Composition and kit for thyroid nodule detection

Abstract

The present invention provides a composition and kit for thyroid nodule detection, comprising detection reagents for detecting methylation levels of the KIF1A, TPO, and UCHL1 genes. By configuring multiple primer probe sets whose target genes are different markers of methylation of thyroid nodule-related genes, the present invention combines MSRE with fluorescent quantitative PCR to detect methylation of thyroid nodule-related genes, thereby effectively determining whether thyroid nodules are benign or malignant.

Description

Technical Field

[0001] The present invention relates to the fields of biotechnology and medicine, and in particular to a composition and a kit for detecting thyroid nodules. Background Art

[0002] Thyroid nodules are lumps in the thyroid tissue caused by abnormal proliferation of thyroid cells. Thyroid cancer has an annual incidence of 201,000 new cases in my country, making it the fastest-rising malignant tumor. Thyroid cancer encompasses at least four different types of thyroid malignancies: papillary tumors, follicular tumors, medullary tumors, and anaplastic tumors. Thyroid cancer is highly treatable, and the vast majority of patients have a good prognosis after thyroidectomy. Thyroid nodules can be categorized as benign or malignant. However, some benign and malignant nodules display no significant differences in cytological features, leading to unnecessary thyroidectomy in patients without cancer. Data indicate that in the United States, 50,000 patients with thyroid nodules undergo unnecessary thyroidectomy each year due to misdiagnosis. Therefore, accurate determination of the benign and malignant nature of thyroid nodules can reduce unnecessary surgeries, enable more precise treatment, and reduce the burden on patients.

[0003] Currently, thyroid nodules are primarily evaluated through ultrasound and fine needle aspiration biopsy (FNAB). High-resolution ultrasound is the preferred test for thyroid nodules, and nodules showing signs of malignancy on ultrasound are then combined with FNAB to determine the nature of the nodule. Cytological examinations also yield up to 20% of nodules as indeterminate. Molecular testing of fine needle aspiration samples of thyroid nodules with uncertain benign or malignant characteristics can help improve clinicians' accuracy in preoperatively distinguishing benign and malignant thyroid nodules, thereby avoiding unnecessary surgery and missed diagnosis of malignant nodules. Currently, the positive predictive value (PPV) of existing thyroid cancer gene tests is very low (42%-77%), necessitating the need for more precise molecular diagnostic tools.

[0004] Multiple mechanisms are involved in the development of thyroid cancer, and epigenetic changes play an important role in thyroid cancer. DNA methylation is an important epigenetic modification that plays a vital role in normal cell development, gene expression patterns, and genomic stability. Abnormality of this function is one of the earliest molecular changes that occur in the cancer process and is tissue-specific. Abnormal DNA methylation usually occurs in the promoter region of transcription factors, mainly leading to tumor development through hypermethylation or hypomethylation. In clinical applications, DNA methylation has the potential to serve as a diagnostic screening marker and therapeutic target. Summary of the Invention

[0005] The present invention provides a composition and a kit for detecting thyroid nodules, so as to achieve effective detection of malignant thyroid nodules.

[0006] The present invention provides a composition for detecting thyroid nodules, which comprises detection reagents for detecting the methylation levels of KIF1A gene, TPO gene and UCHL1 gene.

[0007] Furthermore, the composition includes a detection reagent for detecting the methylation level of the following regions:

[0008] The region of the KIF1A gene as shown in SEQ ID No. 13;

[0009] The region of the TPO gene as shown in SEQ ID No. 14;

[0010] The region of the UCHL1 gene is shown as SEQ ID No. 15.

[0011] Specifically, the SEQ ID NO: 13 region of the KIF1A (Genbank accession number: NG_029724.1) gene is as follows:

[0012] AGCTGTCTAGCTGGTTTCGGCGGGGCTGGGGCTGGGAGTGGGGGGCCCGTGTCTTGC AGAAGGTGGATGTGAATCTCCCCAGCCACCTGCAAGGCGCTCGCACGCAGCTGTCGGGAC TGAGGTGAAGCCGG;

[0013] The SEQ ID NO: 14 region of the TPO (Genbank accession number: NG_011581.2) gene is shown below:

[0014] AAAACAAGTCCACTGCCGCCCCTCCCACAGTCTCTCCGCTCTCCCTGCATCAGCCAGT GGTTCACACTGAGGACACACAGGTGAATCACGTTGAGAATTCCCAGCAGAACCGTAGTTTT CT;

[0015] The SEQ ID NO: 15 region of the UCHL1 (Genbank accession number: NG_012931.1) gene is shown below:

[0016] AATTAGCCGGGTGTGGTGGCGGGCGCCTGTAGTCCCAGCTACTCCGGAGGCTGAGGCA GGAGAATGGCGTGAACCGGGGAGGCGGAGCTTGCAGTGAGCCGAGATCGCGCCACT.

[0017] Furthermore, the detection reagent is a detection reagent used in nucleic acid amplification, nucleic acid sequencing or nucleic acid mass spectrometry detection of methylation levels.

[0018] Furthermore, the detection reagent is a primer and / or a probe.

[0019] Furthermore, the upstream primer, downstream primer and probe of at least one of the primer-probe sets contain sequences of SEQ ID No. 1 to SEQ ID No. 3 respectively.

[0020] Furthermore, the upstream primer, downstream primer and probe of at least one of the primer-probe sets contain sequences of SEQ ID No. 4 to SEQ ID No. 6 respectively.

[0021] Furthermore, the upstream primer, downstream primer, and probe of at least one of the primer-probe sets contain sequences of SEQ ID No. 7 to SEQ ID No. 9, respectively.

[0022] Furthermore, the molar concentration ratio of the primers and / or probes corresponding to every two different genes is 1-10.

[0023] Another aspect of the present invention further discloses a detection kit, which comprises the above composition.

[0024] Furthermore, the detection kit also includes a methylation-sensitive restriction endonuclease mix.

[0025] Furthermore, the detection kit also includes a hot start enzyme, a GC enhancer

[0026] Furthermore, the detection kit also includes dNTPs, PCR amplification buffer, and Mg ions.

[0027] Compared with the existing technology, the present invention sets the target genes of multiple primer probe groups as different markers after methylation of thyroid nodule-related genes, realizes the combination of MSRE and fluorescent quantitative PCR, realizes methylation detection of thyroid nodule-related genes, and then realizes effective judgment of benign and malignant thyroid nodules. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The methylation level of KIF1A gene in malignant and benign thyroid nodule tissues in Example 1 of the present invention;

[0029] Figure 2 The methylation levels of TPO genes in malignant and benign thyroid nodule tissues in Example 1 of the present invention;

[0030] Figure 3 is the methylation level of the UCHL1 gene in malignant and benign thyroid nodule tissues in Example 1 of the present invention;

[0031] Figure 4 This is the amplification curve of the marker and internal standard sample in Example 2 of the present invention;

[0032] Figure 5 This is the amplification curve of the sample without target gene methylation in Example 2 of the present invention;

[0033] Figure 6 ROC analysis diagram of KIF1A in an embodiment of the present invention;

[0034] Figure 7 ROC analysis diagram of TPO according to an embodiment of the present invention;

[0035] Figure 8 ROC analysis diagram of UCHL1 in an embodiment of the present invention;

[0036] Figure 9 ROC analysis diagram of KIF1A, TPO, and UCHL1 in the examples of the present invention. DETAILED DESCRIPTION

[0037] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0038] There are many methods for DNA methylation detection, such as pyrosequencing, methylation-sensitive high-resolution melting curve method, MethyLight fluorescent PCR method, methylation-specific PCR method, methylation-sensitive restriction endonuclease method (MSRE), etc. Compared with other detection methods, the MSRE method does not require sulfite conversion and has the advantages of high sensitivity, simple operation, and short time consumption. The embodiment of the present invention uses MSRE combined with fluorescent PCR technology to achieve gene methylation detection.

[0039] An embodiment of the present invention discloses a composition for detecting thyroid nodules, comprising detection reagents for detecting methylation levels of KIF1A gene, TPO gene, and UCHL1 gene.

[0040] Optionally, the composition includes a detection reagent for detecting the methylation level of the following regions:

[0041] The region of the KIF1A gene as shown in SEQ ID No. 13;

[0042] The region of the TPO gene as shown in SEQ ID No. 14;

[0043] The region of the UCHL1 gene is shown as SEQ ID No. 15.

[0044] Specifically, the SEQ ID NO: 13 region of the KIF1A (Genbank accession number: NG_029724.1) gene is as follows:

[0045] AGCTGTCTAGCTGGTTTCGGCGGGGCTGGGGCTGGGAGTGGGGGGCCCGTGTCTTGC AGAAGGTGGATGTGAATCTCCCCAGCCACCTGCAAGGCGCTCGCACGCAGCTGTCGGGAC TGAGGTGAAGCCGG;

[0046] The SEQ ID NO: 14 region of the TPO (Genbank accession number: NG_011581.2) gene is shown below:

[0047] AAAACAAGTCCACTGCCGCCCCTCCCACAGTCTCTCCGCTCTCCCTGCATCAGCCAGT GGTTCACACTGAGGACACACAGGTGAATCACGTTGAGAATTCCCAGCAGAACCGTAGTTTT CT;

[0048] The SEQ ID NO: 15 region of the UCHL1 (Genbank accession number: NG_012931.1) gene is shown below:

[0049] AATTAGCCGGGTGTGGTGGCGGGCGCCTGTAGTCCCAGCTACTCCGGAGGCTGAGGCA GGAGAATGGCGTGAACCGGGGAGGCGGAGCTTGCAGTGAGCCGAGATCGCGCCACT.

[0050] Among them, experimental analysis (see Example 1 of the present invention for details) shows that KIF1A, TPO, UCHL1, etc. are methylated at a relatively high rate in thyroid cancer.

[0051] The markers of the embodiments of the present invention include a KIF1A gene methylation marker, a TPO gene methylation marker, and a UCHL1 gene methylation marker. By using the above three markers, malignant tissue of thyroid nodules can be specifically analyzed and identified.

[0052] Optionally, the upstream primer, downstream primer and probe of at least one of the primer-probe sets contain sequences of SEQ ID No. 1 to SEQ ID No. 3, respectively.

[0053] Optionally, the upstream primer, downstream primer and probe of at least one of the primer-probe sets contain sequences of SEQ ID No. 4 to SEQ ID No. 6, respectively.

[0054] Optionally, the upstream primer, downstream primer and probe of at least one of the primer-probe sets contain sequences of SEQ ID No. 7 to SEQ ID No. 9, respectively.

[0055] Among them, the sequences of SEQ ID No. 1 to SEQ ID No. 9 of the embodiments of the present invention are shown in the following table.

[0056]

[0057]

[0058] The four fluorescence channels used in the embodiment of the present invention are FAM, HEX, CY5 and ROX channels, but they are not limited to this in actual application and can be a combination of any other fluorescence channels. At the same time, different targets should correspond to different fluorescence channels to facilitate the staff to obtain the amplification results of different gene methylation.

[0059] Furthermore, the 3' end of the probe has a quencher group, such as BHQ1 or BHQ2.

[0060] Optionally, the molar concentration ratio of the primers and / or probes corresponding to every two different genes is 1-10.

[0061] In the embodiment of the present invention, the molar concentration ratio of the primers and / or probes corresponding to every two different genes is 1.

[0062] Another aspect of the present invention further discloses a detection kit, which includes the above-mentioned composition.

[0063] Optionally, the detection kit further comprises a methylation-sensitive restriction endonuclease mix.

[0064] Optionally, the methylation-sensitive restriction endonuclease mix includes HpyCH4IV, Acil and HpaII.

[0065] The present invention combines enzymatic digestion with qPCR using a methylation-sensitive restriction enzyme mix to detect methylation in the promoter regions of the KIF1A, TPO, and UCHL1 genes. The product achieves a sensitivity of 90% and a specificity of 92%, surpassing serological tests, fine needle cytoaspiration, and currently available molecular diagnostic products, achieving superior specificity.

[0066] Optionally, the detection kit further comprises a hot start enzyme, a GC enhancer

[0067] Optionally, the detection kit further comprises dNTPs, PCR amplification buffer, and Mg ions.

[0068] Among them, those skilled in the art are motivated to independently select the dosage of PCR amplification buffer, Mg ions, dNTPs, methylation-sensitive restriction endonucleases, hot start enzymes, and GC enhancers based on their knowledge of conventional fluorescent quantitative PCR technology. Therefore, the embodiments of the present invention do not impose specific dosage restrictions.

[0069] The detection kit of the embodiment of the present invention provides a new molecular diagnostic technology path by detecting methylation markers in the DNA of thyroid nodule samples. It can directly use thyroid nodule tissue and patient plasma as samples, extract nucleic acids from tissue samples and patient plasma, and judge the benign or malignant nature of thyroid nodules through multi-target methylation combined detection.

[0070] To specifically illustrate the solutions and effects of the embodiments of the present invention, embodiments 1-3 are now disclosed.

[0071] Example 1: Detection of gene methylation expression

[0072] Step 1. Collect 30 samples of benign thyroid nodules and 30 samples of malignant thyroid nodules, for a total of 60 samples;

[0073] Step 2. Use the Shengxiang Bio S1008 Nucleic Acid Extraction Kit to extract nucleic acid from the thyroid nodule tissue sample. After concentration determination, take an appropriate amount of sample and dilute it to 1 ng / μl. Then, test according to the test process;

[0074] Step 3. Compare the methylation levels of malignant and benign thyroid nodules. The differences of KIF1A, TPO and UCHL1 are as follows: Figure 1 、 Figure 2 、 Figure 3 shown.

[0075] Methylation level = 2 -ΔCt待检样品 × 100%, ΔCt = Ct target gene - Ct internal reference gene. Figure 1-3As shown, the three targets of the present invention are highly methylated in malignant thyroid nodule tissue, while the methylation level is lower in benign thyroid nodules, which indicates that the methylation levels of the three targets are highly correlated with cancer tissue and can be used as detection markers for thyroid cancer in thyroid nodules.

[0076] Example 2: Reference product detection

[0077] The sequences of the primer probe sets used in Example 2 of the present invention for the methylation markers of KIF1A, TPO, and UCHL1 genes and the internal standard gene (Actin) are shown in the following table:

[0078]

[0079]

[0080] Example 2 of the present invention is designed to detect the upstream primer nucleic acid sequence of the KIF1A gene methylation marker as shown in SEQ ID NO.1, the downstream primer nucleic acid sequence as shown in SEQ ID NO.2, and the probe nucleic acid sequence as shown in SEQ ID NO.3. The upstream primer nucleic acid sequence for detecting the TPO gene methylation marker is shown in SEQ ID NO.4, the downstream primer nucleic acid sequence as shown in SEQ ID NO.5, and the probe nucleic acid sequence as shown in SEQ ID NO.6. The upstream primer nucleic acid sequence for detecting the UCHL1 gene methylation marker is shown in SEQ ID NO.7, the downstream primer nucleic acid sequence as shown in SEQ ID NO.8, and the probe nucleic acid sequence as shown in SEQ ID NO.9. Example 2 of the present invention also uses ACTB as an internal standard. The upstream primer nucleic acid sequence of the internal standard ACTB is shown in SEQ ID NO.10, the downstream primer nucleic acid sequence is shown in SEQ ID NO.11, and the probe nucleic acid sequence is shown in SEQ ID NO.12.

[0081] The positive samples of Example 2 of the present invention are: standard methylated human genomic DNA (KIF1A, TPO, UCHL1 and internal standard ACTB), with a concentration of 1 ng / μl 10% methylated DNA;

[0082] The negative sample of Example 2 of the present invention is: human genomic DNA with no methylation of KIF1A, TPO, and UCHL1 genes verified by sequencing, with a concentration of 2 ng / μl, and containing internal standard ACTB genomic DNA, with a concentration of 1 ng / μl.

[0083] Methylation-sensitive restriction endonuclease mix: includes HpyCH4IV, Acil, and HpaII.

[0084] The process of Example 2 of the present invention is as follows:

[0085] Step 1. Prepare the PCR reaction solution of Example 2 of the present invention according to the reagent formula in the table below;

[0086]

[0087]

[0088] Step 2. Add 10 μL of sample to a PCR reaction tube, then add 40 μL of PCR reaction solution. Cover the tube, vortex to mix, and centrifuge for 5 seconds.

[0089] Step 3. Conduct fluorescent PCR reaction and analyze the results;

[0090] 3.1. Fluorescence detection channel selection: Select the ROX channel (Reportere: ROX, Quencher: None) to detect UCHL1; select the FAM channel (Reportere: FAM, Quencher: None) to detect KIF1A; select the HEX channel (Reportere: HEX, Quencher: None) to detect TPO; select the CY5 channel (Reportere: CY5, Quencher: None) as an internal standard to detect the housekeeping gene ACTB;

[0091] 3.2. Fluorescence quantitative PCR reaction conditions are as follows:

[0092]

[0093] The amplification curves of the positive standard and negative standard of Example 2 of the present invention are as follows: Figure 4 、 5 As shown, the PCR reaction solution of Example 2 of the present invention can achieve specific amplification of positive standards and has good sensitivity.

[0094] Example 3: Clinical sample detection

[0095] The process of Example 3 of the present invention is as follows:

[0096] Step 1. Collect plasma samples from 50 patients with benign thyroid nodules and 50 patients with malignant thyroid nodules;

[0097] Step 2. Use the Novozymes plasma free DNA extraction kit to extract plasma cfDNA;

[0098] Step 3. According to the detection process of Example 2, the nucleic acid sample is subjected to enzyme digestion and PCR amplification detection in the same reaction tube.

[0099] The Ct value of the internal standard gene Actin was used to determine whether the experimental results met the quality control requirements. If the Ct value was > 27, it was not included in the result statistics. The methylation levels of the three target genes KIF1A, TPO, and UCHL1 were obtained using the methylation level calculation formula in Example 1. The ROC curve analysis of KIF1A, TPO, and UCHL1 was as follows: Figure 6 、 Figure 7 、 Figure 8 As shown, the PCR reaction solution and PCR amplification detection process of Example 3 of the present invention can specifically detect the methylation markers of KIF1A, TPO, and UCHL1 genes. In the detection of plasma samples of 100 patients with thyroid nodules (50 cases of malignant thyroid nodules and 50 cases of benign thyroid nodules), the area under the ROC curve of KIF1A gene methylation for distinguishing between malignant thyroid nodules and benign thyroid nodules was 0.838; the area under the ROC curve of TPO gene methylation for distinguishing between malignant thyroid nodules and benign thyroid nodules was 0.822; the area under the ROC curve of UCHL1 gene methylation for distinguishing between malignant thyroid nodules and benign thyroid nodules was 0.820. The ROC curve analysis of the three-gene combined detection is shown in Figure 2. Figure 9 As shown in the figure, the area under the ROC curve of the three-gene combined detection for distinguishing malignant thyroid nodules from benign thyroid nodules was 0.952. Binary logistic regression analysis was performed on the methylation levels of the combined gene detection. The logistic regression equation was -7.3554 + 17.3639 * KIF1A methylation level + 17.4362 * TPO methylation level + 18.624 * UCHL1 methylation level. According to the detection results of fluorescence quantitative PCR, the methylation level of each target was calculated (methylation level = 2 -ΔCt待检样品 × 100%), and the results were calculated by the logistics regression equation. When the result was greater than 0, the result was determined to be positive, i.e., a malignant nodule. According to the interpretation criteria, 4 out of 50 cases of benign thyroid nodules were positive, and 45 out of 50 cases of malignant thyroid nodules were positive. The detection sensitivity of the PCR reaction solution of the embodiment of the present invention (component of the kit of the present invention) was 90%, and the specificity was 92%. This shows that the embodiment of the present invention has high sensitivity and specificity by jointly detecting the methylation levels of the promoter regions of the KIF1A, TPO, and UCHL1 genes, and provides a new method for clinical differentiation of benign and malignant thyroid nodules.

[0100] In summary, KIF1A, TPO, and UCHL1 are methylation genes specific for malignant thyroid nodules. Joint detection of these genes in plasma samples for thyroid nodules demonstrates higher sensitivity and specificity than single-target detection, providing an effective and accurate method for distinguishing benign and malignant thyroid nodules. Furthermore, the components of the detection kit of the present invention enable nucleic acid sample enzymatic digestion and PCR amplification in the same reaction tube, offering the advantage of simple and convenient operation.

[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that after reading the specification of this application, technicians can still modify or replace the specific implementation methods of the present invention with equivalents, but these modifications or changes do not depart from the scope of protection of the pending claims of the present application.

Claims

1. A detection kit, characterized in that The detection kit includes a composition for detecting thyroid nodules, and the composition includes detection reagents for detecting the methylation levels of the KIF1A gene, the TPO gene, and the UCHL1 gene; The detection of the methylation levels of the KIF1A gene, TPO gene, and UCHL1 gene is to detect the methylation levels of the following regions respectively: The region of the KIF1A gene as shown in SEQ ID No. 13; The region of the TPO gene as shown in SEQ ID No. 14; The region of the UCHL1 gene as shown in SEQ ID No. 15; The upstream primer nucleic acid sequence for detecting the KIF1A gene methylation marker is as shown in SEQ ID NO.1, the downstream primer nucleic acid sequence is as shown in SEQ ID NO.2, and the probe nucleic acid sequence is as shown in SEQ ID NO.3; For detecting TPO gene methylation markers, the upstream primer nucleic acid sequence is the sequence shown in SEQ ID NO.4, the downstream primer nucleic acid sequence is the sequence shown in SEQ ID NO.5, and the probe nucleic acid sequence is the sequence shown in SEQ ID NO.6; The upstream primer nucleic acid sequence for detecting the UCHL1 gene methylation marker is as shown in SEQ ID NO.7, the downstream primer nucleic acid sequence is as shown in SEQ ID NO.8, and the probe nucleic acid sequence is as shown in SEQ ID NO.9; The detection kit further comprises a methylation-sensitive restriction endonuclease mix, which comprises HpyCH4IV, Acil and HpaII.

2. The composition for thyroid nodule detection according to claim 1, characterized in that The detection reagent is a detection reagent used in nucleic acid amplification, nucleic acid sequencing or nucleic acid mass spectrometry detection of methylation levels.

3. A composition for thyroid nodule detection according to claim 2, characterized in that, The detection reagent also includes primers and probes as shown in SEQ ID No. 10 to SEQ ID No.

12.

4. The detection kit according to claim 1, characterized in that The detection kit further comprises a hot start enzyme and a GC enhancer.

5. The detection kit according to claim 1, characterized in that The detection kit also includes dNTPs, PCR amplification buffer, and Mg ions.

Images