Biological sample genomic DNA normal temperature long-term storage agent and application thereof

Abstract

A long-term, room-temperature preservative for biological sample genomic DNA and its applications. The components of this preservative work together to preserve biological samples efficiently and effectively over a long period without corrosion, using a simple and low-cost method. It also preserves the integrity of the genomic DNA structure and the stability of its physicochemical properties, preventing the loss or alteration of genetic information during collection, transportation, and preservation. Unlike previous technologies, this invention can be applied to biological samples of different scales, such as bacteria, cells, tissues, organs, and even organisms, without being limited by the size of the biological sample. It effectively protects the genomic DNA in all samples. When genomic DNA extraction is needed, the encapsulation layer is removed, and commercially available kits are used to extract the genomic DNA. This simplifies the preservation process, significantly reduces the cost of the initial preservation steps, and facilitates the widespread adoption of this technology.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a biological sample genomic DNA normal-temperature long-term storage agent and application thereof. BACKGROUND

[0002] Biological samples (such as viruses, bacteria, cells, organs and organisms) are important raw experimental materials for biological, genetic and modern medical research. In the past few decades, the research focus on biological samples of different scales has gradually shifted from morphological feature analysis to biological molecular analysis. Deoxyribonucleic acid (DNA) is one of the important biological macromolecules in biological samples, which carries the genetic information necessary for the synthesis of ribonucleic acid (RNA) and protein, and is also an ideal carrier for future information storage. DNA can be efficiently repaired in living cells, but this repair mechanism stops after the organism dies. During the collection and long-term storage of biological samples, DNA will inevitably be degraded due to the effects of nucleases, oxidative damage and hydrolysis. Long-term and reliable preservation of genetic information in biological samples is of great significance for cancer gene research, forensic evidence, species evolution and identification of new species. How to preserve biological samples and their DNA for a long time with high quality and low cost is a major challenge for researchers.

[0003] At present, the most commonly used biological sample preservation methods are low-temperature cryopreservation and preservative solution preservation (formalin, glutaraldehyde, etc.). In a super-low temperature environment, the free water in the biological sample becomes solid water that cannot be utilized, and the nucleases and other metabolic activities in the cells are inhibited, and the preservation time can reach several months or even decades. However, low-temperature cryopreservation has a high cost and consumes a large amount of electrical energy. Once there is a circuit or equipment failure, the preserved biological samples will suffer devastating damage. In addition, the equipment for rapid low-temperature freezing is large and not easy to move and transport, which greatly limits the outdoor collection and rapid preservation of biological samples. Formalin, as the most commonly used preservative solution, has the advantages of low cost and strong corrosion resistance, and is often used for the fixation and preservation of clinical specimens. However, the formalin solution can cross-link DNA and protein in the sample, which not only affects the extraction of DNA, but also makes the polymerase chain reaction (PCR) process very difficult. Therefore, it is necessary to develop a long-term and reliable preservation method for biological samples and their genomic DNA at normal temperature, which can efficiently preserve biological samples and their DNA while simplifying the operation steps and reducing the preservation cost. SUMMARY

[0004] The purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and to provide a biological sample normal-temperature long-term storage agent, which aims to prolong the preservation time of existing biological samples and their genomic DNA, and to achieve the goal of simple one-step packaging and on-demand extraction.

[0005] Another objective of this invention is to provide a method for long-term preservation of genomic DNA of biological samples at room temperature.

[0006] Another object of the present invention is to provide the application of the above-mentioned long-term preservation agent for biological samples at room temperature.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A long-term preservation agent for biological samples at room temperature comprises the following components in parts by weight: 10-1000 parts of tissue fixative, 10-1000 parts of tissue permeabilizer, 1-150 parts of reactive biological sample encapsulating agent, 0.1-100 parts of pH adjuster, 0.1-100 parts of ion concentration adjuster, and 10-500 parts of water.

[0009] The tissue fixative is preferably 100 to 1000 parts; more preferably 500 to 950 parts.

[0010] The tissue penetrant is preferably 100 to 1000 parts; more preferably 500 to 950 parts.

[0011] The reactive biological sample encapsulating agent is preferably 1 to 100 parts; more preferably 2 to 30 parts.

[0012] The pH adjuster is preferably 0.1 to 50 parts; more preferably 1 to 20 parts.

[0013] The ion concentration regulator is preferably 0.1 to 50 parts; more preferably 1 to 20 parts.

[0014] The tissue fixative is at least one of anhydrous methanol, anhydrous ethanol, and acetone.

[0015] The tissue penetrant is at least one of dimethyl sulfoxide, glycerol, lauryl ketone, isosorbide dimethyl ether, N-n-alkylbenzisothiazolone, and cyclohexanehexyl alcohol.

[0016] The reactive biological sample encapsulating agent is an encapsulating agent capable of forming a silicon nanolayer.

[0017] The reactive biological sample encapsulating agents are methyltrimethoxysilane, methyldiethoxysilane, ethyltriethoxysilane, methyltriethoxysilane, tetraethyl orthosilicate (TEOS), tetramethyl orthosilicate (TMOS), bis(trimethylsilyl)acetamide (BSA), 3-aminopropyltriethoxysilane (APTES), 3-mercaptopropyltrimethoxysilane (MPTMS), trimethylchlorosilane (TMCS), chlorotriethoxysilane (TECS), octyltrimethoxysilane, and cyclohexylmethyldimethoxysilane. The preferred formulations are trimethoxysilane, triethoxysilane, benzyltriethoxysilane, vinyltrimethoxysilane, and isobutyltriethoxysilane, and are at least one of methyltriethoxysilane, tetraethyl orthosilicate (TEOS), tetramethyl orthosilicate (TMOS), vinyltrimethoxysilane, and isobutyltriethoxysilane capable of forming nanolayers; more preferably, at least one of methyltrimethoxysilane, methyltriethoxysilane, tetraethyl orthosilicate (TEOS), and tetramethyl orthosilicate (TMOS) capable of forming inorganic nanolayers.

[0018] The pH adjuster is at least one of hydrochloric acid, acetic acid, phosphoric acid, sulfuric acid, sodium hydroxide, potassium hydroxide, ammonia, and Tris.

[0019] The ionic strength modifier is at least one of sodium chloride, potassium chloride, ammonium chloride, sodium phosphate, sodium monohydrogen phosphate, sodium dihydrogen phosphate, potassium phosphate, potassium monohydrogen phosphate, potassium dihydrogen phosphate, and sodium acetate.

[0020] The water is pure water, preferably RNase-free water.

[0021] A method for long-term preservation of genomic DNA from biological samples at room temperature includes the following steps:

[0022] The above-mentioned biological samples were incubated together with the room temperature long-term preservation agent to obtain the preserved biological samples.

[0023] The volume ratio of the preservative to the biological sample is 1000 to 1:1, preferably 100 to 2:1, and more preferably 50 to 10:1.

[0024] The incubation conditions are 0℃~37℃ for a total incubation period of 5min~720h.

[0025] The application of the above-mentioned long-term room temperature preservation agents for biological samples in the preservation of biological samples.

[0026] The above-mentioned method for long-term preservation of genomic DNA of biological samples at room temperature is applied to the preservation of biological samples.

[0027] The present invention has the following advantages over the prior art:

[0028] The biological samples and their DNA preservatives of this invention can protect the integrity of the genomic DNA structure and the stability of its physicochemical properties at room temperature for extended periods, preventing the loss or alteration of genomic information. They can also extend the storage time of genomic samples at room temperature and facilitate long-distance transportation. The long-term room-temperature preservation and extraction methods for genomic DNA involved in this invention can provide efficient and reliable preservation of genetic information for biological samples such as bacteria, tumor tissues, and organisms.

[0029] The technical solution provided by this invention has the following effects:

[0030] The components of the preservative in this invention work together to preserve biological samples for a long time and efficiently without corrosion in a simple and low-cost manner. It also preserves the integrity of the biological sample's genomic DNA structure and the stability of its physicochemical properties, preventing the loss or alteration of genetic information during collection, transportation, and preservation. Unlike previous technologies, this invention can be applied to biological samples of different scales, such as bacteria, cells, tissues, organs, and even organisms, without being limited by the size of the biological sample. It effectively protects the genomic DNA in all samples. When genomic DNA extraction is needed, the encapsulation layer is removed, and commercial kits are used to extract the genomic DNA, simplifying the preservation process, significantly reducing the cost of the initial preservation process, and facilitating the widespread adoption of this technology. Attached Figure Description

[0031] Figure 1 This is a SEM image of the cell sample preserved in Example 1.

[0032] Figure 2 This is a SEM image of the cell sample after preservation in Comparative Example 2.

[0033] Figure 3 This is a two-dimensional laser confocal microscope image of the sample after preservation in Example 1.

[0034] Figure 4 This is a three-dimensional laser confocal microscope image of the sample after preservation in Example 1.

[0035] Figure 5 This is a SEM image of the earthworm sample preserved in Comparative Example 5.

[0036] Figure 6 This is a SEM image of the earthworm sample preserved in Example 2.

[0037] Figure 7 These are photographs of earthworm samples preserved after Mirco CT scans; the left image is Comparative Example 5, and the right image is Example 2.

[0038] Figure 8These are DNA gel electrophoresis images of biological samples after 1 day at 70°C and 70% humidity; M1, M2: Mark 1, Mark 2; S1, S2: Example 1, Example 2; C1~C6: Comparative Examples 1~6. Detailed Implementation

[0039] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0040] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0041] To better understand the technical solution of the present invention, the following embodiments further illustrate the content of the present invention, but the content of the present invention is not limited to the following embodiments.

[0042] The testing method in this invention is as follows:

[0043] The biological samples used in the experiment were mouse fibroblast epithelial cells (L929 cells) and earthworms.

[0044] Scanning electron microscopy (SEM) observation: Cellular biological samples were dispersed in water and dropped onto clean aluminum foil for SEM observation; earthworm biological samples were placed on conductive adhesive for SEM observation.

[0045] Laser confocal microscopy observation: Cell samples were labeled with Hoechst33342, DiD, and FITC to label the cell nucleus, cell membrane, and encapsulation material, respectively, and then observed under a laser confocal microscope.

[0046] Micro CT scanning imaging observation: Earthworm biological samples are placed in a Micro CT device for scanning imaging to observe their preservation morphology.

[0047] DNA concentration detection: Genomic DNA was extracted from each accelerated aging sample using an animal tissue genomic DNA kit. 2 μL of the sample was added to the NANODROP detection cell, and the concentration of genomic DNA was deduced from the absorbance at 260 nm.

[0048] DNA structural integrity testing: Genomic DNA was extracted from each accelerated aging sample using an animal tissue genomic DNA kit, and the integrity of the extracted DNA was detected by 1% agarose gel electrophoresis.

[0049] qPCR detection:

[0050] 1. Setting up the PCR reaction system:

[0051] L929 cell RT-PCR template: X00686.1

[0052] Top primer A: GGACACGGACAGGATTGACA

[0053] Lower primer B: CGGACATCTAAGGGCATCACAG

[0054] Earthworm RT-PCR template: AB558505.1

[0055] Top primer A: CCGTAACTCTGATGACTCTGG

[0056] Lower primer B: CTGCCTTCCTTGGATGTG

[0057] The sample loading volume was 2 μL;

[0058] a. Dissolve and mix all solutions required for the PCR reaction. After completely dissolving and mixing BeyoFast SYBR Green qPCR Mix (2X), place it on an ice bath or in an ice box.

[0059] b. Set up the PCR reaction system (8 tubes) at room temperature or on an ice bath according to the following formula:

[0060] Reagent Volume for One PCR Reaction (20μL);

[0061] BeyoFast SYBR Green qPCR Mix(2X)10μL;

[0062] Forward and Reverse Primer Mix (10μM each) 2μL;

[0063] The extracted genomic DNA volume was diluted with RNase-Free Water at a ratio of 1:100 to prepare Template DNA.

[0064] 8 μL of template DNA;

[0065] 2. PCR reaction procedure:

[0066] a. Pre-denaturation: 95℃, 2min;

[0067] b. Denaturation: 95℃, 15s;

[0068] c. Annealing / Extension: 55℃, 15-30s (annealing temperature is determined by primer Tm value);

[0069] d. Repeat steps b and c for a total of 40 cycles;

[0070] e. Melting curve analysis (optional): 95℃ / 15s, 60℃ / 15s, 95℃ / 15s;

[0071] f. Analyze the results using the software provided by the real-time PCR instrument.

[0072] Example 1

[0073] A long-term room-temperature preservative for biological samples and its efficacy in preserving cell samples.

[0074] (1) The formulation of the preservative includes the following components by weight: 800 parts of tissue fixative anhydrous ethanol, 10 parts of tissue permeation agent dimethyl sulfoxide, 7.5 parts of reactive cell encapsulation agent tetramethoxysilane, 0.2 parts of pH adjuster hydrochloric acid, 10 parts of ion concentration adjuster sodium chloride, and 170 parts of RNase-free purified water.

[0075] (2) Add 1 mL of the prepared preservative and 2 × 10 6 The L929 cells were mixed and co-incubated at 26°C for 3 hours to obtain preserved samples. The morphology of the samples was then observed using SEM and laser confocal microscopy. The results are as follows: Figure 1 , 3 As shown in Figure 4, the preserved biological samples can be stored at room temperature for a long time.

[0076] (3) After preservation, the sample was immersed in 0.1 times BOE solution (buffered oxide etching solution) for 5 minutes to remove the encapsulation layer. Genomic DNA was extracted using commercial kits (Ezup column-based animal genomic DNA extraction kit, Ezup column-based bacterial genomic DNA extraction kit). The concentration of genomic DNA and the integrity of DNA structure in the sample were detected (the detection method can be referred to Liu Yanyan, Dong Shuguang, Geng Jialiang, et al. Study on DNA degradation law in the process of donkey-hide gelatin processing [J]. Pharmaceutical Research, 2016, 35(09):501-507.DOI:10.13506 / j.cnki.jpr.2016.09.002.). The cycle number CT value of the sample was detected by qPCR.

[0077] In addition, after the preserved samples were placed in a high temperature and high humidity environment (70℃, 70% humidity) for 1, 7, and 14 days, genomic DNA was extracted using the same steps described above, and the concentration of genomic DNA was detected. The cycle number (CT) value of the samples was then detected using qPCR to verify the integrity of the DNA structure in the 1-day samples. The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown, the experimental results demonstrate that the DNA in cell samples preserved using the preservative of this invention is well protected.

[0078] Example 2

[0079] A long-term room-temperature preservative for biological samples and its effectiveness in preserving large-scale biological samples.

[0080] (1) The formulation of the preservative includes the following components by weight: 600 parts of tissue fixative anhydrous ethanol, 200 parts of tissue permeation agent dimethyl sulfoxide, 7.5 parts of reactive cell encapsulation agent tetramethoxysilane, 0.2 parts of pH adjuster hydrochloric acid, 10 parts of ion concentration adjuster sodium chloride, and 180 parts of RNase-free purified water.

[0081] (2) 10 mL of the prepared preservative and 0.3 g of earthworm sample were incubated together at 26℃ for 360 h, with the solution changed every 48–96 h. After incubation, the preserved sample was obtained. The morphology of the sample was then observed using SEM and MicroCT. The results are as follows: Figures 6-7 As shown.

[0082] (3) Following the method in step (3) of Example 1, the genomic DNA concentration and cycle test CT value of the encapsulated samples were tested on days 1, 7, and 14 in a high temperature and high humidity environment. The DNA structural integrity of the day 1 samples was also examined. The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown.

[0083] Comparative Example 1: Cell biological samples without tissue fixative

[0084] (1) The formulation of the preservative includes the following components by weight: 10 parts tissue permeation agent dimethyl sulfoxide, 7.5 parts reactive biological sample encapsulation agent tetramethoxysilane, 0.2 parts pH adjuster hydrochloric acid, 10 parts ion concentration adjuster sodium chloride, and 970 parts RNase-free purified water.

[0085] (2) Add 1 mL of the prepared preservative and 2 × 10 6 L929 cells were co-incubated at 26°C for 3 hours to obtain preserved samples. The morphology of the samples was then observed using SEM. The preserved biological samples can be stored at room temperature for a long time.

[0086] (3) Following the method in step (3) of Example 1, the genomic DNA concentration and cycle test CT value of the encapsulated samples were tested on days 1, 7, and 14 in a high temperature and high humidity environment. The DNA structural integrity of the day 1 samples was also examined. The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown.

[0087] The difference between this comparative example and Example 1 is that no tissue fixative was added to the cell biological sample.

[0088] Comparative Example 2: Cell Biological Sample Encapsulation Agent Comparative Example

[0089] A method for long-term room temperature preservation and extraction of DNA from cellular biological samples and their corresponding DNA preservatives includes the following steps:

[0090] (1) The formulation of the preservative includes the following components by weight: 800 parts tissue fixative anhydrous ethanol, 10 parts tissue permeation agent dimethyl sulfoxide, 7.5 parts reactive biological sample encapsulation agent tetramethoxysilane, 0.2 parts pH adjuster hydrochloric acid, 10 parts ion concentration adjuster sodium chloride, and 170 parts RNase-free purified water.

[0091] (2) Add 1 mL of the prepared preservative and 2 × 10 6 L929 cells were co-incubated at 26℃ for 3 hours to obtain preserved samples. The morphology of the samples was then observed using SEM. The results are as follows: Figure 2 As shown, the preserved biological samples can be stored at room temperature for a long time.

[0092] (3) Following the method in step (3) of Example 1, the genomic DNA concentration and cycle test CT value of the encapsulated samples were tested on days 1, 7, and 14 in a high temperature and high humidity environment. The DNA structural integrity of the day 1 samples was also examined. The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown.

[0093] The difference between this comparative example and Example 1 is that no reactive biological sample encapsulating agent was added to the cell biological sample.

[0094] Comparative Example 3: Cellular biological samples without encapsulation layer removal

[0095] A method for long-term room temperature preservation and extraction of DNA from cellular biological samples and their corresponding DNA preservatives includes the following steps:

[0096] (1) The formulation of the preservative includes the following components by weight: 800 parts of tissue fixative anhydrous ethanol, 10 parts of tissue permeation agent dimethyl sulfoxide, 7.5 parts of reactive cell encapsulation agent tetramethoxysilane, 0.2 parts of pH adjuster hydrochloric acid, 10 parts of ion concentration adjuster sodium chloride, and 170 parts of RNase-free purified water.

[0097] (2) Add 1 mL of the prepared preservative and 2 × 10 6 L929 cells were co-incubated at 26°C for 3 hours to obtain preserved samples. The morphology of the samples was then observed using SEM. The preserved biological samples can be stored at room temperature for a long time.

[0098] (3) Following the method in step (3) of Example 1, the genomic DNA concentration and cycle test CT value of the encapsulated samples were tested on days 1, 7, and 14 in a high temperature and high humidity environment. The DNA structural integrity of the day 1 samples was also examined. The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown.

[0099] The difference between this comparative example and Example 1 is that the biological sample encapsulation layer was not removed from the cell biological sample.

[0100] Comparative Example 4: Earthworm biological samples without tissue fixative

[0101] A method for long-term room temperature preservation and extraction of DNA from large-scale biological samples (such as earthworms) using biological samples and their DNA preservatives includes the following steps:

[0102] (1) The formulation of the preservative includes the following components by weight: 200 parts tissue permeation agent dimethyl sulfoxide, 7.5 parts reactive cell encapsulation agent tetramethoxysilane, 0.2 parts pH adjuster hydrochloric acid, 10 parts ion concentration adjuster sodium chloride, and 780 parts RNase-free purified water.

[0103] (2) 10 mL of the prepared preservative and 0.3 g of earthworm sample were incubated at 26℃ for 360 h. The solution was changed every 48 to 96 h during the incubation period. After the incubation was completed, the preserved sample was obtained and the morphology of the sample was observed by SEM.

[0104] (3) Following the method in step (3) of Example 1, the genomic DNA concentration and cycle test CT value of the encapsulated samples were tested on days 1, 7, and 14 in a high temperature and high humidity environment. The DNA structural integrity of the day 1 samples was also examined. The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown.

[0105] The difference between this comparative example and Example 2 is that no tissue fixative was added to the earthworm biological sample.

[0106] Comparative Example 5: Earthworm biological sample encapsulation agent comparative example

[0107] A method for long-term room temperature preservation and extraction of DNA from large-scale biological samples (such as earthworms) using biological samples and their DNA preservatives includes the following steps:

[0108] (1) The formulation of the preservative includes the following components by weight: 600 parts tissue fixative anhydrous ethanol, 200 parts tissue permeation agent dimethyl sulfoxide, 0.2 parts pH adjuster hydrochloric acid, 10 parts ion concentration adjuster sodium chloride, and 180 parts RNase-free purified water.

[0109] (2) 10 mL of the prepared preservative and 0.3 g of earthworm sample were incubated together at 26℃ for 360 h, with the solution changed every 48–96 h. After incubation, the preserved sample was obtained. The morphology of the sample was then observed using SEM and MicroCT. The results are as follows: Figure 5 and Figure 7 As shown.

[0110] (3) Following the method in step (3) of Example 1, the genomic DNA concentration and cycle test CT value of the encapsulated samples were tested on days 1, 7, and 14 in a high-temperature and high-humidity environment. The DNA structural integrity of the day 1 samples was also examined. The difference was that no BOE solution was added for soaking (the preservative did not contain encapsulating agent). The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown.

[0111] The difference between this comparative example and Example 2 is that no reactive biological sample encapsulating agent was added to the earthworm biological sample.

[0112] Comparative Example 6: Example without encapsulation layer removal

[0113] A method for long-term room temperature preservation and extraction of DNA from large-scale biological samples (such as earthworms) and their corresponding DNA preservatives includes the following steps:

[0114] (1) The formulation of the preservative includes the following components by weight: 600 parts tissue fixative anhydrous ethanol, 200 parts tissue permeation agent dimethyl sulfoxide, 7.5 parts reactive cell encapsulation agent tetramethoxysilane, 0.2 parts pH adjuster hydrochloric acid, 10 parts ion concentration adjuster sodium chloride, and 180 parts RNase-free purified water.

[0115] (2) 10 mL of the prepared preservative and 0.3 g of earthworm sample were incubated at 26℃ for 360 h. The solution was changed every 48 to 96 h during the incubation period. After the incubation was completed, the preserved sample was obtained and the morphology of the sample was observed by SEM.

[0116] (3) Referring to the method in step (3) of Comparative Example 4, the genomic DNA concentration and cycle test CT value of the encapsulated samples were tested on days 1, 7, and 14 in a high temperature and high humidity environment. The DNA structural integrity of the day 1 samples was also examined. The experimental results are shown in Tables 1-2 and 2. Figure 8 As shown.

[0117] The difference between this comparative example and Example 2 is that the earthworm biological sample did not have its biological sample encapsulation layer removed.

[0118] Table 1. Results of DNA concentration detection in samples

[0119]

[0120] *Data from day 0 represents unprocessed biological sample test results.

[0121] Table 2. CT value detection results in the samples.

[0122] Number 0 days CT value * ]] 1 day CT value 7 day CT value 14 day CT value Example 1 18.26 19.54 21.78 22.7 Example 2 15.75 16.41 17.25 17.50 Comparative Example 1 18.26 23.01 27.14 31.40 Comparative Example 2 18.26 19.75 22.54 28.13 Comparative Example 3 18.26 23.93 26.13 30.96 Comparative Example 4 15.75 23.85 28.42 31.33 Comparative Example 5 15.75 22.65 28.13 31.62 Comparative Example 6 15.75 18.67 23.11 28.69

[0123] *Data from day 0 represents unprocessed biological sample test results.

[0124] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A long-term preservation agent for biological sample genomic DNA at room temperature, characterized in that... It consists of the following components in parts by weight: 600-800 parts of anhydrous ethanol as tissue fixative, 10-200 parts of dimethyl sulfoxide as tissue permeation agent, 7.5 parts of tetramethoxysilane as reactive biological sample encapsulation agent, 0.2 parts of hydrochloric acid as pH adjuster, 10 parts of sodium chloride as ion concentration adjuster, and 170-180 parts of pure water; The biological sample referred to is a cell, tissue, or organ of animal origin.

2. A method for long-term preservation of genomic DNA from biological samples at room temperature, characterized in that... Includes the following steps: The biological sample is incubated with the biological sample at room temperature long-term preservation agent as described in claim 1 to obtain the preserved biological sample. The volume ratio of the preservative to the biological sample is 1000 to 1:1; The incubation conditions are 26℃~37℃ for a total incubation of 3~360 h; The biological sample referred to is a cell, tissue, or organ of animal origin.

3. The use of the biological sample long-term preservation agent at room temperature according to claim 1 in the preservation of animal-derived cells, tissues or organs.

Images