Use of genetically engineered bacteria in preparation of a preparation for treating multiple myeloma or relapsed refractory multiple myeloma

Abstract

The application discloses application of genetically engineered bacteria in preparation of a preparation for treating multiple myeloma or relapsed refractory multiple myeloma. The genetically engineered bacteria are Citrobacter freundii with deaminase related gene mutation; the deaminase related mutant gene is imine / enamine deaminase gene and adenosine deaminase gene. The application introduces an expression vector of imine / enamine deaminase mutant gene or adenosine deaminase mutant gene, carries out homologous recombination in the Citrobacter freundii, replaces the wild type imine / enamine deaminase gene or wild type adenosine deaminase gene with the imine / enamine deaminase mutant gene or adenosine deaminase mutant gene, realizes reduction of NH4 + , and obtains genetically engineered bacteria with reduced NH4 + product. The application provides a new treatment strategy for clinically treating relapsed refractory multiple myeloma, and enriches existing neoadjuvant therapy.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and biomedicine, specifically to the construction of mutant strains of Citrobacter freundii deaminase-related genes and the application of the deaminase-related genes in the preparation of diagnostic agents for relapsed or refractory multiple myeloma, as well as the application of mutant strains of Citrobacter freundii deaminase-related genes in the treatment of multiple myeloma or relapsed or refractory multiple myeloma. Background Technology

[0002] Multiple myeloma (MM) is a terminally differentiated malignant clonal disease of plasma cells, characterized by clonal plasma cell infiltration in the bone marrow and the presence of monoclonal M protein in peripheral blood and / or urine. According to the 2018 Global Cancer Report, its incidence rate is 0.41% of all human cancers. Contributing factors include aging and environmental factors. It is more common in the elderly, and its incidence is showing a trend of increasing annually with the growing elderly population.

[0003] Engineered bacteria are novel microorganisms processed using modern bioengineering techniques, characterized by multifunctionality, high efficiency, and strong adaptability. Current research indicates that imbalances in gut microbiota homeostasis promote the development of various diseases. For example, specific bacterial communities enriched in the gut of cancer patients promote tumor cell proliferation and induce drug resistance by encoding specific metabolites or small molecules. By using homologous recombination technology to replace genes encoded by key microorganisms, it is possible to obtain microorganisms without tumor-promoting effects, thereby restoring the gut microbiota balance in cancer patients. This provides direction for novel targeted cancer therapies and has broad application prospects.

[0004] This invention discovered that the RNA level of the deaminase-related gene in *Citrobacter freundii* (CFr) is increased in the intestines of patients with relapsed / refractory multiple myeloma (MM), and this result was also confirmed in in vivo animal experiments. Subsequently, we constructed a genetically engineered mutant strain of *Citrobacter freundii* with the deaminase-related gene, and through in vitro and in vivo experiments, we confirmed that the deletion of the *Citrobacter freundii* deaminase-related gene resulted in the production of NH4+. +Furthermore, this invention colonized the successfully constructed genetically engineered bacteria into the intestines of MM mice and treated the mice with bortezomib (BTZ), a first-line clinical drug. It was found that compared to the combined treatment of *Citrobacter freundii* and BTZ, the combination of the genetically engineered bacteria and BTZ significantly reduced the tumor burden in mice and alleviated BTZ resistance induced by *Citrobacter freundii*. Therefore, the *Citrobacter freundii* deaminase-related gene can serve as a biomarker for predicting and diagnosing relapsed or refractory multiple myeloma patients, and the genetically engineered *Citrobacter freundii* deaminase-related gene mutant bacteria can serve as a novel treatment for multiple myeloma and relapsed / refractory multiple myeloma patients, providing important guidance for neoadjuvant therapy in clinical practice. Summary of the Invention

[0005] This invention provides the application of specific gut microbial biomarkers for relapsed / refractory multiple myeloma, laying the foundation for clinical prediction and diagnosis of relapsed / refractory multiple myeloma. In addition, this invention provides a new treatment approach for patients with relapsed / refractory multiple myeloma from the perspective of gut microbiota, confirming the effectiveness of genetically engineered bacteria in the treatment of relapsed / refractory multiple myeloma, and providing a new option for neoadjuvant therapy of multiple myeloma.

[0006] The first aspect of the present invention aims to provide a reagent for detecting the expression level of deaminase-related genes in *Citrobacter freundii* in the intestine, and its application in the preparation of diagnostic agents for multiple myeloma or relapsed / refractory multiple myeloma, wherein the deaminase-related genes include: an imine / enamine deaminase gene as shown in SEQ ID NO.1 and / or an adenosine deaminase gene as shown in SEQ ID NO.2.

[0007] The aforementioned Citrobacter freundii belongs to the genus Citrobacter of the family Enterobacteriaceae.

[0008] The deaminase-related genes mentioned are imine / enamine deaminase genes and adenosine deaminase genes, such as... Figure 1 As shown: positions 2068934-2069329 of the nucleotide sequence are the enamine / imine deaminase gene (end), and positions 4974011-4974986 of the nucleotide sequence are the adenosine deaminase gene (add).

[0009] Reagents for detecting the expression levels of deaminase-related genes in Citrobacter freundii include PCR reagents, especially reagents for detecting the RNA expression levels of imine / enamine deaminase genes and / or adenosine deaminase genes in fecal samples by qPCR.

[0010] Furthermore, the expression level of Citrobacter freundii deaminase-related gene RNA was significantly higher in fecal or anal swab samples from patients with relapsed or refractory multiple myeloma than in newly diagnosed patients.

[0011] The primer sequences for detecting the imine / enamine deaminase gene are shown in SEQ ID NO. 15 and 16, and the primer sequences for detecting the adenosine deaminase gene are shown in SEQ ID NO. 7 and 8.

[0012] The second aspect of this invention aims to provide a diagnostic reagent for multiple myeloma or relapsed / refractory multiple myeloma, specifically a reagent for detecting the expression levels of deaminase-related genes in Citrobacter freundii, particularly a PCR reagent, and more specifically a reagent for detecting the RNA expression levels of imine / enamine deaminase genes and / or adenosine deaminase genes in fecal samples by qPCR.

[0013] The third aspect of this invention aims to provide a method for reducing NH4 + The product is a genetically engineered bacterium, wherein the genetically engineered bacterium is Citrobacter freundii with deletion and / or mutation and / or reduced expression of deaminase-related genes; the deaminase-related genes include: an imine / enamine deaminase gene with the sequence shown in SEQ ID NO.1 and / or an adenosine deaminase gene with the sequence shown in SEQ ID NO.2.

[0014] Furthermore, the deaminase-related gene mutations include any mutations that can cause the gene to lose or weaken its function.

[0015] This invention involves introducing an expression vector containing an imine / enamine deaminase mutant gene or an adenosine deaminase mutant gene, and then performing homologous recombination within *Citrobacter freundii* to replace the wild-type imine / enamine deaminase gene or the wild-type adenosine deaminase gene with the imine / enamine deaminase mutant gene or the adenosine deaminase mutant gene.

[0016] The sequence of the constructed imine / enamine deaminase mutant gene is shown in SEQ ID NO.23; the sequence of the constructed adenosine deaminase mutant gene is shown in SEQ ID NO.24.

[0017] The fourth aspect of this invention aims to provide the aforementioned method for reducing NH4. +The application of genetically engineered bacteria of the product in the preparation of therapeutic agents for multiple myeloma or relapsed / refractory multiple myeloma.

[0018] A fifth aspect of this invention aims to provide a therapeutic agent for treating multiple myeloma or relapsed / refractory multiple myeloma, comprising the aforementioned agent for reducing NH4. + Genetically engineered bacteria that produce the product.

[0019] The sixth aspect of the present invention aims to provide the aforementioned method for reducing NH4. + The application of the genetically engineered bacteria of the product in the preparation of formulations that reduce the drug resistance of bortezomib in patients with multiple myeloma or relapsed / refractory multiple myeloma.

[0020] A seventh aspect of this invention aims to provide an agent that reduces resistance to bortezomib in patients with multiple myeloma or relapsed / refractory multiple myeloma, including the aforementioned agent that reduces NH4. + Genetically engineered bacteria that produce the product.

[0021] The criteria for diagnosis of patients with relapsed or refractory multiple myeloma are based on the Chinese Guidelines for the Diagnosis and Treatment of Multiple Myeloma (2020 Revision).

[0022] The genetically engineered bacteria effectively inhibited BTZ resistance in relapsed / refractory multiple myeloma mice by regularly administering the genetically engineered bacteria via gavage to the intestinal tract of a multiple myeloma mouse model after feeding mice with a quadruple antibiotic regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L). This reduced NH4+ levels in the intestines and serum of relapsed / refractory multiple myeloma mice. + The content of.

[0023] Experimental results showed that gavage administration of genetically engineered bacteria can effectively inhibit BTZ resistance in relapsed and refractory multiple myeloma and reduce tumor burden in mice.

[0024] The experimental results of this invention show that genetically engineered bacteria reduce NH4 + The production of [a specific substance] inhibits the proliferation and drug resistance of multiple myeloma cells, thereby alleviating BTZ resistance induced by *Citrobacter freundii*, a drug resistance-associated microbe (DRAM). The findings of this invention show great promise for neoadjuvant therapy of multiple myeloma.

[0025] Advantages of this invention:

[0026] (1) This invention achieves NH4+ by introducing homologous mutant sequences of the imine / enamine deaminase gene or adenosine deaminase gene into wild-type Citrobacter freundii.+ The product was reduced (by 53.36% and 86.69%, respectively).

[0027] (2) The screening of biomarkers for diagnosing relapse and refractory multiple myeloma patients in this invention has been verified by a large number of experiments and can accurately predict and diagnose whether multiple myeloma patients will experience relapse and refractory disease.

[0028] (3) This invention elucidates, through the construction of genetically engineered bacteria, that *Citrobacter freundii*, a drug resistance-associated microbe (DRAM), generates large amounts of NH4+. + Inducing resistance in MM to BTZ.

[0029] (4) This invention provides a new treatment strategy for the clinical treatment of relapsed and refractory multiple myeloma, and enriches the existing neoadjuvant therapy options.

[0030] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples. Unless otherwise defined, the technical terms used herein have the meanings commonly understood by those skilled in the art. The nomenclature and experimental methods used herein are well known and routinely used in the field. Operations performed using standard techniques are typically performed according to the product manuals and conventional technical requirements of instrument and consumable manufacturers and the references provided herein. It should be noted that the following drawings and embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the invention, and all such deductions or substitutions should be considered within the scope of protection of the invention. Attached Figure Description

[0031] Figure 1 A map of genes related to deaminase in Citrobacter freundii.

[0032] Figure 2 Expression of deaminase-related genes in Citrobacter freundii.

[0033] Figure 3 Expression of Citrobacter freundii deaminase-related genes in mouse cecal contents.

[0034] Figure 4 Expression of deaminase genes end and add in feces of newly diagnosed and relapsed / refractory MM patients.

[0035] Figure 5 Flowchart of mutations in Citrobacter freundii deaminase-related genes (a) and pKO3-km vector map (b).

[0036] Figure 6DNA gel image after mutations in the end and add genes related to Citrobacter freundii deaminase.

[0037] Figure 7 Cloning identification results of Citrobacter freundii deaminase-related genes end and add mutations.

[0038] Figure 8 Expression of end and add genes in Citrobacter freundii deaminase-related genes after mutation.

[0039] Figure 9 After transplantation of a bacterial line containing a mutant gene related to the deaminase of Citrobacter freundii, the levels of NH4+ in the cecum and serum of mice were found to be significantly higher. + Content statistics.

[0040] Figure 10 In vivo imaging results of MM mice after transplantation of a bacterial line with a mutant gene related to deaminase from Citrobacter freundii.

[0041] Figure 11 Statistical results of fluorescence values ​​in MM mice after transplantation of Citrobacter freundii deaminase-related gene mutant bacterial lines.

[0042] Figure 12 Statistical results of IgG2b content in serum of MM mice after transplantation of Citrobacter freundii deaminase-related gene mutant bacterial line.

[0043] Figure 13 The levels of NH4+ in the cecum and serum of MM mice after transplantation of a bacterial line with a mutant gene related to Citrobacter freundii deaminase were [not specified]. + Content statistics.

[0044] Figure 14 The levels of NH4+ in the cecum and serum of MM mice after transplantation of a bacterial line with a mutant gene related to Citrobacter freundii deaminase were [not specified]. + Content correlation analysis.

[0045] Figure 15 Statistical results of end expression in the cecal contents of MM mice after transplantation of Citrobacter freundii deaminase-related gene mutant bacterial lines.

[0046] Figure 16 The expression of *Citrobacter freundii* deaminase-related gene mutants in the cecal contents of MM mice after transplantation was correlated with NH4+ levels in the cecum and serum. + Content correlation analysis. Detailed Implementation

[0047] Example 1: Collection, preservation, and RNA extraction of fecal samples from newly diagnosed multiple myeloma patients and relapsed / refractory multiple myeloma patients, as well as cecal contents from mice.

[0048] In this embodiment, adhering to relevant ethical requirements, stool samples were obtained from 10 newly diagnosed multiple myeloma (AD) patients and 10 relapsed / refractory multiple myeloma (RM) patients. All specimens were sourced from Xiangya Hospital affiliated with Central South University. All multiple myeloma patients were diagnosed with the disease by testing for serum monoclonal immunoglobulin type and bone marrow plasma cell ratio. The diagnostic criteria for relapsed / refractory multiple myeloma patients followed the "Guidelines for the Diagnosis and Treatment of Multiple Myeloma in China" (2020 revision). All patients' initial treatment regimens were based on bortezomib as the primary therapy. The age, sex, and body mass index of healthy donors were matched with those of the multiple myeloma patients to exclude microbiological differences caused by these factors.

[0049] After obtaining fresh fecal samples from MM patients or mice, place them in sterile cryovials, immediately flash-freeze them in liquid nitrogen, and then store them at -80°C for long-term storage. For anal swab samples, place them directly in sterile cryovials, immediately flash-freeze them in liquid nitrogen, and then store them at -80°C for long-term storage.

[0050] Total microbial RNA was extracted from fecal samples using the Magen HiPure Stool RNA Kit (R4185-02) according to the manufacturer's instructions and stored at -80°C for later use. To assess the quality of the extracted total microbial DNA, the DNA concentration and OD 260 / 280 and OD 260 / 230 values ​​were determined using Nanodrop. A 1% agarose gel was prepared, 500 ng of RNA was loaded, and the gel was run in a DNA electrophoresis tank at 100V for 10 min. RNA degradation was observed under blue light.

[0051] Example 2: Detection of deaminase gene expression in fecal or cecal contents using quantitative real-time PCR (qPCR).

[0052] Previous studies have shown that Citrobacter freundii (CFr) is a MM-related microorganism and can produce large amounts of NH4. + , and NH4 + This can further induce resistance in MM to BTZ, as detailed in patent 202111079749.6. NH4 +This can be regulated by bacterial deaminases. The gene sequence of *Citrobacter freundii* 4974986bp NZ_CP033744.1 was found in the NCBI database. Primers for nine deaminase-related genes were designed using the online tool Primer Blast in NCBI. In addition to the gene primers, this example also requires a pair of internal control primers (Maeda H, et al. Quantitative real-time PCR using TaqMan and SYBR Green for *Actinobacillus actinomycetemcomitans*, *Porphyromonas gingivalis*, *Prevotella intermedia*, tetQ gene and total bacteria. FEMS Immunology & Medical Microbiology. 2003, 39:81-86), the primer sequence is shown in SEQ ID NO. 3-22. Subsequently, total microbial RNA was extracted from fecal samples according to Example 1, and the expression of nine deaminase genes in *Citrobacter freundii* was detected by qPCR. It was found that all nine deaminase genes were expressed in *Citrobacter freundii*. Figure 2 Subsequently, the expression of nine deaminase genes in the cecal contents of CFr-induced MM-resistant mice was examined. It was found that the expression of the imine / imine deaminase gene (end, primer sequences see SEQ ID NO. 15 and 16) and the adenosine deaminase gene (add, primer sequences see SEQ ID NO. 7 and 8) was significantly upregulated in the CFr group and CFr+BTZ. Figure 3 Finally, by examining the expression of end and add in the feces of AD and RM patients, we found that the expression of end and add was significantly upregulated in RM patients. Figure 4 The results showed that the deaminase genes end and add were significantly upregulated in the fecal intestinal tract of patients with relapsed / drug-resistant multiple myeloma (MM). The unpaired t-test was used for statistical analysis.

[0053] Experimental methods and steps for qPCR detection of microbial gene expression in fecal samples: First, determine the optimal annealing temperature for each primer using gradient annealing temperature PCR; then, using cDNA reverse transcribed from RNA extracted from each sample as a template, perform qPCR with specific primers for each gene, and record the cycle number (Ct value) for each primer; finally, calculate the relative expression of each gene in each sample. The relative abundance (Ra) of any gene i can be expressed by the formula: Ra( i)=(1 / 2)^(Ct i -Ct c ), where Ct i Ct represents the cycle number of gene i. c This indicates the cycle number of the universal primer.

[0054] The gradient annealing temperature PCR reaction system is as follows:

[0055]

[0056] A total of 20 μL was used. PCR amplification was performed on a Biorad PCR instrument under the following conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, gradient annealing temperature (50℃-60℃) for 15 s, 72℃ extension for 20 s, 32 cycles; 72℃ final extension for 3 min. A 1% agarose gel was prepared, and 10 μL of the PCR amplification product was loaded. The gel was run in a DNA electrophoresis tank at 100V for 20 min. The band specificity and brightness at each annealing temperature were observed under blue light to determine the annealing temperature for each bacterial primer.

[0057] The qPCR reaction system is as follows:

[0058]

[0059] Total volume: 20 μL. qPCR reaction conditions: 1) Incubation at 50℃ for 2 min; 2) Pre-denaturation at 95℃ for 2 min; 3) Denaturation at 95℃ for 15 s, annealing at 52℃ for 15 s, extension at 72℃ for 1 min, repeated for 40 cycles; 4) Melting curve analysis, default program.

[0060] Table 1. Primers involved in Example 2

[0061]

[0062] Example 3: Construction of a genetically engineered bacterial line with the CFr deaminase gene end / add mutant

[0063] See the build process Figure 5a. Fusion PCR: PCR amplification was performed using primers SEQ ID NO.25 / SEQ ID NO.26 (169 bp after amplification) and SEQ ID NO.27 / SEQ ID NO.28 (208 bp after amplification). The PCR products from primers SEQ ID NO.25 / SEQ ID NO.26 and SEQ ID NO.27 / SEQ ID NO.28 were then recovered from the gel. The purified products from SEQ ID NO.25 / SEQ ID NO.26 and SEQ ID NO.27 / SEQ ID NO.28 were mixed 1:1 and diluted to a total concentration of 30 ng / ul, which was used as a template for fusion PCR. PCR amplification was performed using primers SEQ ID NO.25 / SEQ ID NO.28 (287 bp after amplification). The product from primers SEQ ID NO.25 / SEQ ID NO.28 was then recovered from the gel. The product from SEQ ID NO.25 / SEQ ID NO.28 was ligated into the pEASY-Blunt Zero Cloning Vector (Transgene pEASY-Blunt ZeroCloning Vector). Kit), ligation product transformed into DH5α; bacterial culture PCR identification of positive clones: after amplification of positive clones, plasmid was extracted, plasmid NotI digested 5 μg, 287 bp fragment recovered by gel extraction; pKO3-km plasmid NotI digested 5 μg, 6939 bp fragment recovered by gel extraction, SEQ ID NO.25 / SEQ ID NO.28 product fragment and pKO3-km ( Figure 5 b) Ligate with Transgene T4 DNA Ligase overnight at 25℃. Transform DH5α with the ligation product, plate with LB-Kana, and incubate overnight at 30℃. Pick clones for colony PCR. After identifying positive clones, incubate overnight at 220 rpm at 30℃ and extract plasmids. Transform CFr: Add 400 ng plasmid to 100 μL of competent CFr cells, gently mix, and add to a 0.2 cm electroporation cuvette pre-cooled to -80℃. Place on ice for 15 min, and electroporate at 25 μF, 200 Ω, and 2.5 Kv. Immediately after electroporation, transfer to 10 mL of LB and incubate at 200 rpm for 3 h at 30℃. Plate all transformants with LB-Kana and incubate overnight at 30℃. Pick clones for identification. Perform two rounds of recombination on positive clones to obtain a CFr bacterial line with the end-deleted deaminase gene. The primer sequences for the add mutation are shown in SEQ ID NO. 29-32, and the construction method is the same as above. Figure 6 Seven to eight clones of each of the recombinant mutant bacteria were selected: end 1-7, add 1-8. After amplification and culture for 18 hours, the NH4+ content in the culture medium was measured. + content( Figure 7Finally, end 5 (CFr-end) was selected. mut ) and add 1(CFr-add mut Further experiments were conducted; CFR-end was extracted. mut and CFr-add mut Bacterial RNA was analyzed to detect the expression of end and add genes. Mutations in the deaminase gene revealed that the expression of both end and add genes was downregulated. Figure 8 The results showed that the genetically engineered bacterium CFr-end mut and CFr-add mut The bacterial line was successfully constructed.

[0064] Table 2. Primers involved in Example 3

[0065]

[0066] Example 4: Genetically engineered bacteria CFr-end mut and CFr-add mut Bacterial strains in mouse intestines and cecum affect NH4+ levels. + Impact

[0067] To detect the genetically engineered bacteria CFR-end mut and CFr-add mut After colonization in the mouse intestine, the bacterial line affected NH4 in the cecum and serum. + To investigate the effects, standard C57BL6 mice were used. Fifteen mice were randomly divided into three groups of five each: the CFr-WT group, the CFr-end group, and the standard C57BL6 group. mut Groups and CFr-add mut Group CFr-WT group: Mice were fed a quadruple antibiotic regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for 2 weeks, followed by normal drinking water and oral administration of CFr-WT (2 × 10⁻⁶) mice. 8 / 200μL), administered orally three times a week for two weeks; CFr-end mut Group: Mice were fed a four-drug regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for 2 weeks, followed by normal drinking water and oral administration of CFr-end. mut (2×10 8 200 μL), administered orally three times a week for two weeks; CFr-add mut Group: Mice were fed a four-drug regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for 2 weeks, followed by normal drinking water and oral administration of CFr-add.mut (2×10 8 The dose was administered via gavage at a frequency of 3 times per week for 2 weeks. Blood was collected from the cheek and cecal contents were collected after the experiment was terminated.

[0068] Animal experiment results showed that, compared with the CFr-WT group, CFr-end mut Groups and CFr-add mut NH4 in the cecum and serum + Significantly reduced, and CFR-end mut The reduction in group was more significant ( Figure 9 The statistical method used was the unpaired t-test. This result indicates that CFr-end mut and CFr-add mut Colonization in the gut can reduce NH4 in the cecum and serum. + The content of.

[0069] Example 5: Genetically engineered bacteria CFr-end mut The effect of bacterial colonization in the mouse gut on BTZ resistance in multiple myeloma patients

[0070] The 5TGM1 mouse MM model was used. Thirty-five mice were randomly divided into seven groups of five each: PBS group, BTZ group, CFr-WT group, CFr-WT+BTZ group, and CFr-end group. mut Group, CFr-end mut +BTZ group and CFR-end mut +BTZ+NH4Cl group. PBS group: Mice were fed a quadruple antibiotic regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for 2 weeks, then switched to normal drinking water and administered PBS (200 μL / mouse) by gavage three times a week. One week after gavage, 1×10⁻⁶ PBS was injected via the tail vein. 6 5TGM1 cells (5TGM1-Luc) carrying the luciferase reporter gene were administered PBS (200 μL / mouse) by gavage three times a week. The BTZ group received a four-drug regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for two weeks, followed by normal drinking water and gavage with PBS (200 μL / mouse) three times a week. One week after gavage, 1 × 10⁻⁶ cells were injected via the tail vein. 65TGM1 cells (5TGM1-Luc) carrying the luciferase reporter gene were administered PBS (200 μL / mouse) by gavage three times a week. After one week, BTZ (0.75 mg / kg) was administered intraperitoneally three times a week. The CFr-WT group was fed a quadruple antibiotic regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for two weeks, followed by normal drinking water and gavage administration of CFr-WT (2 × 10⁻⁶ cells / mouse). 8 200 μL was administered orally three times a week, followed by a tail vein injection of 1 × 10⁻⁶ μL after one week of gavage. 6 5TGM1 cells (5TGM1-Luc) carrying the luciferase reporter gene were then administered CFr-WT (2 × 10⁻⁶ cells) by gavage. 8 / 200μL), at a frequency of 3 times a week; CFr-WT+BTZ group: mice were fed with a quadruple antibiotic (ampicillin 0.2g / L, neomycin 0.2g / L, metronidazole 0.2g / L, vancomycin 0.1g / L) in water for 2 weeks, then switched to normal drinking water and were gavaged with CFr-WT (2×10 8 200 μL was administered orally three times a week, followed by a tail vein injection of 1 × 10⁻⁶ μL after one week of gavage. 6 5TGM1 cells (5TGM1-Luc) carrying the luciferase reporter gene were administered to mice CFr-WT by gavage (2 × 10⁻⁶ cells). 8 One week later, BTZ (0.75 mg / kg) was administered intraperitoneally three times a week, alternating between oral CFr-WT and intraperitoneal BTZ administration; CFr-end mut Group: Mice were fed a four-drug regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for 2 weeks, followed by normal drinking water and oral administration of CFr-WT (2 × 10⁻⁶). 8 200 μL was administered orally three times a week, followed by a tail vein injection of 1 × 10⁻⁶ μL after one week of gavage. 6 5TGM1 cells (5TGM1-Luc) carrying the luciferase reporter gene were then administered CFR-end via gavage. mut (2×10 8 / 200μL), three times a week; CFr-end mut +BTZ group: Mice were fed a four-drug regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for 2 weeks, followed by normal drinking water and oral administration of CFr-end. mut (2×10 8 200 μL was administered orally three times a week, followed by a tail vein injection of 1 × 10⁻⁶ μL after one week of gavage. 65TGM1 cells (5TGM1-Luc) carrying the luciferase reporter gene were administered to mice via gavage. mut (2×10 8 One week later, BTZ (0.75 mg / kg) was administered intraperitoneally three times a week, followed by CFR-end via gavage. mut Alternate with intraperitoneal administration of BTZ; CFr-end mut +BTZ+NH4Cl group: Mice were fed a four-drug regimen (ampicillin 0.2 g / L, neomycin 0.2 g / L, metronidazole 0.2 g / L, vancomycin 0.1 g / L) in water for 2 weeks, followed by normal drinking water and oral administration of CFr-end. mut (2×10 8 200 μL was administered orally three times a week, followed by a tail vein injection of 1 × 10⁻⁶ μL after one week of gavage. 6 5TGM1 cells (5TGM1-Luc) carrying the luciferase reporter gene were administered to mice via gavage. mut (2×10 8 Mice were administered NH4Cl by gavage at a frequency of 200 μL (3 times a week) daily. After one week, mice were administered BTZ (0.75 mg / kg) intraperitoneally at a frequency of 3 times a week, followed by CFR-end gavage. mut Alternating administration of NH4Cl and intraperitoneal BTZ was performed. Fecal samples were collected from mice before antibiotic administration via water and before cell injection. In vivo imaging and cheek blood collection were performed 6 weeks after cell injection.

[0071] Animal experiments showed that compared with the PBS group, the fluorescence value of the BTZ group was significantly reduced, while compared with the BTZ group, the fluorescence value of the CFr-WT+BTZ group was significantly increased. Compared with the CFr-WT+BTZ group, the fluorescence value of the CFr-end group was significantly increased. mut The fluorescence value of the +BTZ group was significantly reduced, compared with CFr-end mut Compared to the +BTZ group, CFr-end mut The fluorescence value of the +BTZ+NH4Cl group increased significantly. Figure 10 , Figure 11 The same result was obtained regarding the content of IgG2b secreted by MM cells in serum. Figure 12 Then, we measured NH4 in the cecum and serum. + The content of CFr-end was found to be lower than that of CFr-WT transplantation. mut Post-transplant NH4 + The content of [certain substances] decreased, while in CFR-end [certain substances]... mut Supplementing with NH4Cl after transplantation, its NH4 + The content increased again ( Figure 13 Furthermore, the levels of NH4 in the cecum and serum of each group were [data missing].+ The content of [something] is positively correlated ( Figure 14 Finally, we examined the expression of *end* in the cecal contents and found that, compared with CFr-WT transplantation, CFr-end... mut The expression of end decreased after transplantation. Figure 15 ), CFr-end mut After removing +BTZ+NH4Cl (excluding NH4Cl interference), we analyzed the expression of end cells in relation to NH4Cl in the cecum and serum. + The correlation between the content of [elements] was found to be positive. Figure 16 The statistical method used was the unpaired t-test, and the correlation analysis was performed. This result indicates that CFr-end mut Colonization in the gut can reduce NH4 levels in the cecum and serum. + The content of [unclear] can alleviate CFr-WT-induced MM resistance to BTZ.

[0072] The imine / enamine deaminase gene sequence is as follows: (e.g., SEQ ID NO.1)

[0073] ATGAGAAAAGTTATTGCAACCGAATGTGCGCCAGGGGCTATCGGGCCTTACGTACAGGGTGTGGATCTGGGCAGCATGGTGTTGACGTCAGGTCAAATCCCGGTGTGTCCACAGACCGGTGAAGTGGCTGAAAACGTATCCGATCAAGCGCGTCAAAGCCTGGAAAACGTGAAAGCGATTGTCGAGTCTGCAGGTTTG AAAGTGAGCGATATCGTCAAGACCACCGTTTTCGTTTCCGACCTGAACGACTTCGCCACCATCAATCAGGTGTACCAGCAGTTCTTTGATGAGCATAAGGCAATCTACCCTACGCGCAGCTGCGTGCAGGTCGCCCGCTTACCAAAGGATGTGAAGCTGGAGATTGAAGCCATCGCCGTACGTGGCGACACGCTGTAA

[0074] The adenosine deaminase gene sequence is shown below, as in SEQ ID NO.2.

[0075] CGACGTCCATCGCCACCTTGATGGTAACATCCGTGCCCAAACGATTCTGGATCTGGGTCGTCAGTTCAATTTAACGCTCCCGGCACAAACGTTGGAAACGCTGATCCCTCATGTGCAAGTGACATCCACTGAGCCAGATTTAGTGAGCTTTTTATCCAAGCTCGACTGGGGCGTGAAGGTACTGGCCTCGCTGGATGCCTGTCGCCGCGTGGCATTTGAAAATATTGAGGATGCAGCACGTAACGGTCTGCACTATGTAGAATTACGTTTTTCACCAGGCTATATGGCGATGGCGCACCAACTCCCGGTGGCAGGTGTGGTTGAAGCCGTCATCGCAGGCGTGCGCGAGGGCTGCAAGACCTTTGGCGTCGAAGCACGCTTAATTGGCATTATGAGCCGTACTTTTGGCGAAGCCGCCTGTCTGCAGGAACTGGATGCGCTGTTAGCCCACCGAGATCATATTACGGCACTGGATCTAGCCGGTGACGAACTGGGATTCCCTGGCAGTCTGTTCCTGTCCCATTTCAACCAGGCACGCGACGCCGGCTGGCATATTACCGTGCATGCGGGCGAAGCCGCGGGACCAGAAAGCATCTGGCAGGCCATTAAAGAGCTGGGCGCTGAGCGTATTGGTCACGGCGTTAAAGCCGTTGAAGATCGTGCGTTGATGGATTACCTCGCCGAGCATCGTATCGGCATCGAATCCTGCCTGACATCAAACATTCAGACCAGCACCGTTGCCTCACTAGCGAACCATCCGCTGAAAACGTTCCTTGAGCATGGCGTTATTGCCAGTTTGAATACGGACGACCCGGCTGTTCAGAGTGTGGATATTATTCACGAGTACACCATTGCCGCACCAGCTGCAGGCCTAACGCGCGAACAGATCCGCCAGGCGCAAATCAACGGTCTGGAAATGGCATTCCTGAGTAACGAAGAAAAACGAGCCTTGCGCGAGAAAGTCGGCGCAGCGTAA

[0076] The homologous mutant sequences of imine / enamine deaminase gene are as follows: such as SEQ ID NO.23

[0077] ATGAGAAAAGTTATTGCAACCGAATGTGCGCCAGGGGCTATCGGGCCTTACGTACAGGGTGTGGATCTGGGCAGCATGGTGTTGACGTCAGGTCAAATCCCGGTGTGTCCACAGACCGGTGAAGTTCCGACCTGAACGACTTCGCCACCATCAATCAGGTGTACCAGCAGTTCTTTGATGAGCATAAGGCAATCTACCCTACGCGCAGCTGCGTGCAGGTCGCCCGCTTACCAAAGGATGTGAAGCTGGAGATTGAAGCCATCGCCGTACGTGGCGACACGCTGTAA

[0078] The homologous mutant sequences of adenosine deaminase gene are as follows: such as SEQ ID NO.24

[0079] CGACGTCCATCGCCACCTTGATGGTAACATCCGTGCCCAAACGATTCTGGATCTGGGTCGTCAGTTCAATTTAACGCTCCCGGCACAAACGTTGGAAACGCTGATCCCTCATGTGCAAGTGACATCCACTGAGCCAGATTTAGTGAGCTTTTTATCCAAGCTCGACTGGGGCGTGAAGGTACTGGCCTCGCTGGATGCCTGTCGCCGCGTGGCATTTGAAAATATTGAGGATGCAGCACGTACCAGCACCGTTGCCTCACTAGCGAACCATCCGCTGAAAACGTTCCTTGAGCATGGCGTTATTGCCAGTTTGAATACGGACGACCCGGCTGTTCAGAGTGTGGATATTATTCACGAGTACACCATTGCCGCACCAGCTGCAGGCCTAACGCGCGAACAGATCCGCCAGGCGCAAATCAACGGTCTGGAAATGGCATTCCTGAGTAACGAAGAAAAACGAGCCTTGCGCGAGAAAGTCGGCGCAGCGTAA。

Claims

1. A genetically engineered bacterium for reducing NH4 + characterized in that The genetically engineered bacteria are Corynebacterium ammoniagenes with a deaminase-related gene mutation Citrobacter freundii The deaminase-related gene mutation comprises: an imine / enamine deaminase mutant gene with a sequence shown as SEQ ID NO. 23, and / or an adenosine deaminase mutant gene with a sequence shown as SEQ ID NO.

24.

2. The method of claim 1, wherein the NH4+ is reduced by at least 50%. + The genetically engineered bacteria for use in the preparation of a preparation for reducing the drug resistance of a patient with multiple myeloma or relapsed and refractory multiple myeloma treated with bortezomib.

3. A preparation for reducing the drug resistance of a patient with multiple myeloma or relapsed refractory multiple myeloma treated with bortezomib, characterized by, The genetically engineered bacteria of claim 1, wherein the bacteria are selected from the group consisting of Escherichia coli, Klebsiella pneumoniae, and Pseudomonas putida. + The genetically engineered bacteria of

Images