Reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer, preparation method and application

Abstract

The present invention discloses a reverse amplification electrochemical biosensor based on functionalized carbonitride polymers, a preparation method and an application thereof, including: synthesis of amino-carbonitride polymers; functional modification of the amino-carbonitride polymers with thiolated OA aptamers; Th being used as an electron transfer promoter to improve the conductivity of the carbonitride polymers; modification of the surface of a glassy carbon electrode with the functionalized amino-carbonitride polymers; functional modification of the amino-carbonitride polymers with thiolated ssDNA; complementary pairing of the thiolated ssDNA-functionalized amino-carbonitride polymers and the thiolated OA aptamer-functionalized amino-carbonitride polymers modified with Th; DPV detection of OA by a working electrode. The test results show that the sensor system is simple, effective, low-cost and highly sensitive. Based on the diversity of aptamers and single-stranded DNAs, the reverse amplification electrochemical biosensor provides a general detection method for the detection of toxins, biomolecules and organic molecules.

Description

Technical Field

[0001] The present invention relates to the field of OA detection, and specifically relates to a method for the specific recognition of OA by a Th-modified thiolated OA aptamer-functionalized amino-carbonitride polymer, and the complementary pairing of a thiolated ssDNA-functionalized amino-carbonitride polymer, and realizing the quantitative detection of OA through the redistribution of charges on the surface of a glassy carbon electrode caused by this process. Background Art

[0002] Marine biotoxins in shellfish can be divided into paralytic shellfish toxins, neurogenic shellfish toxins, amnesic shellfish toxins, and diarrheic shellfish toxins. Among them, diarrheic shellfish toxin okadaic acid (OA) is one of the most widely distributed and highest incidence marine toxins. Its main toxic effect is to inhibit protein phosphatases PP1 and PP2A in the human body, and cause a series of pathological symptoms by stimulating phosphorylation and changing intracellular calcium concentration. In addition, relevant reports have confirmed that OA is a potential tumor promoter. The long-term toxicity of OA poses a serious threat to the development of the shellfish aquaculture industry and public health. Therefore, there is an urgent need for a highly sensitive and accurate detection method to prevent and handle OA-contaminated seafood and waters.

[0003] Current methods for OA detection mainly include mouse bioassay, immunoassay, cell assay, biosensor method, high performance liquid chromatography, liquid chromatography-mass spectrometry, capillary electrophoresis, etc. The mouse bioassay is a classic detection method for marine biotoxins, with the advantages of convenient operation, no need for toxin standards and expensive detection equipment, etc. However, due to its high detection limit, poor repeatability, long time consumption and other deficiencies, and there are also animal ethics issues. Although methods such as high performance liquid chromatography and liquid chromatography-mass spectrometry have the characteristics of a wider detection range and lower detection limit, they cannot be widely used due to the need for trained personnel, high-intensity labor and expensive equipment. The immunoassay has the characteristics of good specificity, high sensitivity, simple operation, etc., and is widely used for the detection of OA. However, there are problems such as the relatively difficult acquisition and high cost of the toxin antibodies required for its detection. The capillary electrophoresis detection method (CE) combines electrophoresis and chromatography techniques, and only a few nanoliters of sample volume is required to achieve sample detection. However, it has certain limitations on the specificity and detection limit of the detected substance. Therefore, there is an urgent need to develop a rapid, simple and low-cost OA detection method. Summary of the Invention

[0004] The purpose of the present invention is to develop a convenient and sensitive OA detection technology, and use the specific recognition ability of a Th-modified thiolated OA aptamer-functionalized carbonitride polymer, and the redistribution of charges on the surface of the working electrode caused by the complementary pairing of a thiolated ssDNA-functionalized amino-carbonitride polymer and the OA aptamer, to realize an effective, rapid and highly sensitive detection method for OA.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] A preparation method of a reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer, comprising the following steps:

[0007] (1) Prepare amino-carbon nitride polymer by pyrolysis method:

[0008] (2) Covalently connect the amino-carbon nitride polymer obtained in step (1) with thiolated okadaic acid (OA) aptamer and thiolated ssDNA having a terminal complementary fragment with the OA aptamer respectively to obtain thiolated OA aptamer-functionalized amino-carbon nitride polymer and thiolated ssDNA-functionalized amino-carbon nitride polymer;

[0009] (3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (2) with Th solution, and obtain Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer by electrostatic adsorption;

[0010] (4) Modify the glassy carbon electrode with the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (3) to obtain a functionalized working electrode. Then combine a platinum electrode as a counter electrode and a calomel electrode as a reference electrode to jointly form a three-electrode system required for detection. The three-electrode system and the thiolated ssDNA-functionalized amino-carbon nitride polymer obtained in step (2) jointly form a reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer.

[0011] During use, mix the functionalized working electrode obtained in step (4) with a standard OA solution, and fix OA on the working electrode of the thiolated OA aptamer-functionalized carbon nitride polymer by the specific binding between the OA aptamer and OA. Then mix it with the thiolated ssDNA-functionalized amino-carbon nitride polymer obtained in (2), and realize the reverse amplification quantitative detection of OA through the complementary pairing of thiolated ssDNA and thiolated OA aptamer.

[0012] Further, step (1) specifically includes:

[0013] (1.1) Mix urea and melamine according to a mass ratio of 1:1, heat to 550 - 600 °C at a heating rate of 1 - 3 °C / min, and keep the reaction for 5 - 7 h;

[0014] (1.2) Grind the yellow powder obtained in step (1.1);

[0015] (1.3) Heat the product obtained in step (1.2) to 500 - 600 °C at a heating rate of 4 - 7 °C / min and hold for 1 - 3 h to obtain the product g-C3N4;

[0016] (1.4) Mix the product g-C3N4 obtained in step (1.3) with concentrated hydrochloric acid at a mass ratio of 10:1 and mix at 30 °C - 50 °C for 4 - 6 h;

[0017] (1.5) Centrifuge and wash the mixed solution in step (1.4) until the pH value of the supernatant reaches neutral, and then filter to obtain a precipitate;

[0018] (1.6) Disperse the precipitate obtained in step (1.5) in ultrapure water, use ultrasonic exfoliation of nanosheets to promote nanosheet delamination, and centrifuge to collect the exfoliated nanosheets;

[0019] (1.7) Vacuum-dry the exfoliated nanosheets obtained in step (1.6) to obtain a powder, namely amino-carbonitride polymer, where the vacuum-drying temperature is 50 °C and the time is 24 h.

[0020] Furthermore, step (2) is specifically as follows:

[0021] (2.1) Add the amino-carbonitride polymer to PBS buffer and sonicate for 5 - 10 min, where 1 - 10 mg of the amino-carbonitride polymer is added to every 1000 μL of PBS buffer to obtain an amino-carbonitride polymer solution, where the concentration of the PBS buffer is 2 mM and the pH is 7.2;

[0022] (2.2) Prepare an amino-carbonitride polymer-SMCC copolymer solution, and simultaneously prepare a thiolated OA aptamer solution and a thiolated ssDNA solution;

[0023] (2.3) Mix the thiolated OA aptamer solution and the thiolated ssDNA solution with the amino-carbonitride polymer-SMCC copolymer solution at a volume ratio of 1:9 respectively, mix and react, end the reaction after 4 h, and wash away the excess thiolated OA aptamer and thiolated ssDNA by centrifugal washing respectively to obtain a thiolated OA aptamer-functionalized amino-carbonitride polymer and a thiolated ssDNA-functionalized amino-carbonitride polymer, and disperse the thiolated OA aptamer-functionalized amino-carbonitride polymer and the thiolated ssDNA-functionalized amino-carbonitride polymer in PBS respectively.

[0024] Furthermore, the preparation of the amino-carbonitride polymer-SMCC copolymer solution in step (2.2) specifically includes:

[0025] (2.2.1) Take Sulfo-SMCC and prepare a Sulfo-SMCC solution with ultrapure water at a concentration of 10 - 100 mg / mL;

[0026] (2.2.2) Mix the amino-carbonitride polymer solution obtained in step (2.1) with the Sulfo-SMCC solution at a volume ratio of 20:1, and stir for 120 min at room temperature to obtain an amino-carbonitride polymer-SMCC copolymer;

[0027] (2.2.3) Then, by means of centrifugal washing, remove the supernatant of the amino-carbonitride polymer-SMCC copolymer solution in (2.2.2) to wash away the excess Sulfo-SMCC molecules, and repeat 3 to 6 times;

[0028] (2.2.4) Redisperse the precipitate obtained in step (2.2.3) in PBS buffer to obtain an amino-carbonitride polymer-SMCC copolymer solution.

[0029] Further, in step (2.2.3), the centrifugal washing speed is 8000 revolutions per minute and the time is 5 to 10 minutes.

[0030] Further, the specific preparation of the thiolated OA aptamer solution and the thiolated ssDNA solution in step (2.2) is as follows: Mix 10 mM TCEP solution, 100 μM OA aptamer solution / 100 μM ssDNA solution, and ddH2O in a volume ratio of 1:1:8 to activate the thiol groups. At room temperature, the reduction reaction lasts for 30 to 60 minutes to obtain the thiolated OA aptamer solution and the thiolated ssDNA solution respectively.

[0031] Further, in step (2.3), the centrifugal washing speed is 6000 revolutions per minute and the time is 3 to 5 minutes.

[0032] Further, step (3) is specifically as follows:

[0033] (3.1) Ultrasonicate the thiolated OA aptamer-functionalized amino-carbonitride polymer solution obtained in (2.3) for 30 min to promote the dispersion of the nanosheets;

[0034] (3.2) Prepare a Th solution with PBS at a concentration of 5 mg / mL to 10 mg / mL.

[0035] (3.3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbonitride polymer solution in the dispersed state obtained in (3.1) with the Th solution prepared in (3.2), and stir at room temperature for 48 h - 72 h.

[0036] (3.4) Centrifuge the mixed solution obtained in (3.3), wash it thoroughly to remove the excess Th particles, obtain the Th-modified thiolated OA aptamer-functionalized amino-carbonitride polymer, and dissolve it in ultrapure water.

[0037] Further, in step (3.4), the centrifugal washing speed is 12,000 revolutions per minute and the time is 3 to 5 minutes.

[0038] Further, the preparation of the functionalized working electrode in step (4) specifically includes:

[0039] (4.1) Polish the glassy carbon electrode successively with alumina powder with a particle size of 1.5 μm and alumina powder with a particle size of 0.5 μm;

[0040] (4.2) In a 5 mM - 10 mM K4Fe(CN)6 / K3Fe(CN)6 solution, scan the polished electrode obtained in (4.1) by cyclic voltammetry to obtain the voltage difference ΔP between the cathode and the anode in the cyclic voltammogram;

[0041] (4.3) Until ΔP is less than or equal to 80 mV, otherwise repeat steps (3.1) to (3.2);

[0042] (4.4) Drop the solution of Th - modified thiolated OA aptamer - functionalized amino - carbon nitride polymer onto the surface of the glassy carbon electrode, and place it in a dust - free condition for 12 - 16 h to obtain the functionalized working electrode.

[0043] The application of the reverse - amplification electrochemical biosensor based on functionalized carbon nitride polymer in OA detection includes the following steps:

[0044] (5.1) Place the three - electrode system in a 5 mM - 10 mM K4Fe(CN)6 / K3Fe(CN)6 solution, and use an electrochemical workstation to perform Differential Pulse Voltammetry (DPV) detection on the surface of the working electrode to obtain the initial current change information;

[0045] (5.2) Immerse the functionalized working electrode after measurement in (5.1) in the target analyte OA solution and mix and react for 1 h - 2 h;

[0046] (5.3) Perform DPV testing on the functionalized working electrode after reaction in (5.2) to obtain the current change information caused by OA;

[0047] (5.4) Insert the functionalized working electrode combined with OA after reaction in (5.3) into the solution of thiolated ssDNA - functionalized amino - carbon nitride polymer, and wrap it with a sealing film to prevent solution evaporation;

[0048] (5.5) After allowing the mixture system in (5.4) to stand and react for 1 h - 3 h, perform DPV testing to achieve quantitative detection of OA through reverse amplification.

[0049] Based on a working electrode modified with Th-modified thiolated OA aptamer-functionalized carbon nitride polymer, combined with thiolated ssDNA-functionalized amino-carbon nitride polymer as a medium for reverse signal amplification of an electrochemical biosensor, a reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer was successfully constructed. It was prepared by the above-mentioned method for preparing a reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer.

[0050] Compared with the prior art, the present invention has the following beneficial technical effects:

[0051] The specific process completed by this method includes: synthesis of amino-carbon nitride polymer; functional modification of the amino-carbon nitride polymer with thiolated OA aptamer; Th as an electron transfer promoting medium to improve the conductivity of carbon nitride polymer; modification of the surface of a glassy carbon electrode with functionalized amino-carbon nitride polymer; functional modification of the amino-carbon nitride polymer with thiolated ssDNA; complementary pairing of thiolated ssDNA-functionalized amino-carbon nitride polymer and Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer; differential pulse voltammetry (DPV) detection of OA by the functionalized working electrode. The test results show that the sensor system is simple, effective, low-cost, and highly sensitive. Based on the diversity of aptamers and single-strand DNA (ssDNA), this reverse amplification electrochemical biosensor provides a general detection method for the detection of toxins, biomolecules, and organic molecules.

[0052] Specifically, the present invention utilizes the complementary pairing of Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer and thiolated ssDNA-functionalized amino-carbon nitride polymer to achieve, for the first time, reverse quantitative detection of OA, with the advantages of low cost, convenient operation, high sensitivity, etc. In addition, this method can not only achieve quantitative detection of OA, but also achieve semi-quantitative detection of ssDNA.

[0053] Compared with the existing OA detection methods, the present invention has the advantages of simple operation steps, low cost, lower detection limit, etc., and overcomes the disadvantages of high production cost and complex detection process of the existing methods. Based on the above advantages, the present invention can provide new ways and development space for the detection of more different marine biotoxins or other small molecule recognition. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The accompanying drawings in the specification are used to provide a further understanding of the present invention, and constitute a part of the present invention. The schematic embodiments and descriptions thereof of the present invention are used to explain the present invention, and do not constitute an improper limitation to the present invention.

[0055] The Th-modified mercapto OA aptamer-functionalized amino-carbon nitride polymer is abbreviated as C3N4-aptamer-Th, the mercapto ssDNA-functionalized amino-carbon nitride polymer is abbreviated as C3N4-ssDNA, and the complementary pairing of the mercapto ssDNA-functionalized amino-carbon nitride polymer and the Th-modified mercapto OA aptamer-functionalized amino-carbon nitride polymer is abbreviated as C3N4-aptamer-Th + C3N4-ssDNA.

[0056] Figure 1 It is a schematic diagram of a reverse amplification electrochemical biosensor based on C3N4-aptamer-Th and C3N4-ssDNA for realizing the quantitative detection of OA;

[0057] Figure 2 It is the SEM image of C3N4 and C3N4-aptamer-Th + C3N4-ssDNA;

[0058] Figure 3 It is the Zeta potential diagram before and after the functionalization of the amino-carbon nitride polymer

[0059] Figure 4 It is the cyclic voltammogram of the present invention before and after the surface modification of the glassy carbon electrode with C3N4-aptamer-Th and for detecting OA;

[0060] Figure 5 It is the differential pulse voltammogram of the present invention before and after the surface modification of the glassy carbon electrode with C3N4-aptamer-Th and for detecting OA;

[0061] Figure 6 It is the DPV curve of the electrochemical sensor system built based on C3N4-aptamer-Th modification and C3N4-ssDNA for detecting OA and other marine toxins of the present invention;

[0062] Figure 7 It is the DPV curve of the electrochemical sensor system built based on C3N4-aptamer-Th and C3N4-ssDNA for detecting OA at different concentrations of the present invention. Detailed implementation manners

[0063] The present invention will be further described in detail below:

[0064] A reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer, comprising a carbon nitride polymer, a protein crosslinking agent Sulfo-SMCC, thionine (Th), thiolated OA aptamer, thiolated ssDNA, a glassy carbon electrode and other parts. In the present invention, a carbon nitride polymer rich in amino groups is used as a carrier. Through a typical bifunctional crosslinking method, it is used as a carrier for both sensitive materials and reverse amplification materials, and an electrochemical biosensor with reverse amplification function is successfully constructed. The maleimide groups of the carbon nitride polymer rich in amino groups are exposed under the action of Sulfo-SMCC and covalently connected to the thiols modified on the nucleic acid chain. However, the carbon nitride polymer has poor electrical conductivity and does not have an advantage in the current detection strategy. Using Th as an intermediate medium to promote electron transfer improves the problem of poor electrical conductivity of the carbon nitride polymer and significantly increases the overall detection limit for target detection. In addition, the good characteristics such as high affinity, specificity and stability of the thiolated OA aptamer greatly ensure the good selectivity of the reverse amplification electrochemical biosensor for target detection. It should be noted that the characteristic of poor electrical conductivity of the carbon nitride polymer provides an opportunity for realizing high-sensitivity detection of OA by this electrochemical biosensor. The thiolated ssDNA immobilized on the carbon nitride polymer can be complementary paired with the thiolated OA aptamer that has not reacted with OA. Then, by detecting the change in current information through differential pulse voltammetry, reverse amplification detection of OA can be successfully achieved. In addition, the detection of this reverse amplification mode can also achieve semi-quantitative detection of ssDNA. This reverse amplification sensor provides advantages and new trends for label-free detection of small molecules, especially in the field of marine biotoxin detection.

[0065] A method for rapidly, simply and effectively reverse detecting OA by applying functionalized amino-carbon nitride polymer, comprising the following steps:

[0066] (1) Preparing amino-carbon nitride polymer (C3N4) by a pyrolysis method:

[0067] (1.1) Mix urea and melamine at a mass ratio of 1:1, heat at a heating rate of 1 - 3 °C / min to 550 - 600 °C, and keep the reaction for 5 - 7 h.

[0068] (1.2) Obtain a yellow powder from (1.1) and grind it.

[0069] (1.3) Heat the product obtained from (1.2) at a heating rate of 4 - 7 °C / min to 500 - 600 °C and keep it for 1 - 3 h to obtain the product graphite-phase carbon nitrde (g-C3N4).

[0070] (1.4) Mix the product g-C3N4 obtained in (1.3) with concentrated hydrochloric acid at a mass ratio of 10:1 at 30°C to 50°C for 4 to 6 hours.

[0071] (1.5) Centrifuge and wash the mixed solution in (1.4) until the pH value of the supernatant reaches neutral.

[0072] (1.6) Disperse the precipitate obtained in step (1.5) in ultrapure water, and use ultrasound (power 50%-80%, 5-10 min) to exfoliate the nanosheets to promote the stratification of the nanosheets, and centrifuge to collect the exfoliated nanosheets.

[0073] (1.7) Vacuum-dry the exfoliated nanosheets obtained in step (1.6) to obtain a powder, which is the amino-carbonitride polymer material. Among them, the vacuum-drying temperature is 50°C and the time is 24 hours.

[0074] (2) Covalently link the product amino-carbonitride polymer obtained in (1) with the thiolated OA aptamer to obtain the OA aptamer-functionalized amino-carbonitride polymer.

[0075] (2.1) Add 1 to 10 mg of the amino-carbonitride polymer material to 1000 μL of PBS buffer (2 mM, pH 7.2) and sonicate for 5 to 10 minutes.

[0076] (2.2) Preparation of the amino-carbonitride polymer-SMCC copolymer solution

[0077] (2.2.1) Take out Sulfo-SMCC from the refrigerator and place it at room temperature, and prepare a Sulfo-SMCC solution with a concentration of 10 to 100 mg / mL using ultrapure water.

[0078] (2.2.2) Mix the solution obtained in (2.2.1) with 10 mg / mL Sulfo-SMCC in a volume ratio of 20:1 and react for 2 hours at room temperature with stirring to obtain the amino-carbonitride polymer-SMCC copolymer.

[0079] (2.2.3) Then, by centrifugal washing, remove the supernatant to wash away the excess Sulfo-SMCC molecules (8000 rpm, 5 to 10 minutes), and repeat 3 to 6 times.

[0080] (2.2.4) Redisperse the obtained precipitate in PBS buffer to obtain the amino-carbonitride polymer-SMCC copolymer solution.

[0081] (2.3) During this period, prepare the OA aptamer solution (OA aptamer sequence: GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG) and the ssDNA solution (ssDNA sequence: GTAGCGCTCCCTGTTGTTGGTGACC).

[0082] (2.3.1) Mix the 10 mM (Tris(2-carboxyethyl)phosphine, TCEP) solution, 100 μM OA aptamer solution / ssDNA solution, and ddH2O in a volume ratio of 1:1:8 to activate the thiol groups.

[0083] (2.3.2) At room temperature, the reduction reaction lasts for 30 - 60 min to obtain the thiolated OA aptamer solution and the thiolated ssDNA solution.

[0084] (2.4) Respectively mix the thiolated OA aptamer solution and the thiolated ssDNA solution obtained in (2.3.2) with the amino-carbon nitride polymer-SMCC copolymer solution obtained in (2.2.4) in a volume ratio of 1:9, and react with slow shaking;

[0085] (2.5) After 4 h, the covalent reactions of the thiolated OA aptamer and the thiolated ssDNA on the surface of the amino-carbon nitride polymer are completed respectively, and the thiolated OA aptamer-functionalized amino-carbon nitride polymer material and the thiolated ssDNA-functionalized amino-carbon nitride polymer material are obtained. Finally, wash away the excess thiolated OA aptamer and thiolated ssDNA by centrifugal washing (6000 rpm, 3 - 5 min). And dissolve the prepared thiolated OA aptamer-functionalized amino-carbon nitride polymer material and the thiolated ssDNA-functionalized amino-carbon nitride polymer material in PBS buffer respectively.

[0086] (3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (2.5) with the Th solution to obtain the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer;

[0087] (3.1) Ultrasonic the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution obtained in (2.5) for 30 min to promote the dispersion of the nanosheets;

[0088] (3.2) Prepare the Th solution with PBS at a concentration of 5 mg / mL.

[0089] (3.3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbonitride polymer solution in the dispersed state obtained in (3.1) with the Th solution prepared in (3.2), and stir at room temperature for 48 h.

[0090] (3.4) Centrifuge the mixed solution obtained in (3.3), wash thoroughly to remove excess Th particles, and obtain Th-modified thiolated OA aptamer-functionalized amino-carbonitride polymer, which is dissolved in ultrapure water.

[0091] (4) Modify the glassy carbon electrode with the Th-modified thiolated OA aptamer-functionalized amino-carbonitride polymer prepared in (3.4) to obtain a functionalized working electrode.

[0092] (4.1) Polish the glassy carbon electrode successively with alumina powder with particle sizes of 1.5 - 2.0 μm and 0.5 - 1.0 μm.

[0093] (4.2) In a 5 mM - 10 mM K4Fe(CN)6 / K3Fe(CN)6 solution, scan the polished electrode obtained in (3.1) by cyclic voltammetry to obtain the voltage difference ΔP between the cathode and anode in the cyclic voltammogram.

[0094] (4.3) Until ΔP is less than or equal to 80 mV, otherwise repeat steps (3.1) to (3.2).

[0095] (4.4) Drop 10 - 20 μL of the Th-modified thiolated OA aptamer-functionalized amino-carbonitride polymer prepared in (2.5) onto the surface of the glassy carbon electrode (covering the electrode surface is sufficient), and place it in a dust-free condition for 12 - 16 h to obtain a functionalized working electrode.

[0096] (4.5) Use the functionalized electrode obtained in (4.4) as the working electrode, a platinum electrode as the counter electrode, and a calomel electrode as the reference electrode to form a three-electrode system, and use an electrochemical workstation to perform OA electrochemical detection.

[0097] (5) Detect the target OA.

[0098] (5.1) Place the three-electrode system mentioned in (4.5) in a 5 mM - 10 mM K4Fe(CN)6 / K3Fe(CN)6 solution, and use an electrochemical workstation to perform DPV detection to obtain the initial current change information.

[0099] (5.2) Immerse the functionalized working electrode after measurement in (5.1) in the target analyte OA solution and mix and react for 60 - 120 min.

[0100] (5.3) Perform DPV testing on the functionalized electrode after the reaction in (5.2) to obtain the current change information caused by OA.

[0101] (5.4) Insert the functionalized electrode combined with OA after the reaction in (5.3) into the solution of mercapto-ssDNA functionalized amino-carbon nitride polymer obtained in (2.5), and wrap it with a sealing film to prevent the solution from evaporating;

[0102] (5.5) After allowing the mixture system in (5.4) to stand and react for 120 min to 180 min, perform DPV testing to achieve quantitative detection of OA through reverse amplification.

[0103] A reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer includes parts such as carbon nitride polymer, protein crosslinker Sulfo-SMCC, thionine (Th), mercapto-OA aptamer, mercapto-ssDNA, and glassy carbon electrode. In the present invention, the amino-rich carbon nitride polymer is used as a carrier, and through a typical bifunctional crosslinking method, it is used as the carrier of both the sensitive material and the reverse amplification material, and an electrochemical biosensor with reverse amplification function is successfully constructed. The maleimide groups of the amino-rich carbon nitride polymer are exposed under the action of Sulfo-SMCC and covalently connected to the mercapto groups modified on the nucleic acid chain. However, the carbon nitride polymer has poor conductivity and does not have an advantage in current detection methods. Th, as an intermediate medium to promote electron transfer, improves the problem of poor conductivity of the carbon nitride polymer and significantly increases the overall detection limit for target detection. In addition, the good characteristics such as high affinity, specificity, and stability of the mercapto-OA aptamer greatly ensure the good selectivity of the reverse amplification electrochemical biosensor for target detection. It is worth noting that the characteristic of poor conductivity of the carbon nitride polymer provides an opportunity for achieving high-sensitivity detection of OA by this electrochemical biosensor. The mercapto-ssDNA immobilized on the carbon nitride polymer can undergo complementary pairing with the mercapto-OA aptamer that has not reacted with OA. By detecting the change in its current information through differential pulse voltammetry, reverse amplification detection of OA can be successfully achieved. In addition, this reverse amplification mode of detection can also achieve semi-quantitative detection of ssDNA. This reverse amplification sensor provides advantages and new trends for label-free detection of small molecules, especially in the field of marine biotoxin detection.

[0104] The present invention provides a reverse amplification electrochemical biosensor for OA detection based on a functionalized carbon nitride polymer. The sensor includes amino-carbon nitride polymer, protein cross-linking agent Sulfosuccinimidyl 4-(Nmaleimidomethyl)cyclohexane-1–carboxylate (Sulfo-SMCC), thiolated OA aptamer, thionine (Th), thiolated ssDNA, and glassy carbon electrode, etc.

[0105] The specific work content completed by this method includes: synthesis of amino-carbon nitride polymer; functional modification of the amino-carbon nitride polymer with thiolated OA aptamer; Th as an electron transfer mediator to improve the conductivity of the carbon nitride polymer; modification of the glassy carbon electrode surface with functionalized amino-carbon nitride polymer; functional modification of the amino-carbon nitride polymer with thiolated ssDNA; complementary pairing of the thiolated ssDNA-functionalized amino-carbon nitride polymer and the thiolated OA aptamer-functionalized amino-carbon nitride polymer modified with Th; differential pulse voltammetry (DPV) detection of OA by the functionalized working electrode. The test results show that the sensor system is simple, effective, low-cost, and highly sensitive. Based on the diversity of aptamers and single-strand DNA (ssDNA), this reverse amplification electrochemical biosensor provides a general detection method for the detection of toxins, biomolecules, and organic molecules.

[0106] The present invention will be described in detail below with reference to the embodiments. It should be noted that, without conflict, the embodiments and features in the embodiments of the present application can be combined with each other.

[0107] The following detailed descriptions are all descriptions of the embodiments, aiming to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the art to which the present application belongs. The terms used in the present invention are only for describing specific embodiments, and are not intended to limit the exemplary embodiments according to the present invention.

[0108] Example 1

[0109] Figure 1 In this study, the thiolated OA aptamer-functionalized amino-carbon nitride polymer includes amino-carbon nitride polymer, Sulfo-SMCC, thiolated OA aptamer chain, OA, Th, and thiolated ssDNA.

[0110] A method for simply and effectively detecting OA by using the above-mentioned Th-modified mercapto OA aptamer-functionalized amino-carbon nitride polymer and mercapto-ssDNA-functionalized amino-carbon nitride polymer, comprising the following steps:

[0111] (1) Preparation of amino-carbon nitride polymer (C3N4) by pyrolysis method:

[0112] (1.1) Mix urea and melamine in a mass ratio of 1:1, heat to 550 °C at a heating rate of 3 °C / min, and keep the reaction for 5 h.

[0113] (1.2) The yellow powder obtained from (1.1) is ground.

[0114] (1.3) Heat the product obtained from (1.2) to 550 °C at a heating rate of 5 °C / min and keep it for 1 h to obtain the product graphite-phase carbon nitride (g-C3N4).

[0115] (1.4) Mix the product g-C3N4 obtained from (1.3) with concentrated hydrochloric acid in a mass ratio of 10:1 at 30 °C for 4 h;

[0116] (1.5) Centrifuge and wash the mixed solution of (1.4) until the pH value of the supernatant reaches neutral.

[0117] (1.6) Disperse the precipitate obtained in step (1.5) in ultrapure water, use ultrasound (power 50%, 5 min) to exfoliate the nanosheets to promote nanosheet delamination, and centrifuge to collect the exfoliated nanosheets.

[0118] (1.7) Vacuum dry the exfoliated nanosheets obtained in step (1.6) to obtain a powder, which is the amino-carbon nitride polymer material. Among them, the vacuum drying temperature is 50 °C and the time is 24 h.

[0119] (2) Covalently connect the product amino-carbon nitride polymer obtained in (1) with the mercapto OA aptamer to obtain the OA aptamer-functionalized amino-carbon nitride polymer.

[0120] (2.1) Add 10 mg of the amino-carbon nitride polymer material to 1000 μL of PBS buffer (2 mM, pH 7.2) and sonicate for 5 min;

[0121] (2.2) Preparation of amino-carbon nitride polymer-SMCC copolymer solution

[0122] (2.2.1) Take out Sulfo-SMCC from the refrigerator and place it at room temperature, and prepare a 10 mg / mL Sulfo-SMCC solution with ultrapure water.

[0123] (2.2.2) Mix the solution obtained in (2.2.1) with 10 mg / mL Sulfo - SMCC in a volume ratio of 20:1 and react with stirring for 120 min at room temperature to obtain an amino - carbon - nitrogen polymer - SMCC copolymer.

[0124] (2.2.3) Then, by centrifugal washing, remove the supernatant to wash away the excess Sulfo - SMCC molecules (8000 rpm, 5 min). Repeat this process 3 times.

[0125] (2.2.4) Redisperse the obtained precipitate in PBS buffer to obtain an amino - carbon - nitrogen polymer - SMCC copolymer solution.

[0126] (2.3) During this period, prepare an OA aptamer solution (OA aptamer sequence: GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG) and an ssDNA solution (ssDNA sequence: GTAGCGCTCCCTGTTGTTGGTGACC).

[0127] (2.3.1) Mix a 10 mM (Tris(2 - carboxyethyl)phosphine, TCEP) solution, a 100 μM OA aptamer solution / ssDNA solution, and ddH2O in a volume ratio of 1:1:8 to activate the thiol groups.

[0128] (2.3.2) At room temperature, the reduction reaction lasts for 30 min to obtain a thiolated OA aptamer solution and a thiolated ssDNA solution.

[0129] (2.4) Respectively mix the thiolated OA aptamer solution and the thiolated ssDNA solution obtained in (2.3.2) with the amino - carbon - nitrogen polymer - SMCC copolymer solution obtained in (2.2.4) in a volume ratio of 1:9, and react with slow shaking;

[0130] (2.5) After 4 h, the covalent reactions of the thiolated OA aptamer and the thiolated ssDNA on the surface of the amino - carbon - nitrogen polymer are completed respectively to obtain a thiolated OA aptamer - functionalized amino - carbon - nitrogen polymer material and a thiolated ssDNA - functionalized amino - carbon - nitrogen polymer material. Finally, wash away the excess thiolated OA aptamer and thiolated ssDNA by centrifugal washing (6000 rpm, 5 min) respectively. And dissolve the prepared thiolated OA aptamer - functionalized amino - carbon - nitrogen polymer material and thiolated ssDNA - functionalized amino - carbon - nitrogen polymer material in PBS buffer respectively.

[0131] (3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (2.5) with the Th solution to obtain the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer.

[0132] (3.1) Ultrasonicate the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution obtained in (2.5) for 30 min to promote the dispersion of nanosheets.

[0133] (3.2) Prepare the Th solution with PBS at a concentration of 5 mg / mL.

[0134] (3.3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution in the dispersed state obtained in (3.1) with the Th solution prepared in (3.2), and stir at room temperature for 48 h.

[0135] (3.4) Centrifuge the mixed solution obtained in (3.3), wash thoroughly to remove excess Th particles, obtain the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer, and dissolve it in ultrapure water.

[0136] (4) Modify the glassy carbon electrode with the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer prepared in (3.4) to obtain a functionalized working electrode.

[0137] (4.1) Polish the glassy carbon electrode successively with alumina powder of particle size 1.5 μm and 0.5 μm.

[0138] (4.2) In a 5 mM K4Fe(CN)6 / K3Fe(CN)6 solution, scan the polished electrode obtained in (3.1) by cyclic voltammetry to obtain the voltage difference ΔP between the cathode and anode in the cyclic voltammogram.

[0139] (4.3) Until ΔP is less than or equal to 80 mV, otherwise repeat steps (3.1) to (3.2).

[0140] (4.4) Drop 20 μL of the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer prepared in (2.5) onto the surface of the glassy carbon electrode (covering the electrode surface is sufficient), and place it in a dust-free condition for 12 h to obtain a functionalized working electrode.

[0141] (4.5) Use the functionalized electrode obtained in (4.4) as the working electrode, a platinum electrode as the counter electrode, and a calomel electrode as the reference electrode to form a three-electrode system, and use an electrochemical workstation to perform OA electrochemical detection.

[0142] (5) Detect the target OA.

[0143] (5.1) The three-electrode system referred to in (4.5) is placed in a 5 mM K4Fe(CN)6 / K3Fe(CN)6 solution and DPV detection is performed using an electrochemical workstation to obtain the initial current change information.

[0144] (5.2) Immerse the functionalized working electrode measured in (5.1) in the target OA solution and allow the mixture to react for 1 hour.

[0145] (5.3) The functionalized electrode after reaction (5.2) is subjected to DPV testing to obtain the current change information caused by OA.

[0146] (5.4) inserting the OA-bound functionalized electrode after the reaction in (5.3) into the thiol-functionalized ssDNA amino-carbon nitrogen polymer solution obtained in (2.5), and wrapping it with a sealing film to prevent the solution from evaporating;

[0147] (5.5) After the mixed system (5.4) was allowed to react for 60 min, a DPV test was performed to achieve quantitative detection of OA through reverse amplification.

[0148] Figure 2 yes Figure 1 Based on the SEM images of C3N4 and C3N4-aptamer-Th+C3N4-ssDNA, the amino-carbon nitrogen polymer structure always maintains a rough sheet structure before and after modification.

[0149] Figure 3 This is the Zeta potential diagram before and after the amino-carbon nitrogen polymer functionalization. It can be seen from the figure that the amino-modified C3N4 still carries more negative charges. After modification with the negatively charged thiolated OA aptamer and thiolated ssDNA, C3N4 carries more negative charges. Since Th carries a positive charge, the Th-modified C3N4-aptamer neutralizes the negative charge carried by the C3N4-aptamer. After the complementary pairing of C3N4-aptamer-Th and C3N4-ssDNA, the entire system carries a negative charge. This process shows the successful functionalization of the amino-carbon nitrogen polymer and the potential for reverse quantitative detection of OA and semi-quantitative detection of ssDNA.

[0150] Figure 4It is the cyclic voltammogram of the present invention before and after the surface of the glassy carbon electrode is modified with C3N4-aptamer-Th, the reaction with OA, and the complementary pairing of C3N4-ssDNA with the unreacted OA aptamer; obviously, before and after the functionalization of the glassy carbon electrode, after the mixed reaction with OA, and after the complementary pairing of C3N4-ssDNA with the unreacted OA aptamer, the peak values of the double peaks in its cyclic voltammogram curve are significantly reduced, and the semicircle diameter of the electrochemical impedance curve is significantly increased, indicating the successful functionalization modification of the glassy carbon electrode, and the potential possibility of reverse quantitative detection of OA and semi-quantitative detection of ssDNA. This result is consistent with Figure 5 the differential pulse voltammogram results of detecting OA before and after the surface of the glassy carbon electrode is modified with C3N4-aptamer-Th.

[0151] Figure 6 It is the DPV curve of the electrochemical sensor system built based on C3N4-aptamer-Th modification and C3N4-ssDNA for the detection of OA and other marine toxins in the present invention; Dinophysistoxin (DTX) is a natural derivative toxin of OA, and Yessotoxin (YTX) and Palytoxin (PTX) are other types of marine biotoxins. In the present invention, other types of marine biotoxins 100 times higher than the OA concentration are used as the control group to verify the selectivity characteristics of the bioelectrochemical sensor for OA. The experimental results show that due to the high affinity of the aptamer for OA, the electrochemical sensor system built based on C3N4-aptamer-Th modification and C3N4-ssDNA shows good selectivity for OA.

[0152] Figure 7 It is the DPV curve of the electrochemical sensor system built based on C3N4-aptamer-Th and C3N4-ssDNA for the detection of different concentrations of OA. It can be seen from the figure that the electrochemical sensor built based on the functionalization of the thiolated OA aptamer-modified amino-carbonitride polymer realizes the effective measurement of different concentrations of OA. As the concentration of OA increases, the peak current of DPV shows a gradient increase, which also indicates the high-sensitivity detection characteristics of the functionalized electrode for OA. The above experiments show that the electrochemical sensor technology for OA detection constructed based on the specific binding of C3N4-aptamer-Th to OA and the complementary pairing of C3N4-ssDNA in this study is not only simple and easy to implement, but also low in cost, providing a favorable research direction for the development of portable OA detection devices.

[0153] Example 2

[0154] A method for rapidly, simply and effectively detecting OA by applying the above mercapto-OA aptamer-functionalized amino-carbon nitride polymer, comprising the following steps:

[0155] (1) Prepare amino-carbon nitride polymer (C3N4) by pyrolysis method:

[0156] (1.1) Mix urea and melamine in a ratio of 1:1, heat to 550 °C at a heating rate of 2 °C / min, and keep for 6 h.

[0157] (1.2) Obtain a yellow powder from (1.1) and grind it.

[0158] (1.3) Heat the product obtained in (1.2) to 550 °C at a heating rate of 5 °C / min and keep for 120 min to obtain the product graphite-phase carbon nitrde (g-C3N4).

[0159] (1.4) Mix the product g-C3N4 obtained in (1.3) with concentrated hydrochloric acid at a mass ratio of 10:1 at 40 °C for 5 h;

[0160] (1.5) Centrifuge and wash the mixed solution in (1.4) until the pH value of the supernatant reaches neutral.

[0161] (1.6) Disperse the precipitate obtained in step (1.5) in ultrapure water, use ultrasound (power 60%, 10 min) to exfoliate the nanosheets to promote nanosheet delamination, and centrifuge to collect the exfoliated nanosheets.

[0162] (1.7) Vacuum dry the exfoliated nanosheets obtained in step (1.6) to obtain a powder, namely the amino-carbon nitride polymer material. Among them, the vacuum drying temperature is 50 °C and the time is 24 h.

[0163] (2) Covalently connect the product amino-carbon nitride polymer obtained in (1) with the mercapto-OA aptamer to obtain the OA aptamer-functionalized amino-carbon nitride polymer.

[0164] (2.1) Add 10 mg of the amino-carbon nitride polymer material to 1000 μL of PBS buffer (2 mM, pH 7.2) and sonicate for 10 min

[0165] (2.2) Preparation of amino-carbon nitride polymer-SMCC copolymer solution

[0166] (2.2.1) Take out Sulfo-SMCC from the refrigerator and place it at room temperature, and prepare a Sulfo-SMCC solution with a concentration of 80 mg / mL with ultrapure water.

[0167] (2.2.2) Mix the solution obtained in (2.2.1) with 10 mg / mL Sulfo-SMCC at a volume ratio of 20:1 and react with stirring for 2 h at room temperature to obtain an amino-carbon nitride polymer-SMCC copolymer.

[0168] (2.2.3) Then, by means of centrifugation and washing, remove the supernatant to wash away the excess Sulfo-SMCC molecules (8000 rpm, 10 min). And repeat 3 times.

[0169] (2.2.4) Redisperse the obtained precipitate in PBS buffer to obtain an amino-carbon nitride polymer-SMCC copolymer solution.

[0170] (2.3) During this period, prepare an OA aptamer solution (OA aptamer sequence: GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG) and an ssDNA solution (ssDNA sequence: GTAGCGCTCCCTGTTGTTGGTGACC).

[0171] (2.3.1) Mix a 10 mM (Tris(2-carboxyethyl)phosphine, TCEP) solution, a 100 μM OA aptamer solution / ssDNA solution, and ddH2O in a volume ratio of 1:1:8 to activate the thiol groups.

[0172] (2.3.2) At room temperature, the reduction reaction lasts for 40 min to obtain a thiolated OA aptamer solution and a thiolated ssDNA solution.

[0173] (2.4) Respectively mix the thiolated OA aptamer solution and the thiolated ssDNA solution obtained in (2.3.2) with the amino-carbon nitride polymer-SMCC copolymer solution obtained in (2.2.4) at a volume ratio of 1:9 and react with slow shaking;

[0174] (2.5) After 4 h, the covalent reactions of the thiolated OA aptamer and the thiolated ssDNA on the surface of the amino-carbon nitride polymer are completed respectively to obtain a thiolated OA aptamer-functionalized amino-carbon nitride polymer material and a thiolated ssDNA-functionalized amino-carbon nitride polymer material. Finally, respectively by centrifugation and washing, wash away the excess thiolated OA aptamer and thiolated ssDNA (6000 rpm, 5 min). And dissolve the prepared thiolated OA aptamer-functionalized amino-carbon nitride polymer material and thiolated ssDNA-functionalized amino-carbon nitride polymer material in PBS buffer respectively.

[0175] (3) The thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (2.5) is uniformly mixed with the Th solution to obtain the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer.

[0176] (3.1) Ultrasonicate the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution obtained in (2.5) for 30 min to promote the dispersion of the nanosheets.

[0177] (3.2) Prepare the Th solution with PBS at a concentration of 10 mg / mL.

[0178] (3.3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution in the dispersed state obtained in (3.1) with the Th solution prepared in (3.2), and stir at room temperature for 36 h.

[0179] (3.4) Centrifuge the mixed solution obtained in (3.3), wash thoroughly to remove the excess Th particles, obtain the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer, and dissolve it in ultrapure water.

[0180] (4) Modify the glassy carbon electrode with the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer prepared in (3.4) to obtain a functionalized working electrode.

[0181] (4.1) Polish the glassy carbon electrode successively with alumina powders of particle sizes 1.5 and 0.1 μm.

[0182] (4.2) In a 5 mM K4Fe(CN)6 / K3Fe(CN)6 solution, scan the polished electrode obtained in (3.1) by cyclic voltammetry to obtain the voltage difference ΔP between the cathode and the anode in the cyclic voltammogram.

[0183] (4.3) Until ΔP is less than or equal to 80 mV, otherwise repeat steps (3.1) to (3.2).

[0184] (4.4) Drop 10 μL of the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer prepared in (2.5) onto the surface of the glassy carbon electrode (covering the electrode surface is sufficient), and place it in a dust-free condition for 14 h to obtain a functionalized working electrode.

[0185] (4.5) Use the functionalized electrode obtained in (4.4) as the working electrode, a platinum electrode as the counter electrode, and a calomel electrode as the reference electrode to form a three-electrode system, and perform OA electrochemical detection using an electrochemical workstation.

[0186] (5) Detect the target OA.

[0187] (5.1) Place the three - electrode system referred to in (4.5) in a 5 mM K4Fe(CN)6 / K3Fe(CN)6 solution, and perform differential pulse voltammetry (DPV) detection using an electrochemical workstation to obtain the initial current change information.

[0188] (5.2) Immerse the functionalized working electrode after the measurement in (5.1) in the target analyte OA solution and mix and react for 60 min.

[0189] (5.3) Perform DPV testing on the functionalized electrode after the reaction in (5.2) to obtain the current change information caused by OA.

[0190] (5.4) Insert the functionalized electrode combined with OA after the reaction in (5.3) into the mercapto - modified ssDNA - functionalized amino - carbon nitride polymer solution obtained in (2.5), and wrap it with a sealing film to prevent the solution from evaporating;

[0191] (5.5) After allowing the mixture in (5.4) to stand and react for 120 min, perform DPV testing to achieve quantitative detection of OA through reverse amplification.

[0192] Example 3

[0193] A method for rapidly, simply, and effectively detecting OA by applying the above - mentioned mercapto - modified OA aptamer - functionalized amino - carbon nitride polymer, comprising the following steps:

[0194] (1) Prepare amino - carbon nitride polymer (C3N4) by pyrolysis method:

[0195] (1.1) Mix urea and melamine in a ratio of 1:1, heat at a heating rate of 3 °C / min to 600 °C, and hold for 6 h.

[0196] (1.2) Obtain a yellow powder from (1.1) and grind it.

[0197] (1.3) Heat the product obtained in (1.2) at a heating rate of 7 °C / min to 600 °C and hold for 120 min to obtain the product graphite - phase carbon nitride (g - C3N4).

[0198] (1.4) Mix the product g - C3N4 obtained in (1.3) with concentrated hydrochloric acid in a mass ratio of 10:1 at 50 °C for 6 h;

[0199] (1.5) Centrifuge and wash the mixed solution in (1.4) until the pH value of the supernatant reaches neutral.

[0200] (1.6) Disperse the precipitate obtained in step (1.5) in ultrapure water, and use ultrasonic waves (power 60%, 10 min) to exfoliate the nanosheets to promote the stratification of the nanosheets, and centrifuge to collect the exfoliated nanosheets.

[0201] (1.7) Vacuum-dry the exfoliated nanosheets obtained in step (1.6) to obtain a powder, namely the amino-carbonitride polymer material. Among them, the vacuum-drying temperature is 50 °C and the time is 24 h.

[0202] (2) Covalently link the product amino-carbonitride polymer obtained in (1) with the thiolated OA aptamer to obtain the OA aptamer-functionalized amino-carbonitride polymer.

[0203] (2.1) Add 10 mg of the amino-carbonitride polymer material to 1000 μL of PBS buffer (2 mM, pH 7.2) and ultrasonicate for 6 min

[0204] (2.2) Preparation of the amino-carbonitride polymer-SMCC copolymer solution

[0205] (2.2.1) Take out Sulfo-SMCC from the refrigerator and place it at room temperature, and prepare a Sulfo-SMCC solution with a concentration of 100 mg / mL using ultrapure water.

[0206] (2.2.2) Mix and react the solution obtained in (2.2.1) with 10 mg / mL Sulfo-SMCC according to a volume ratio of 20:1, and stir at room temperature for 2 h to obtain the amino-carbonitride polymer-SMCC copolymer.

[0207] (2.2.3) Then, by means of centrifugal washing, remove the supernatant to wash away the excess Sulfo-SMCC molecules (8000 revolutions / min, 10 min). And repeat 3 times.

[0208] (2.2.4) Redisperse the obtained precipitate in PBS buffer to obtain the amino-carbonitride polymer-SMCC copolymer solution.

[0209] (2.3) During this period, prepare the OA aptamer solution (OA aptamer sequence: GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCAT GCGGATGTGTGG) and the ssDNA solution (ssDNA sequence: GTAGCGCTCCCTGTTGTTGGTGACC).

[0210] (2.3.1) Mix a 10 mM (Tris(2-carboxyethyl)phosphine, TCEP) solution, a 100 μM OA aptamer solution / ssDNA solution, and ddH2O in a volume ratio of 1:1:8 to activate the thiol groups.

[0211] (2.3.2) At room temperature, the reduction reaction lasts for 40 min to obtain a thiolated OA aptamer solution and a thiolated ssDNA solution.

[0212] (2.4) Respectively mix the thiolated OA aptamer solution and the thiolated ssDNA solution obtained in (2.3.2) with the amino-carbon nitride polymer-SMCC copolymer solution obtained in (2.2.4) in a volume ratio of 1:9, and react with slow oscillation.

[0213] (2.5) After 4 h, the covalent reactions of the thiolated OA aptamer and the thiolated ssDNA on the surface of the amino-carbon nitride polymer are completed respectively to obtain a thiolated OA aptamer-functionalized amino-carbon nitride polymer material and a thiolated ssDNA-functionalized amino-carbon nitride polymer material. Finally, wash off the excess thiolated OA aptamer and thiolated ssDNA by centrifugal washing (6000 rpm, 5 min). And dissolve the prepared thiolated OA aptamer-functionalized amino-carbon nitride polymer material and thiolated ssDNA-functionalized amino-carbon nitride polymer material in PBS buffer respectively.

[0214] (3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (2.5) with the Th solution to obtain a Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer

[0215] (3.1) Ultrasonicate the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution obtained in (2.5) for 30 min to promote the dispersion of the nanosheets.

[0216] (3.2) Prepare a Th solution with PBS at a concentration of 8 mg / mL.

[0217] (3.3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution in the dispersed state obtained in (3.1) with the Th solution prepared in (3.2), and stir at room temperature for 36 h.

[0218] (3.4) Centrifuge the mixed solution obtained in (3.3), wash thoroughly to remove the excess Th particles, obtain a Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer, and dissolve it in ultrapure water.

[0219] (4) Modify the glassy carbon electrode with the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer prepared in (3.4) to obtain a functionalized working electrode.

[0220] (4.1) Polish the glassy carbon electrode successively with alumina powder of particle size 1.5 μm and 0.1 μm.

[0221] (4.2) In a 5 mM K4Fe(CN)6 / K3Fe(CN)6 solution, scan the polished electrode obtained in (3.1) by cyclic voltammetry to obtain the voltage difference ΔP between the cathode and anode in the cyclic voltammogram.

[0222] (4.3) Until ΔP is less than or equal to 80 mV, otherwise repeat steps (3.1) to (3.2).

[0223] (4.4) Drop 10 μL of the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer prepared in (2.5) onto the surface of the glassy carbon electrode (covering the electrode surface is sufficient), and place it in a dust-free condition for 14 h to obtain a functionalized working electrode.

[0224] (4.5) Use the functionalized electrode obtained in (4.4) as the working electrode, a platinum electrode as the counter electrode, and a calomel electrode as the reference electrode to form a three-electrode system, and use an electrochemical workstation to perform OA electrochemical detection.

[0225] (5) Detect the target OA.

[0226] (5.1) Place the three-electrode system mentioned in (4.5) in a 10 mM K4Fe(CN)6 / K3Fe(CN)6 solution, and perform DPV detection using an electrochemical workstation to obtain the initial current change information.

[0227] (5.2) Immerse the functionalized working electrode after measurement in (5.1) in the target analyte OA solution and mix and react for 60 min.

[0228] (5.3) Perform DPV testing on the functionalized electrode after the reaction in (5.2) to obtain the current change information caused by OA.

[0229] (5.4) Insert the functionalized electrode combined with OA after the reaction in (5.3) into the thiolated ssDNA-functionalized amino-carbon nitride polymer solution obtained in (2.5), and wrap it with a sealing film to prevent solution evaporation;

[0230] (5.5) After allowing the mixture in (5.4) to stand and react for 120 min, perform DPV testing to achieve quantitative detection of OA through reverse amplification.

[0231] The above-described embodiments are only the preferred technical solutions of the present invention and should not be regarded as limitations on the present invention. The embodiments in this application and the features in the embodiments can be arbitrarily combined with each other without conflict. The protection scope of the present invention should be the technical solutions recorded in the claims, including the equivalent replacement solutions of the technical features in the technical solutions recorded in the claims. That is, the equivalent replacement improvements within this scope are also within the protection scope of the present invention.

Claims

1. Preparation method of a reverse amplification electrochemical biosensor based on functionalized carbonitride polymers, characterized in that, It includes the following steps: (1) Prepare amino-carbon nitride polymer by pyrolysis method; (2) Covalently link the amino-carbon nitride polymer obtained in step (1) with thiolated OA aptamer and thiolated ssDNA with a terminal complementary fragment to the OA aptamer respectively to obtain a thiolated OA aptamer-functionalized amino-carbon nitride polymer and a thiolated ssDNA-functionalized amino-carbon nitride polymer. Among them, the OA aptamer sequence is: GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG; the ssDNA sequence is: GTAGCGCTCCCTGTTGTTGGTGACC; (3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (2) with Th solution, and obtain a Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer by electrostatic adsorption; (4) Modify a glassy carbon electrode with the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer obtained in step (3) to obtain a functionalized working electrode, and then combine a platinum electrode as a counter electrode and a calomel electrode as a reference electrode to jointly form a three-electrode system required for detection. The three-electrode system and the thiolated ssDNA-functionalized amino-carbon nitride polymer obtained in step (2) jointly form a reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer.

2. The preparation method of the reverse amplification electrochemical biosensor based on functionalized carbonitride polymer according to claim 1, wherein Step (1) specifically includes: (1.1) Mix urea and melamine in a mass ratio of 1:1, heat to 550-600 °C at a heating rate of 1-3 °C / min, and react for 5-7 h to obtain a yellow powder; (1.2) Grind the yellow powder obtained in step (1.1); (1.3) Heat the product obtained in step (1.2) to 500-600 °C at a heating rate of 4-7 °C / min and hold for 1-3 h to obtain g-C3N4; (1.4) Mix g-C3N4 obtained in step (1.3) with concentrated hydrochloric acid in a mass ratio of 10:1 and react at 30 °C - 50 °C for 4-6 h to obtain a mixed solution; (1.5) Centrifuge and wash the mixed solution obtained in step (1.4) until the pH value of the supernatant reaches neutral, and then filter to obtain a precipitate; (1.6) Disperse the precipitate obtained in step (1.5) in ultrapure water, perform ultrasonic exfoliation of nanosheets to promote nanosheet delamination, and centrifuge to collect exfoliated nanosheets; (1.7) Vacuum-dry the exfoliated nanosheets obtained in step (1.6) to obtain a powder, which is the amino-carbon nitride polymer. The vacuum-drying temperature is 50 °C and the time is 24 h.

3. The preparation method of the reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer according to claim 1, characterized in that, Step (2) is specifically: (2.1)Add the amino-carbon nitride polymer to PBS buffer and sonicate for 5 - 10 min, adding 1 - 10 mg of the amino-carbon nitride polymer to every 1000 μL of PBS buffer to obtain an amino-carbon nitride polymer solution, where the concentration of the PBS buffer is 2 mM and the pH is 7.2; (2.2)Prepare an amino-carbon nitride polymer-SMCC copolymer solution, and simultaneously prepare a thiolated OA aptamer solution and a thiolated ssDNA solution; (2.3)Mix the thiolated OA aptamer solution and the thiolated ssDNA solution with the amino-carbon nitride polymer-SMCC copolymer solution respectively in a volume ratio of 1:9 by shaking and reacting. After 4 h of reaction, end the reaction. Wash away the excess thiolated OA aptamer and thiolated ssDNA by centrifugal washing respectively to obtain a thiolated OA aptamer-functionalized amino-carbon nitride polymer and a thiolated ssDNA-functionalized amino-carbon nitride polymer, and disperse the thiolated OA aptamer-functionalized amino-carbon nitride polymer and the thiolated ssDNA-functionalized amino-carbon nitride polymer in PBS buffer respectively.

4. The preparation method of the reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer according to claim 3, characterized in that, The preparation of the amino-carbon nitride polymer-SMCC copolymer solution in step (2.2) specifically includes: (2.2.1)Prepare a Sulfo-SMCC solution with a concentration of 10 - 100 mg / mL using ultrapure water; (2.2.2)Mix the amino-carbon nitride polymer solution obtained in step (2.1) with the Sulfo-SMCC solution in a volume ratio of 20:1 and stir at room temperature for 2 h to obtain an amino-carbon nitride polymer-SMCC copolymer; (2.2.3)Then, by centrifugal washing, remove the supernatant to wash away the excess Sulfo-SMCC molecules, and repeat 3 - 6 times; (2.2.4)Redisperse the precipitate obtained in step (2.2.3) in PBS buffer to obtain an amino-carbon nitride polymer-SMCC copolymer solution.

5. The preparation method of the reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer according to claim 3, characterized in that, The specific preparation of the thiolated OA aptamer solution and the thiolated ssDNA solution in step (2.2) is as follows: Mix a 10 mM TCEP solution, a 100 μM OA aptamer solution / 100 μM ssDNA solution, and ddH2O in a volume ratio of 1:1:8 to activate the thiol groups. At room temperature, this reduction reaction lasts for 30 - 60 min to obtain a thiolated OA aptamer solution and a thiolated ssDNA solution.

6. The preparation method of the reverse amplification electrochemical biosensor based on functionalized carbonitride polymer according to claim 3, characterized in that, Step (3) is specifically as follows: (3.1)Sonicate the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution obtained in (2.3) for 30 min to promote the dispersion of the nanosheets; (3.2)Prepare a Th solution with PBS at a concentration of 5 mg / mL - 10 mg / mL; (3.3) Uniformly mix the thiolated OA aptamer-functionalized amino-carbon nitride polymer solution in the dispersed state obtained in (3.1) with the Th solution prepared in (3.2), and stir at room temperature for 48 h - 72 h; (3.4) Centrifuge the mixed solution obtained in (3.3), wash thoroughly to remove excess Th particles, and obtain Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer, which is dissolved in ultrapure water.

7. The preparation method of the reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer according to claim 6, wherein, (2.2.3) The centrifugation and washing speed is 8000 revolutions per minute, and the time is 5 - 10 minutes; in step (2.3), the centrifugation and washing speed is 6000 revolutions per minute, and the time is 3 - 5 minutes; in step (3.4), the centrifugation and washing speed is 12000 revolutions per minute, and the time is 3 - 5 minutes.

8. The preparation method of the reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer according to claim 1, characterized in that, (4) The preparation of the functionalized working electrode specifically includes: (4.1) Polish the glassy carbon electrode successively with alumina powder with a particle size of 1.5 µm and 0.5 µm; (4.2) In a 5 mM - 10 mM K4Fe(CN)6 / K3Fe(CN)6 solution, scan the polished electrode obtained in (4.1) by cyclic voltammetry to obtain the voltage difference ΔP between the cathode and anode in the cyclic voltammogram; (4.3) Until ΔP is less than or equal to 80 mV, otherwise repeat steps (3.1) to (3.2); (4.4) Drop the Th-modified thiolated OA aptamer-functionalized amino-carbon nitride polymer solution onto the surface of the glassy carbon electrode, and place it in a dust-free condition for 12 - 16 h to obtain the functionalized working electrode. (9) The reverse amplification electrochemical biosensor based on the functionalized carbon nitride polymer is prepared by using the preparation method of the reverse amplification electrochemical biosensor based on the functionalized carbon nitride polymer according to any one of claims 1 - 8.

10. Use of the reverse amplification electrochemical biosensor based on functionalized carbon nitride polymer as claimed in claim 9 in the detection of OA, characterized in that, (9) It includes the following steps: (5.1) Place the three-electrode system in a 5 mM - 10 mM K4Fe(CN)6 / K3Fe(CN)6 solution, and use an electrochemical workstation to perform DPV detection on the surface of the functionalized working electrode to obtain the initial current change information; (5.2) Immerse the functionalized working electrode measured in (5.1) in the target analyte OA solution and mix and react for 1 h - 2 h; (5.3) Perform DPV testing on the functionalized working electrode after the reaction in (5.2) to obtain the current change information caused by OA; (5.4) Insert the functionalized working electrode combined with OA after the reaction in (5.3) into the thiolated ssDNA-functionalized amino-carbon nitride polymer solution, and wrap it with a sealing film to prevent the solution from evaporating; (5.5) After the mixed system in (5.4) stands and reacts for 1 h - 3 h, perform DPV testing to achieve quantitative detection of OA through reverse amplification.

Images