Method for measuring single-molecule RNA force spectrum and application thereof

By designing specially modified handle strand primers and microfluidic channel technology, combined with dual optical trap optical tweezers, the problem of single-molecule RNA force spectroscopy measurement was solved, achieving efficient and accurate RNA force spectroscopy detection.

CN116287109BActive Publication Date: 2026-06-23TSINGHUA UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TSINGHUA UNIVERSITY
Filing Date
2022-09-29
Publication Date
2026-06-23

Smart Images

  • Figure CN116287109B_ABST
    Figure CN116287109B_ABST
Patent Text Reader

Abstract

The application provides a method for measuring single-molecule RNA force spectrum and application thereof, and the method comprises the following steps: 1) obtaining handle chains: designing and synthesizing handle chain primers with special modifications; obtaining handle chains with special modifications according to the handle chain primers, wherein the handle chains comprise handle chain 1 and handle chain 2; the handle chain 1 and the handle chain 2 have sticky ends; 2) obtaining single-molecule RNA-handle complex chains: obtaining single-molecule RNA, wherein the RNA has a fragment which is complementary to the sticky ends; annealing the handle chains with the RNA to obtain single-molecule RNA-handle complex chains. The method can quickly and efficiently and accurately implement force spectrum measurement on a single RNA molecule. The single-molecule RNA complex chains prepared by the method can bear greater force, can be used for measurement of higher force, and can also be used for RNA structure analysis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for measuring the force spectrum of single-molecule RNA and its applications, belonging to the fields of biophysics and structural biology. Background Technology

[0002] RNA molecules have long been important biomolecules of interest to biologists. Early studies suggested that RNA played a crucial role in the central dogma, acting as a medium for transmitting genetic information between DNA and proteins. However, subsequent research revealed that most RNA molecules do not translate into proteins but instead possess a variety of important physiological functions, such as genetic coding, gene expression, gene regulation, and enzyme catalysis. From a molecular structural perspective, these functions can be achieved through either the primary sequence or secondary or tertiary structures. However, researchers do not fully understand the complex structure of RNA. Unlike the regular double helix structure of DNA, RNA molecules are generally single-stranded ribonucleic acid that folds into secondary or more complex tertiary structures through base pairing. Furthermore, RNA molecules frequently interact with other molecules (proteins, DNA / RNA, small molecules, etc.), and their conformation often changes in real time. For example, the coronavirus genome, a single-stranded positive-sense RNA virus, has a pseudoknot structure at the end of open reading frame 1a, which allows the ribosome to perform a -1 frameshift, enabling the translation of a longer polypeptide 1ab at open reading frame 1b. This frameshift behavior is generally believed to be related to the special pseudoknot structure at this location.

[0003] Currently, the structures of most RNA molecules with significant biomedical value remain unknown, and it is difficult to accurately predict their structure and function using sequence information. Different methods are needed to analyze their structures and study their functions, such as SHAPE, X-ray diffraction, nuclear magnetic resonance (NMR), and cryo-electron microscopy. SHAPE uses electrophilic reagents to react with 2-hydroxyl groups of varying reactivity, resolving the structure of RNA molecules through reverse transcription. This method has been successfully used for the structural analysis of many important RNA molecules; however, it primarily obtains RNA secondary structures, providing relatively limited information. X-ray diffraction and cryo-electron microscopy are complex and difficult to widely apply, while NMR has significant limitations on RNA size, making it difficult to detect larger RNA molecules (>60 nt).

[0004] Optical tweezers, also known as gradient force optical traps, use focused lasers to exert forces on objects. Since its inception, optical tweezers have received widespread attention for their applications in the biological field, leading to Ashkin being awarded the Nobel Prize in Physics in 2018 for his work. Compared to other single-molecule force spectroscopy techniques, optical tweezers offer higher spatial (sub-nanometer), mechanical (sub-pico-Newton), and temporal (sub-millisecond) resolutions, characteristics consistent with the inherent properties of RNA molecules, such as length (a single nucleotide is approximately 0.59 nm) and mechanical properties (0-30 pN). With the development of optical tweezers, dual-trap optical tweezers have matured. Unlike traditional single-molecule force spectroscopy techniques (single-trap optical tweezers, magnetic tweezers, atomic force microscopy) which fix one end of the molecule to a glass, substrate, or probe surface, dual-trap optical tweezers fix the molecule between suspended microspheres. Furthermore, the use of advanced devices such as piezoelectric platforms and avalanche photodiodes significantly reduces the influence of the external environment, improving the resolution and stability of the technique. Currently, single-molecule force spectroscopy has been widely used in the force spectroscopy research of DNA and proteins, and the technology is relatively mature. However, due to the instability and complex structure of RNA molecules, it is difficult to establish force spectroscopy experimental methods, and there is a lack of research on single-molecule RNA force spectroscopy. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a method for measuring the force spectrum of single-molecule RNA and its application.

[0006] On one hand, the present invention provides a method for measuring the force spectrum of a single RNA molecule, the method comprising:

[0007] 1) Obtaining the handle chain: Designing and synthesizing a specially modified handle chain primer; obtaining a specially modified handle chain based on the handle chain primer, the handle chain comprising handle chain 1 and handle chain 2; the handle chain 1 and handle chain 2 having sticky ends; preferably, the handle chain is a double-stranded DNA with sticky ends; preferably, the sticky ends are 30-100 nt in length, more preferably 30-50 nt;

[0008] 2) Obtaining a single RNA-handle complex: Obtain a single RNA molecule containing a fragment complementary to the sticky ends described above; anneal the handle chain with the RNA to obtain a single RNA-handle complex.

[0009] According to a specific embodiment of the present invention, the method further includes designing and constructing a plasmid; the plasmid contains a template DNA sequence and a handle strand sequence of the RNA to be studied; primers with special modifications are designed based on the plasmid; and the DNA template, handle strand 1, and handle strand 2 of the RNA molecule to be studied are obtained based on the designed plasmid and primers.

[0010] According to a specific embodiment of the present invention, the method further includes obtaining a single RNA molecule based on the DNA template of the RNA molecule to be studied.

[0011] According to a specific embodiment of the present invention, the method further includes obtaining standard double-stranded DNA; the standard double-stranded DNA is obtained by amplification using a handle strand primer as an amplification primer; the standard double-stranded DNA molecule is directly used to verify the single-molecule experimental system.

[0012] Preferably, the standard double-stranded DNA is obtained by amplification using the upstream primer of handle strand 1 and the downstream primer of handle strand 2 as amplification primers.

[0013] According to a specific embodiment of the present invention, the primer and / or handle chain has one or more special modifying molecules;

[0014] Preferably, the primer and / or handle chain has 3, 4 or 5 or more special modifying molecules.

[0015] Preferably, the special modification includes one or more of the following: digoxigenin modification, biotin modification, d-spacer modification, phophate modification, thiophosphate modification, and azide group modification;

[0016] Preferably, the special modification is digoxin.

[0017] Preferably, the primers and / or handle chains are modified with more than three digoxigenin molecules;

[0018] Preferably, the handle chain has 3-5 digoxin decorations.

[0019] According to a specific embodiment of the present invention, the upstream primer 1F of the handle chain 1 is further modified with digoxigenin, and the downstream primer 1R is modified with d-spacer, and the downstream primer 1R has a sticky end sequence 1 for annealing with RNA; the upstream primer 2F of the handle chain 2 is modified with phosphate, the downstream primer 2R is modified with biotin, and the upstream primer 2F has a sticky end sequence 2 for annealing with RNA.

[0020] According to a specific embodiment of the present invention, the handle chains are respectively equipped with special decorations and adhesive ends;

[0021] Preferably, the handle chain 1 is specially decorated and has an adhesive end 1 with a length of 30-100nt;

[0022] Preferably, the handle chain 2 is specially decorated and has an adhesive end 2 with a length of 30-100nt;

[0023] Preferably, the sticky end 1 comprises a segment of the sequence shown in SEQ ID NO.7;

[0024] Preferably, the sticky end 2 comprises a segment of the sequence shown in SEQ ID NO.8.

[0025] According to a specific embodiment of the present invention, the method includes obtaining handle strands and / or standard double-stranded DNA of different lengths by changing the spacing between upstream and downstream primers;

[0026] Preferably, the length of the handle strand and / or standard double-stranded DNA can be changed by altering the plasmid size;

[0027] Preferably, the length of the handle strand and / or standard double-stranded DNA can be changed by altering the binding position of the primers on the template. Preferably, the handle strand of the present invention is 1 kb in length.

[0028] The primers designed using this method have great scalability, allowing for the preparation of handle chains of different lengths, which are suitable for force spectroscopy measurements of molecules of different sizes, thus expanding their applications.

[0029] According to a specific embodiment of the present invention, the handle chain is used to connect a single RNA molecule to a surface; the surface is a surface modified to bind with a special modified molecule to handle chain 1 and / or handle chain 2.

[0030] According to a specific embodiment of the present invention, the method further includes designing primers with sequences complementary to the sticky end sequence to ultimately obtain RNA with fragments complementary to the sticky end.

[0031] According to a specific embodiment of the present invention, the handle chain primer comprises primers with sequences as shown in SEQ ID NO.1-SEQ ID NO.4.

[0032] According to a specific embodiment of the present invention, the annealing is performed by mixing the RNA molecule to be studied with handle chain 1 and handle chain 2 in a molar ratio of (0.7-2):1:1 and then annealing.

[0033] Preferably, the annealing is performed by mixing the RNA molecule to be studied with handle chain 1 and handle chain 2 in a molar ratio of 1:1:1 and then annealing.

[0034] According to a specific embodiment of the present invention, the annealing temperature is 50-65°C;

[0035] Preferably, the annealing temperature is 62°C and / or 52°C.

[0036] More preferably, the annealing conditions are: 98°C for 10 minutes, 62°C for 1 hour, 52°C for 1 hour, and the reaction is terminated at 4°C.

[0037] According to a specific embodiment of the present invention, the annealing buffer is a buffer solution containing formamide and PIPES;

[0038] Preferably, the annealing buffer contains 60%-80% formamide by volume;

[0039] More preferably, the annealing buffer is a solution with pH 7.5 containing: 80% formamide, 400mM NaCl, 40mM PIPES and 1mM EDTA.

[0040] According to a specific embodiment of the present invention, the method further includes performing molecular force spectroscopy detection, wherein the force spectroscopy detection is performed in a measurement buffer solution containing an oxygen removal system and / or an RNase inhibitor; the oxygen removal system and the RNase inhibitor can keep the RNA molecules in an anaerobic aqueous solution environment, prevent the RNA from being degraded by enzymes, and improve the stability of the RNA in experiments.

[0041] Preferably, the deoxygenation system comprises glucose oxidase, catalase, and glucose;

[0042] Preferably, the deoxygenation system comprises 160 units / ml glucose oxidase, 100 units / ml catalase, and 0.8% glucose by mass.

[0043] Preferably, the measurement buffer solution contains NaCl and EDTA. + or Mg 2+ The buffer solution is preferably a Hepes or Tris-HCl buffer solution.

[0044] According to a specific embodiment of the present invention, the force spectrum detection is performed using a microfluidic channel. The sample in the microfluidic channel is as follows: a single-molecule RNA-handle complex or a standard double-stranded DNA single-molecule sample is incubated with microspheres 1, a measurement buffer solution is added, and the sample is placed in channel 1; a measurement buffer solution is added to channel 2; and channel 3 contains a solution of microspheres 2. The sample is introduced into the microfluidic channel, and an oxygen removal system and an RNase inhibitor are added to each channel; a force spectrum detection system is formed in the microfluidic channel, and molecular force spectrum detection is performed. The microfluidic channel is used to control and separate samples of different components, avoid interference, and rapidly and efficiently conduct single-molecule force spectrum experiments.

[0045] According to a specific embodiment of the present invention, the force spectrum detection includes: fixing one or both ends of the RNA-handler complex and acquiring data; the data is preferably force, time and / or distance;

[0046] Preferably, the force spectrum detection includes: fixing one end of the RNA-handler complex and moving it in a single direction at the other end to acquire data such as force, time, and distance;

[0047] Preferably, the force spectrum detection includes: fixing the distance or force between the two ends of the RNA-handle complex, and acquiring data such as RNA molecule force or distance and time;

[0048] Preferably, the force spectrum detection includes: fixing both ends of the RNA molecule and obtaining changes in distance, force parameters, etc., when the RNA molecule interacts with other molecules; the other molecules are preferably small molecules or proteins;

[0049] Preferably, during the force spectrum detection process, dual-light-trap optical tweezers, magnetic tweezers, acoustic tweezers, or atomic force microscopy are used to control the movement and fixation of one and / or both ends. This method uses dual-light-trap optical tweezers to move and fix the microspheres when measuring molecular force spectra, reducing sample contact with the external physical environment, minimizing external environmental interference, and improving the stability of the measurement mechanics and distance.

[0050] According to a specific embodiment of the present invention, the formation of the force spectrum detection system includes: controlling microspheres 1 and 2 to simultaneously connect a single RNA complex or a standard double-stranded DNA to microspheres 1 and 2 to form a force spectrum detection system.

[0051] On the other hand, the present invention provides a primer composed of sequences selected from SEQ ID NO.1-SEQ ID NO.4.

[0052] According to a specific embodiment of the present invention, the primer carries one or more special modifying molecules; preferably, the primer carries three, four or five or more special modifying molecules.

[0053] According to a specific embodiment of the present invention, the special modification includes one or more of the following: digoxigenin modification, biotin modification, d-spacer modification, phosphate modification, thiophosphate modification, and azide group modification; preferably, the special modification is digoxigenin.

[0054] According to a specific embodiment of the present invention, the primer is modified with more than three digoxigenin molecules;

[0055] Preferably, the handle chain has 3-5 digoxin decorations.

[0056] The design of the handle and sticky end in this invention enables the single-molecule RNA-handle complex obtained by this invention to withstand higher forces, preferably 50-60 pN.

[0057] On the other hand, the present invention provides an adhesive end composed of sequences selected from SEQ ID NO.7-SEQ ID NO.8.

[0058] On the other hand, the present invention provides a kit for measuring the force spectrum of single-molecule RNA, wherein the kit comprises at least one of the primers and / or at least one of the sticky ends described herein.

[0059] According to a specific embodiment of the present invention, the kit includes an annealing buffer containing formamide and PIPES;

[0060] Preferably, the annealing buffer contains 60%-80% formamide by volume;

[0061] More preferably, the annealing buffer is a solution with pH 7.5 containing: 80% formamide, 400mM NaCl, 40mM PIPES and 1mM EDTA.

[0062] According to a specific embodiment of the present invention, the kit includes an oxygen removal system and / or an RNase inhibitor;

[0063] Preferably, the deoxygenation system is a buffer solution containing glucose oxidase, catalase and glucose;

[0064] Preferably, the deoxygenation system is a buffer solution containing 160 units / mL glucose oxidase, 100 units / mL catalase, and 0.8% glucose by mass.

[0065] The beneficial effects of this invention are as follows:

[0066] This method provides a rapid and efficient experimental approach for measuring single-molecule RNA samples, enabling rapid, efficient, and accurate force spectroscopy measurements of individual RNA molecules. Furthermore, this method exhibits good reproducibility. Specifically, this invention offers the following advantages:

[0067] 1. In this invention, the handle strand is connected to RNA with sticky ends to form a double strand, resulting in a tighter connection between the handle and the single RNA molecule. The handle of this invention is a DNA double strand, and the overall single RNA-handle complex has a higher proportion of DNA double strands, giving it greater stability and the ability to withstand greater forces, making it suitable for higher forces and more precise measurements. Similarly, this invention is also applicable to RNA structure analysis.

[0068] 2. The present invention uses a handle chain with special modifications, preferably a handle chain with three or more special molecules modified, the connection between the handle and the fixed surface is tighter, it can withstand greater force, and it is suitable for measuring higher forces.

[0069] 3. This invention designs a better sticky end length and more efficient annealing conditions, making the annealing and connection of RNA samples to the handle strand more efficient.

[0070] 4. This invention designs a measurement system more suitable for RNA force spectroscopy measurement, especially by adding an oxygen removal system and / or RNase inhibitors, making the measurement environment more suitable for RNA. Attached Figure Description

[0071] Figure 1 This is the experimental flowchart for this method.

[0072] Figure 2 Gel electrophoresis diagrams of standard double-stranded DNA, handle strand 1, handle strand 2, and RNA molecules.

[0073] Figure 3 This is a schematic diagram of a multi-channel microfluidic chip used in the experiment.

[0074] Figure 4 This is a single-molecule force spectrum of a 3kbp double-stranded DNA.

[0075] Figure 5 This is a curve showing the fit of the force spectrum of a single RNA molecule.

[0076] Figure 6 This is a schematic diagram of the plasmid design for the standard double-stranded DNA, handle strand 1, handle strand 2, and primers used in this method.

[0077] Figure 7 To investigate the conditions for annealing solutions with different formamide concentrations.

[0078] Figure 8 To change the plasmid size, 1F, 1R, 2F, and 2R were used to amplify longer handles 3 and 4. Detailed Implementation

[0079] This invention provides a method for measuring the force spectrum of a single RNA molecule, the method comprising:

[0080] 1) Obtaining the handle chain: Design and synthesize a specially modified handle chain primer; obtain a specially modified handle chain based on the handle chain primer, the handle chain including handle chain 1 and handle chain 2; the handle chain 1 and handle chain 2 have sticky ends; preferably, the handle chain is a double-stranded DNA with sticky ends; preferably, the sticky ends are 30-100 nt in length.

[0081] 2) Obtaining a single RNA-handle complex: Obtain a single RNA molecule containing a fragment complementary to the sticky ends described above; anneal the handle chain with the RNA to obtain a single RNA-handle complex.

[0082] According to a specific embodiment of the present invention, the method for measuring the force spectrum of single-molecule RNA includes:

[0083] 1) Obtaining the handle strand and other required double-stranded DNA: Designing and synthesizing specially modified handle strand primers; obtaining specially modified handle strands based on the handle strand primers, the handle strands including handle strand 1 and handle strand 2; the handle strand 1 and handle strand 2 have sticky ends; preferably, the handle strand is double-stranded DNA with sticky ends; preferably, the sticky ends are 30-100 nt in length; obtaining the DNA template for the RNA molecule to be studied.

[0084] The primers of the handle chain 1 include: the upstream primer 1F of the handle chain 1 has one or more digoxigenin modifications at its 5' end, the downstream primer 1R has d-spacer modifications in its chain, and the 5' end of the downstream primer 1R has a sticky end sequence 1 to be annealed to the 5' end of the RNA.

[0085] The primers of the handle chain 2 are as follows: the 5' end of the upstream primer 2F of the handle chain 2 is modified with phosphate, the upstream primer 2F chain is modified with thiophosphate, and the 5' end of the upstream primer 2F has a sticky end sequence 2 to be annealed to the 3' end of the RNA; the 5' end of the downstream primer 2R of the handle chain 2 is modified with one or more biotins.

[0086] The process involved obtaining handle strand 1, handle strand 2, and standard double-stranded DNA: using the designed plasmid as a template, PCR was performed using the designed primers 1F, 1R, 2F, and 2R. The PCR conditions were: 98℃ for 1 minute, 98℃ for 10 seconds, 58℃ for 30 seconds, 72℃ for 30 seconds, 60 seconds, or 90 seconds, for 35 cycles, and then the reaction was terminated at 4℃. After the PCR reaction, the products were separated by gel electrophoresis to obtain handle strand 1, handle strand 2, and standard double-stranded DNA, respectively.

[0087] The 5' and 3' ends of the handle chain 1 are respectively modified with digoxin and have sticky ends with a sequence length of 30-100nt;

[0088] The 5' and 3' ends of the handle chain 2 are respectively modified with biotin and have sticky ends with a sequence length of 30-100nt;

[0089] The process involves obtaining the DNA template for the RNA molecule under study: Based on the RNA sequence, upstream primer 3F and downstream primer 3R are designed. The 5' end of upstream primer 3F contains a sequence complementary to the sticky end sequence 1 of the handle strand 1, and the 5' end of downstream primer 3R contains a sequence complementary to the sticky end sequence 2 of the handle strand 2. Using the designed and constructed plasmid as a template, PCR reaction is performed using primers 3F and 3R to synthesize the DNA template corresponding to the RNA under study.

[0090] 2) Obtaining a single RNA-handle complex: Obtain a single RNA molecule containing a fragment complementary to the sticky ends described above; anneal the handle chain with the RNA to obtain a single RNA-handle complex.

[0091] The method for obtaining the RNA molecule to be studied involves using a T7 reagent kit to transcribe the RNA molecule to be studied using the DNA template corresponding to the RNA molecule to be studied as a substrate. The 5' and 3' ends of the RNA molecule to be studied have sequences that are complementary to the sticky ends of handle chain 1 and handle chain 2, and the length of the complementary sequence is 30-50 nt.

[0092] The method for obtaining a single-molecule RNA-handler complex involves mixing the RNA molecule to be studied with handleler chain 1 and handleler chain 2 in a molar ratio of 1:1:1 and then annealing the mixture. The annealing conditions are: 98℃ for 10 minutes, 62℃ for 1 hour, 52℃ for 1 hour, and 4℃ to terminate the reaction. After the reaction is terminated, the mixture is precipitated with ethanol and dissolved in 10 μL of H2O to obtain the single-molecule RNA-handler complex.

[0093] 3) Molecular force spectroscopy detection using microfluidic channels: Samples are introduced into microfluidic channels, and an oxygen removal system and RNase inhibitor are added to each channel; a force spectroscopy detection system is formed in the microfluidic channels and molecular force spectroscopy detection is performed;

[0094] The process of introducing different samples into the microfluidic channels involves using microfluidic channels to separate different samples. Specifically, 1 μL of a single RNA-handle complex or a standard double-stranded DNA single-molecule sample is incubated with 1 μL of anti-digoxigenin microspheres 1 at room temperature for 5 minutes, followed by the addition of 1 mL of measurement buffer solution, and placed in channel 1. Measurement buffer solution is added to channel 2. Channel 3 contains a solution of streptomycin affinity-modified microspheres 2. An oxygen removal system and an RNase inhibitor are added to each channel.

[0095] The preparation process of microspheres 1 and 2 is as follows: carboxyl-modified microspheres are activated with 5 μg / ml EDC and NHS. After 20 minutes, anti-digoxin protein is added and coupled to the activated microspheres to obtain anti-digoxin modified microspheres 1; streptomycin is added after activation to obtain streptomycin modified microspheres 2.

[0096] The formation of the force spectrum detection system involves: using optical trap 1 to capture microsphere 1 in channel 1, and optical trap 2 to capture microsphere 2 in channel 3; moving optical trap 1 and optical trap 2 to channel 2; and slowly bringing optical trap 1 and optical trap 2 closer together, so that the single-molecule RNA complex or standard double-stranded DNA sample on microsphere 1 specifically binds to microsphere 2 to form the force spectrum detection system.

[0097] The force spectrum detection involves fixing microsphere 1 or microsphere 2, moving another microsphere horizontally, and acquiring data such as force, time, and distance.

[0098] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0099] Experimental methods not specified in the examples are generally performed under standard conditions and as described in the manual, or as recommended by the manufacturer. Unless otherwise specified, all general equipment, materials, reagents, etc., used are commercially available from Sigma.

[0100] Example 1

[0101] This embodiment provides a rapid and efficient method for measuring single-molecule RNA samples. The experimental procedure of this method is as follows: Figure 1 As shown.

[0102] The steps for rapid and efficient measurement of single-molecule RNA samples are as follows:

[0103] 1) Obtain handle strand and other required DNA: Design and construct a plasmid containing the RNA molecule to be studied, handle strand 1 and handle strand 2 DNA sequences; and design primers with special modifications based on the plasmid; obtain the DNA template of the RNA molecule to be studied, handle strand 1, handle strand 2 and standard double-stranded DNA based on the designed plasmid and primers; the handle strand 1 and handle strand 2 are double-stranded DNA with sticky ends;

[0104] The primers for the handle chain 1 are as follows: the upstream primer 1F of the handle chain 1 has a digoxigenin-modified 5' end, the downstream primer 1R has a phosphate-modified 5' end, and the downstream primer 1R has a d-spacer modification in its chain. The downstream primer 1R has a sticky end sequence 1 at its 5' end to be annealed to the 5' end of the RNA. The primer sequences are shown in Table 1.

[0105] The primers for the handle chain 2 include: upstream primer 2F with a phosphate-modified 5' end, upstream primer 2F with a thiophosphate-modified 5' end, and upstream primer 2F with a sticky end sequence 2 at its 5' end to anneal to the 3' end of the RNA; and downstream primer 2R with a biotin-modified 5' end. The primer sequences are shown in Table 1. All primers used in this experiment were synthesized from Genscript Biotech Inc. In this invention, "T" represents uracil "U".

[0106] Table 1

[0107]

[0108] Among these, handle strand 1, handle strand 2, and standard double-stranded DNA were obtained: (Reference) Figure 6 To illustrate, primers 1F, 1R, 2F, and 2R were designed and synthesized. PCR was performed using polymerase (F530, Thermo). The PCR conditions were: 98℃ for 1 minute, 98℃ for 10 seconds, 58℃ for 30 seconds, 72℃ for 30 seconds, 60 seconds, or 90 seconds, for 35 cycles, followed by termination at 4℃. After the PCR reaction, the products were separated by gel electrophoresis, and recovered using a Tiangen kit (DP209, Tiangen Biotech (Beijing) Co., Ltd.). Handle strand 1, handle strand 2, and standard double-stranded DNA were obtained. The electrophoresis images of single-molecule samples of handle strand 1, handle strand 2, and standard double-stranded DNA are shown below. Figure 2 As shown.

[0109] The handle chain 1 has 5 digoxin-modified ends and 3' ends with adhesive ends 1 with a sequence length of 36nt, respectively. The sequence of adhesive ends 1 is shown in Table 1.

[0110] The handle chain 2 has 5' end and 3' end respectively with 2 A biotin-modified, sticky end 2 with a sequence length of 35 nt is shown in Table 1.

[0111] The process involves obtaining the DNA template for the RNA molecule to be studied: Based on the RNA sequence, upstream primer 3F and downstream primer 3R are designed. The 5' end of the upstream primer 3F has a sequence complementary to the sticky end sequence 1 of the handle strand 1, and the 5' end of the downstream primer 3R has a sequence complementary to the sticky end sequence 2 of the handle strand 2. The sequences of primers 3F and 3R are shown in Table 1.

[0112] PCR was performed using primers 3F and 3R to synthesize the DNA template corresponding to the RNA to be studied (the DNA template sequence corresponding to the RNA to be studied is shown in Table 1).

[0113] 2) Obtaining a single-molecule RNA-handler complex: The RNA molecule to be studied is obtained based on the DNA template of the RNA molecule to be studied; the 5' and 3' ends of the RNA molecule to be studied have sequences that are complementary to the sticky ends of handle chain 1 and handle chain 2, and the length of the complementary sequence is 30-100 nt; the RNA molecule to be studied is mixed with handle chain 1 and handle chain 2 and then annealed to obtain a single-molecule RNA-handler complex.

[0114] The process of obtaining the RNA molecule to be studied involves: using the DNA template corresponding to the RNA molecule as a substrate, transcription is performed using a T7 reagent kit (E2040S, NEB) to obtain the RNA molecule to be studied; the 5' and 3' ends of the RNA molecule to be studied have sequences complementary to the sticky ends of handle strand 1 and handle strand 2, and the length of the complementary sequences is 30-100 nt; the electrophoresis image of the obtained RNA molecule sample is shown below. Figure 2 As shown.

[0115] The method for obtaining a single-molecule RNA-handler complex involves: purifying the RNA molecule to be studied with handleler strand 1 and handleler strand 2 separately, mixing them in a molar ratio of 1:1:1, and then annealing them in a solution containing 80% formamide (F9037, Sigma), 400 mM NaCl, 40 mM PIPES, 1 mM EDTA, and pH 7.5. The annealing conditions are: 98℃ for 10 minutes, 62℃ for 1 hour, 52℃ for 1 hour, and terminating the reaction at 4℃. After the reaction is terminated, the mixture is precipitated with ethanol and dissolved in 10 μL of H2O to obtain the single-molecule RNA-handler complex. This single-molecule RNA complex possesses affinity molecular ends, allowing it to bind to corresponding microspheres for the determination of larger force values.

[0116] 3) Molecular force spectroscopy detection using microfluidic channels: Different samples are separated by microfluidic channels, and different samples are introduced into the microfluidic channels. An oxygen removal system and an RNase inhibitor (N8080119, Thermo) are added to each channel. A force spectroscopy detection system is formed in the microfluidic channels and molecular force spectroscopy detection is performed.

[0117] The step of introducing different samples into the microfluidic channel involves using a microfluidic channel to separate different samples. A schematic diagram of the microfluidic channel is shown below. Figure 3As shown. 1 μL of a single RNA-handle complex or a standard double-stranded DNA sample was incubated with 1 μL of anti-digoxigenin (11222089001, Roche) microspheres 1 at room temperature for 5 minutes. 1 mL of measurement buffer was added and placed in channel 1; measurement buffer was added to channel 2; channel 3 contained streptomycin affinity-modified microspheres 2 (SVP-08-10, Spherotech); each channel contained an oxygen removal system and an RNase inhibitor; the measurement buffer used in this method was a buffer solution containing 20 mM Hepes, 100 mM NaCl, and 0.2 mM EDTA.

[0118] The preparation process of microspheres 1 and 2 is as follows: Carboxyl-modified microspheres are activated using 5 μg / ml EDC and NHS. After 20 minutes, anti-digoxigenin is added and coupled to the activated microspheres to obtain anti-digoxigenin modified microspheres 1; after activation, streptomycin is added for coupling to obtain streptomycin modified microspheres 2. The connection methods between nucleic acid macromolecules and between nucleic acid molecules and microspheres are described in [details omitted]. Figure 1 As shown.

[0119] The formation of the force spectrum detection system involves: using optical trap 1 to capture microsphere 1 in channel 1, and optical trap 2 to capture microsphere 2 in channel 3. Optical traps 1 and 2 are moved to channel 2, slowly approaching each other, causing the single-molecule RNA complex or standard double-stranded DNA sample on microsphere 1 to specifically bind to microsphere 2, thus forming the force spectrum detection system. This method uses a microfluidic chip, introducing different samples into the chip to rapidly form a detection system, enabling efficient force spectrum detection of target RNA molecules.

[0120] The force spectrum detection involves fixing microsphere 1 or microsphere 2 and moving another microsphere in a single direction to obtain data such as force, time, and distance.

[0121] This embodiment uses a dual optical trap optical tweezers manufactured by Lumicks as an example when measuring single-molecule force spectra, but is not limited to this device.

[0122] Example 2

[0123] This embodiment investigates the annealing effect of annealing buffer solutions containing different volume fractions of formamide during the annealing of RNA and the handle chain in the process of obtaining single-molecule RNA-handler complexes. The specific operation is as follows:

[0124] ① The RNA and handle chain were obtained using the same method as in Example 1;

[0125] ② The same RNA and handle strand were annealed in PIPES buffer solution containing 30%, 40%, 50%, 60%, 70% and 80% formamide by volume, respectively. The annealing conditions were the same for each group except for the concentration of formamide.

[0126] ③ The single RNA-handle complex obtained from each group was subjected to subsequent force spectroscopy measurements using the same method as in Example 1.

[0127] The electrophoresis results after annealing are as follows Figure 7 As shown, gel electrophoresis results alone cannot determine whether the RNA-handle complexes in each group were successfully ligated; subsequent force spectroscopy measurements are needed to assess the suitability of the annealing conditions. Force spectroscopy experiments revealed that the probability of forming RNA monomolecules increased with increasing formamide concentration. Furthermore, annealing in an 80% (v / v) formamide solution resulted in approximately 1.6 times the formation of RNA monomolecules compared to a 50% (v / v) formamide solution. We determined that a PIPES buffer solution containing 80% (v / v) formamide was the optimal annealing condition. Therefore, the most suitable annealing buffer is a solution containing 80% (v / v) formamide, 400 mM NaCl, 40 mM PIPES, and 1 mM EDTA at pH 7.5.

[0128] Example 3

[0129] This embodiment investigates the annealing effects of different annealing procedures during the annealing of RNA and the handle strand in the process of obtaining a single-molecule RNA-handler complex. The specific operation is as follows:

[0130] ① The RNA and handle chain were obtained using the same method as in Example 1;

[0131] ② The same RNA and handle strand were annealed in the same reaction system but with different reaction programs. The annealing conditions were the same for each group, except for the annealing program itself. The different annealing reaction programs were as follows:

[0132] Program 1: 98℃ for 10 minutes, 62℃ for 1 hour, 52℃ for 1 hour, 4℃ to terminate the reaction;

[0133] Procedure 2: 95℃ for 10 minutes, followed by gradient cooling at a rate of 1℃ / min, and terminate the reaction at 4℃;

[0134] ③ After annealing, the single RNA-handle complex obtained from each group was subjected to subsequent force spectroscopy measurements using the same method as in Example 1.

[0135] The formation efficiency of the RNA-handler complex was determined by force spectroscopy. The force spectroscopy results showed that the probability of forming valid data under the reaction conditions of procedure 1 was 10%. We determined that the annealing conditions of 62℃ for 1 hour and 52℃ for 1 hour yielded the best RNA-handler complex formation efficiency. Therefore, the optimal annealing conditions were: 98℃ for 10 minutes, 62℃ for 1 hour, 52℃ for 1 hour, and termination of the reaction at 4℃.

[0136] Example 4

[0137] This embodiment provides an experiment in which handle chains of different lengths are amplified by expanding plasmids using primers 1F, 1R, 2F and 2R provided in Example 1.

[0138] The PCR conditions were: 98℃ for 1 minute, 98℃ for 10 seconds, 58℃ for 30 seconds, and 72℃ for 240 seconds, for 35 cycles, followed by termination at 4℃. After the PCR reaction, the products were separated by gel electrophoresis, and recovered using a Tiangen reagent kit (DP209, Tiangen Biotech (Beijing) Co., Ltd.). Handlebar strand 1, handlebar strand 2, and standard double-stranded DNA were obtained. The electrophoresis images of single-molecule samples of handlebar strand 1, handlebar strand 2, and standard double-stranded DNA are shown below. Figure 8 As shown.

[0139] Depend on Figure 8 It is known that handle chains 3 and 4 have significantly larger molecular weights than handle chains 1 and 2. That is, when amplifying handle chains using primers 1F, 1R, 2F, and 2R, handle chains of different lengths can be obtained by changing the plasmid. Handle chains of different lengths are suitable for more types of force spectroscopy experiments and can meet more force spectroscopy measurement needs.

[0140] Example 5

[0141] This embodiment uses the same method as in Example 1 to measure the force spectra of multiple groups of DNA and RNA molecules.

[0142] ① The experimental results of measuring the single-molecule force spectrum of 3kbp double-stranded DNA are shown in the figure. Figure 4 As shown.

[0143] ②The results of the RNA single-molecule force spectrum measurement experiment are shown in Figure 5 As shown.

[0144] from Figure 4 As can be seen, this method uses more stable double-stranded DNA as a handle, which can withstand a greater force of approximately 60 pN for measurement.

[0145] from Figure 5 It can be seen that the force spectrum curve of the single RNA complex prepared by this method can show the force spectrum changes of the RNA structure under constant speed stretching.

[0146] Example 6

[0147] This embodiment provides a kit containing adhesive ends, the sequences of which are shown in SEQ ID NO.7 or SEQ ID NO.8, or as shown in the complementary sequence of SEQ ID NO.7 (SEQ ID NO.11: GAATTCGGCTACGTAGCTCAGTTGGTTAGAGCAGCG) or the complementary sequence of SEQ ID NO.8 (SEQ ID NO.12: GTCACAGGTTCGAATCCCGTCGTAGCCACCACTGC).

[0148] The kit described in this embodiment can be used to construct RNA with sticky ends, as shown in the structure: "sticky end 1—RNA—sticky end 2". The RNA in this structure can be any single RNA molecule. For example, RNA with sticky ends is: GAATTCGGCTACGTAGCTCAGTTGGTTAGAGCAGCG (SEQ ID NO.11)—RNA—GTCACAGGTTCGAATCCCGTCGTAGCCACCACTGC (SEQ ID NO.12).

[0149] Preferably, this kit is suitable for measuring the molecular force spectrum of RNA with a length of 40-500 nt.

[0150] The kit in this embodiment also includes: a solution of 80% formamide, 400mM NaCl, 40mM PIPES and 1mM EDTA at pH 7.5, as well as an oxygen removal system and / or an RNase inhibitor.

[0151] The kit in this embodiment can be used with the method provided by the present invention for force spectroscopy measurement of single RNA molecules.

[0152] The above embodiments can be partially adjusted by those skilled in the art in different ways without departing from the principles and purpose of the invention. The scope of protection of the present invention is defined by the claims and is not limited to the specific implementations described above. All implementations within the scope of the claims are subject to the present invention.

[0153] Compared with traditional methods, the method for measuring the force spectrum of single RNA molecules in this invention has the following advantages:

[0154] 1. Traditional methods for designing handles use a mixed complementary pairing of DNA and RNA strands. Because DNA and RNA have different nucleotide compositions, force spectrum data analysis of the handles using this method is difficult and lacks standardized data for comparison. In contrast, this method uses double-stranded DNA as the handle, and its force spectrum data can be calculated based on mathematical equations, providing a standardized reference. Figure 4As shown, the double-stranded DNA handle obtained by this method coincides with the theoretical curve, demonstrating that the handle prepared by this method has extremely high accuracy and can be used for subsequent high-precision RNA single-molecule force spectroscopy analysis.

[0155] 2. Traditional methods lack high-precision measurements of RNA molecular force spectroscopy; this method fills a gap in this research field. This method enables the rapid and efficient establishment of an experimental system for measuring RNA single-molecule force spectroscopy.

[0156] This method simplifies the experimental procedure for single-molecule force spectroscopy while improving detection efficiency and accuracy. By designing primers with specific site modifications, the required molecules—a handle chain, a standard double-stranded DNA molecule, and the RNA molecule under study—are rapidly prepared on a pre-constructed plasmid. These primers possess sticky ends and affinity molecules, allowing the RNA molecule under study to efficiently form a single-molecule RNA complex with the handle chain via annealing. Simultaneously, the single-molecule RNA complex is more tightly bound to the microspheres, enabling it to withstand greater forces for measuring higher forces. Finally, different samples are introduced into a microfluidic chip to rapidly form a detection system for efficient force spectroscopy detection of the target RNA molecule.

[0157] This invention can be widely applied to the measurement of the mechanical and dynamic behavior of nucleic acid molecules, and the measurement of the interactions between nucleic acid molecules and other molecules such as small molecules, proteins, and other nucleic acid-containing complexes. Specific areas covered include basic and applied scientific research with the aforementioned needs; high-precision quantitative measurement, comparison, and screening of the binding effects of small molecule drugs and various macromolecular drugs with nucleic acids during the development of targeted nucleic acid drugs; the proposal or improvement of design schemes in the design of mRNA drugs or vaccines; and quantitative measurements related to the pathogenesis and treatment of nucleic acid-related patients in medical research.

[0158] This method can rapidly and efficiently construct a single-molecule RNA detection system and is suitable for: 1) RNA molecular force spectroscopy measurement; 2) single-molecule mechanical experiments with high values ​​(50-60 pN); 3) studies on the interaction between RNA molecules and other molecules.

Claims

1. A method for measuring the force spectrum of a single RNA molecule, the method comprising: 1) Obtaining the handle chain: Designing and synthesizing handle chain primers with special modifications; A specially modified handle chain is obtained based on the handle chain primer, the handle chain including handle chain 1 and handle chain 2; the handle chain 1 and handle chain 2 have adhesive ends; 2) Obtaining a single RNA-handle complex: Obtain a single RNA molecule containing a fragment complementary to the sticky ends described above; anneal the handle chain with the RNA to obtain a single RNA-handle complex. The method also includes obtaining standard double-stranded DNA; The standard double-stranded DNA was obtained by amplification using the upstream primer of handle strand 1 and the downstream primer of handle strand 2 as amplification primers. The primers and / or handle chains have three, four, or five or more specially modified molecules. The specific modifications include one or more of the following: digoxigenin modification, biotin modification, d-spacer modification, phosphate modification, thiophosphate modification, and azide group modification. The handle chains 1 are each specially decorated and have adhesive ends 1 with a length of 30-100 nt. The handle chains 2 are each specially decorated and have adhesive ends 2 with a length of 30-100 nt. The sticky terminal 1 includes the sequence shown in SEQ ID NO.7 or its complementary sequence. The sticky terminal 2 includes the sequence shown in SEQ ID NO.8 or its complementary sequence. The handle chain primers include primers with sequences as shown in SEQ ID NO.1-SEQ ID NO.

4.

2. The method for measuring the force spectrum of single-molecule RNA according to claim 1, wherein, The primers and / or handle chains are modified with more than three digoxins.

3. The method for measuring the force spectrum of single-molecule RNA according to claim 1, wherein, The handle chain has 3-5 digoxin decorations.

4. The method for measuring the force spectrum of single-molecule RNA according to claim 1, wherein, The method includes obtaining handle strands and / or standard double-stranded DNA of different lengths by changing the spacing between upstream and downstream primers.

5. The method for measuring the force spectrum of single-molecule RNA according to claim 4, wherein, The length of the handle strand and / or standard double-stranded DNA can be altered by changing the plasmid size.

6. The method for measuring the force spectrum of single-molecule RNA according to claim 4, wherein, The length of the handle strand and / or standard double-stranded DNA can be altered by changing the binding position of the primers on the template.

7. The method for measuring the force spectrum of single-molecule RNA according to any one of claims 1-6, wherein, The annealing process involves annealing a mixture of the RNA molecule to be studied with handle chain 1 and handle chain 2 in a molar ratio of (0.7-2):1:

1.

8. The method for measuring the force spectrum of single-molecule RNA according to claim 7, wherein, The annealing process involves annealing the RNA molecule to be studied with handle chain 1 and handle chain 2 in a molar ratio of 1:1:

1.

9. The method for measuring the force spectrum of single-molecule RNA according to any one of claims 1-6, wherein, The annealing temperature is 50-65 ℃.

10. The method for measuring the force spectrum of single-molecule RNA according to any one of claims 1-6, wherein, The annealing temperature is 62 °C and / or 52 °C.

11. The method for measuring the force spectrum of single-molecule RNA according to any one of claims 1-6, wherein, The annealing conditions are: 98 °C for 10 minutes, 62 °C for 1 hour, 52 °C for 1 hour, and the reaction is terminated at 4 °C.

12. The method for measuring the force spectrum of single-molecule RNA according to any one of claims 1-6, wherein, The annealing buffer is a buffer solution containing formamide and PIPES.

13. The method for measuring the force spectrum of a single RNA molecule according to claim 12, wherein, The annealing buffer contains 60%-80% formamide by volume.

14. The method for measuring the force spectrum of a single RNA molecule according to claim 12, wherein, The annealing buffer solution contains: 80% formamide, 400 mM NaCl, 40 mM PIPES and 1 mM EDTA in a pH 7.5 solution.

15. The method for measuring the force spectrum of single-molecule RNA according to any one of claims 1-6, wherein, The method further includes performing molecular force spectroscopy detection in a measurement buffer solution containing a deoxygenation system and / or an RNase inhibitor.

16. The method for measuring the force spectrum of a single RNA molecule according to claim 15, wherein, The deoxygenation system contains glucose oxidase, catalase, and glucose.

17. The method for measuring the force spectrum of single-molecule RNA according to claim 16, wherein, The deoxygenation system contains 160 units / mL of glucose oxidase, 100 units / mL of catalase, and 0.8% glucose by mass.

18. The method for measuring the force spectrum of a single RNA molecule according to claim 15, wherein, The measurement buffer solution contains NaCl and EDTA. + or Mg 2+ The solution.

19. The method for measuring the force spectrum of a single RNA molecule according to claim 18, wherein, The measurement buffer solution is a Hepes and / or Tris-HCl buffer solution.

20. The method for measuring the force spectrum of a single RNA molecule according to claim 15, wherein, The force spectrum detection includes: fixing one or both ends of the RNA and acquiring data.

21. The method for measuring the force spectrum of a single RNA molecule according to claim 20, wherein, During the force spectrum detection process, dual-light trap optical tweezers, magnetic tweezers, acoustic tweezers, and atomic force microscopes are used to control the movement and fixation of one and / or both ends.

22. A kit for measuring the force spectrum of single-molecule RNA, wherein, The kit comprises the primers and sticky ends as described in any one of claims 1-21.

23. The kit according to claim 22, wherein, The kit includes an annealing buffer containing formamide, PIPES, NaCl, and EDTA.

24. The kit according to claim 23, wherein, The annealing buffer contains 60%-80% formamide by volume.

25. The kit according to claim 24, wherein, The annealing buffer is a solution with pH 7.5 containing 80% formamide, 400 mM NaCl, 40 mM PIPES, and 1 mM EDTA.

26. The kit according to claim 22, wherein, The kit includes an oxygen removal system and / or an RNase inhibitor.