNA sequence. The ORF sequence of RsCM was predicted using the online software ORFfinder. Based on the predicted ORF sequence, primers Full-CMF(5′-ATGAAAGGACTTCTTCCTTCGTTCC-3′) / Full-CMR were designed to amplify the full-length RsCM ORF29.
[0030] (5′-TCAGTTGTTCCGAGCCCTCACGTCC-3′) was used as a template to amplify the gDNA sequence (as shown in SEQ ID NO.1) and full-length cDNA sequence (as shown in SEQ ID NO.2) of RsCM. Its amino acid sequence was predicted using ORFfinder (as shown in SEQ ID NO.3).
[0031] Example 2: Determination of RsCM gene expression in different life stages of banana nematode
[0032] Under a microscope, 3000 female, male, larval, and egg worms of *Nematodea bananaensis* were collected using a needle and transferred to centrifuge tubes. These tubes were immediately frozen in liquid nitrogen and stored at -80°C for later use. Total RNA was extracted from a small amount of the nematodes according to the instructions of the TIANGEN RNAprep PureMicro Kit. cDNA was synthesized from female, male, larval, and egg worms of *Nematodea bananaensis*. Using cDNA from different developmental stages of *Nematodea bananaensis* as templates, RT-qPCR experiments were performed using qCM-F(5′-CAACAAAGTCATCCAGAAG-3′) / qCM-R(5′-GACCTATTCGCCGATTTG-3′) primers and eIF5A as an internal control gene, following the instructions of the Vazyme AceQ qPCR SYBR Green Master Mix to detect the relative expression level of RsCM at different developmental stages of *Nematodea bananaensis*. The qPCR reaction system consisted of 2 μL cDNA, 1 μL primers, 10 μL 2×ChamQ SYBRqPCR Master Mix, and water to a final volume of 20 μL. The reaction conditions were 95℃ for 5 min, 95℃ for 10 s, and 60℃ for 1 min, for a total of 40 cycles. Melting curves were collected after the reaction. The results showed that the relative expression level of RsCM was significantly higher in larvae (p<0.05). Figure 1 ).
[0033] Example 3: In situ hybridization of the RsCM gene
[0034] Using in vitro transcription, positive and negative probes (upstream primer ISCM-T7F: TAATACGACTCACTATAGGGATCGCCAATAAAACCATCC, downstream primer ISCM-R: CCTCAAATCTGTGCCAACA) and negative probes (upstream primer ISCM-F: ATCGCCAATA AAACCATCC, downstream primer ISCM-T7R: TAATACGACTCACTATAGGGCCTCAAA TCTGTGCCAACA) for in situ hybridization were synthesized. The positive and negative probes of RsCM were used to perform in situ hybridization on banana nematodes (the specific method is disclosed in the literature "In-situ hybridization to messenger RNA in Heterodera glycines. Journal of Nematology. 30, 309-312"). The results showed that the negative probe of RsCM produced a hybridization signal in the esophageal glands of nematodes, while the positive probe did not produce a hybridization signal in nematodes. Figure 2 The results indicate that RsCM is specifically expressed in the esophageal glands of *Bacillus chinensis*.
[0035] Example 4: Subcellular localization of RsCM
[0036] pCAMBIA1300:RsCM Δsp -GFP and pCAMBIA1300:GFP was transformed into Agrobacterium competent cells GV3101, and then transformed into tobacco leaves (the specific method is disclosed in the literature "Optimization of transient Agrobacterium-mediated gene expression system in leaves of Nicotiana benthamiana. Acta Biochimica Polonica, 53, 289-298"). The results showed that RsCM was secreted in the cytoplasm and nucleus of plant cells. Figure 3 ).
[0037] Example 5: Detection and analysis of the inhibitory effect of RsCM on the basal immune response of tobacco.
[0038] The constructed vector pCAMBIA1300:Flag:RsCM ΔSPThe gene was transformed into Agrobacterium competent cells GV3101, and then Agrobacterium culture containing the target vector was injected into tobacco leaves for transient expression (the specific method is disclosed in the literature "Optimization of transient Agrobacterium-mediated gene expression system in leaves of Nicotiana benthamiana. Acta Biochimica Polonica, 53, 289-298"). The results of staining using the aniline blue method showed that... Figure 4 A) Compared to the control group, Flag:RsCM was injected. ΔSP Callus deposition in tobacco leaves was significantly reduced, indicating that RsCM expression could inhibit flg22-induced callus deposition. 24 hours after injecting Agrobacterium-containing bacterial suspension with the target vector into tobacco leaves, Agrobacterium-containing BAX bacterial suspension was injected into the same area. Analysis of the effect of RsCM on BAX-induced cell necrosis showed that ( Figure 4 B) RsCM can effectively inhibit BAX-induced cell necrosis.
[0039] Tobacco injected with recombinant Agrobacterium vector and then soaked in flg22 was analyzed for the relative expression levels of three tobacco defense genes, NbPti5, NbGras2, and Nbacre31, by RT-qPCR (the specific method is disclosed in the literature "Methods to study PAMP-triggered immunity using tomato and Nicotiana benthamiana. Molecular Plant-Microbe Interactions, 23, 991-999"). The results showed that RsCM could significantly inhibit the flg22-induced upregulation of the three tobacco defense genes. Figure 5 ).
[0040] Example 6: Genetic transformation of RsCM-overexpressing tomatoes and in-planta RNAi tomatoes
[0041] Using the RsCM overexpression vector pCAMBIA1300:RsCM ΔSPTomato explants were transformed with the silencing vector PFGC5941:RsCMI, resulting in three overexpressing plants and three in-planta RNAi plants. After planting, testing, and screening at T0 and T1 generations, the plants were identified and inoculated with banana nematode. Results 30 days after inoculation showed that the RsCM expression level of banana nematode collected from the roots of T1 generation RNAi plants was significantly lower than that of wild-type tomatoes and plants transformed with the empty vector. This indicates that T1 generation RsCM in-planta RNAi tomatoes effectively inhibits RsCM expression, thereby effectively suppressing the pathogenicity of banana nematode and significantly reducing the severity of tomato damage. Figure 6 Overexpression of RsCM in plants significantly increased the pathogenicity of nematodes to tomatoes. Figure 6 ).
Claims
1. A method for breeding nematode-resistant plant varieties to reduce the pathogenicity of banana nematode infestation, characterized in that, By constructing a target acid mutase gene from the banana nematode. RsCM The RNAi transgenic plants were used; the banana nematode branch acid mutase gene was described. RsCM Its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2.