A myocardial ischemic injury marker capg and application thereof

Abstract

The application discloses a myocardial ischemic injury marker CAPG and application thereof. The application finds that down-regulation of CAPG expression can improve myocardial cell apoptosis and heart function after myocardial infarction by injecting AAV9-shCAPG virus into the tail vein of a mouse model of myocardial infarction. The application first discloses a new use of macrophage capping protein (CAPG) as a therapeutic target and a diagnostic target of myocardial ischemic injury, provides a new drug action target for diagnosis and treatment of myocardial ischemic injury, and has very important clinical transformation value. As a diagnostic marker of myocardial ischemic injury, CAPG can be conveniently detected by using an existing enzyme-linked immunosorbent assay kit, has the advantage of rapid detection, and can be conveniently detected by only extracting a small amount of peripheral venous blood of a patient.

Description

TECHNICAL FIELD

[0001] The application relates to a myocardial ischemic injury marker CAPG and application thereof, and belongs to the technical field of biological medicine. BACKGROUND

[0002] Research finds that macrophage capping protein (CAPG) is widely involved in biological activities such as cell signal transduction, phagocytosis, vesicle movement and cell movement, and CAPG is first discovered in rabbit alveolar macrophages. Existing research shows that CAPG is involved in the regulation of actin, the receptor-mediated wrinkling in macrophages, phagocytosis, and eukaryotic cell mitosis, and in tumor cells, the biological activities such as cell signal transduction, phagocytosis, vesicle movement and cell movement involved in CAPG are often out of normal regulation, so CAPG is considered to be a potential tumor formation promoting factor and an anti-tumor drug action target.

[0003] In addition, as a carcinogenic gene, CAPG is overexpressed in gastric cancer, hepatocellular carcinoma, colorectal cancer, lung cancer, prostate cancer, glioblastoma and ovarian cancer, and the overexpression is related to tumor metastasis and invasion. Research by Yun et al. finds that the messenger RNA and protein levels of CAPG in human brain glioma tissue are significantly increased, and cell proliferation experiments on U87 and U251 human brain glioma cell lines with overexpression of CAPG and U87 and U251 human brain glioma cell lines with knockout of CAPG show that the U87 and U251 human brain glioma cell lines with overexpression of CAPG have a faster proliferation rate, while the U87 and U251 human brain glioma cell lines with knockout of CAPG stop proliferating or proliferate slowly, indicating that high expression of CAPG can be used as an independent prognostic factor for poor prognosis of human brain glioma. Research by Bahrami et al. finds that high expression of CAPG is negatively correlated with the survival period of bladder cancer patients, and CAPG is expressed in both normal tissues adjacent to cancer and bladder cancer tissues and is overexpressed in bladder cancer tissues, so it is inferred that the overexpression of CAPG is related to the poor prognosis of bladder cancer. CAPG plays an important role in the mitosis of eukaryotic cells, can affect the DNA replication process, and has the effect of promoting cell proliferation, so CAPG may enhance the invasiveness of cancer cells in the development process of bladder cancer and promote the metastasis of cancer cells, and may become a new prognostic biomarker for bladder cancer.

[0004] However, the role of CAPG in myocardial ischemic injury has not been reported at present. SUMMARY

[0005] The purpose of the present application is to provide a new use of CAPG in myocardial ischemic injury and provide a new treatment and diagnosis target for myocardial ischemic injury.

[0006] In order to achieve the above object, the application provides application of a reagent or kit for detecting CAPG expression in preparation of a reagent or kit for detecting myocardial ischemic injury.

[0007] The application also provides application of a reagent for inhibiting expression and / or activity of CAPG in preparation of a drug for treating myocardial ischemic injury.

[0008] Preferably, the reagent comprises at least one of RNAi, microRNA, shRNA, siRNA, adeno-associated virus vector, antibody of CAPG protein and inhibitor of activity of CAPG protein which specifically interfere with expression of the CAPG gene.

[0009] Preferably, the reagent is an adeno-associated virus vector which specifically interferes with expression of the CAPG gene, and the adeno-associated virus vector is an AAV9 virus comprising a gene sequence as shown in SEQ ID NO: 1.

[0010] Preferably, the reagent is siRNA which specifically interferes with expression of the CAPG gene, and the sequence of the siRNA is as shown in SEQ ID NO: 2-3.

[0011] The application also provides a drug for treating myocardial ischemic injury, comprising a medically acceptable carrier and an effective amount of an active ingredient, and the active ingredient comprises a reagent for inhibiting expression and / or activity of CAPG.

[0012] Preferably, the reagent comprises at least one of RNAi, microRNA, shRNA, siRNA, adeno-associated virus vector, antibody of CAPG protein and inhibitor of activity of CAPG protein which specifically interfere with expression of the CAPG gene.

[0013] Preferably, the reagent is an adeno-associated virus vector which specifically interferes with expression of the CAPG gene, and the adeno-associated virus vector is an AAV9 virus comprising a gene sequence as shown in SEQ ID NO: 1.

[0014] Preferably, the reagent is siRNA which specifically interferes with expression of the CAPG gene, and the sequence of the siRNA is as shown in SEQ ID NO: 2-3.

[0015] Compared with the prior art, the application has the following beneficial effects:

[0016] 1.The present application discloses that down-regulating the expression of CAPG can improve myocardial cell apoptosis and heart function after myocardial infarction by injecting AAV9-shCAPG virus into the tail vein of a mouse model of myocardial infarction, and for the first time discloses a new use of macrophage capping protein (CAPG) as a therapeutic target and diagnostic target for myocardial ischemic injury, providing a new drug action target for the diagnosis and treatment of myocardial ischemic injury, and having very important clinical transformation value.

[0017] 2.CAPG as a diagnostic marker for myocardial ischemic injury can be conveniently detected by using existing enzyme-linked immunosorbent assay kits, has the advantage of rapid detection, and only a small amount of peripheral venous blood of the patient needs to be taken to achieve convenient detection. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is shown that the expression of CAPG protein in the serum of myocardial infarction patients is significantly up-regulated compared with the healthy control group;

[0019] Figure 2 It is shown that the expression of CAPG protein in the serum of myocardial infarction mice at different time points compared with the sham operation control group;

[0020] Figure 3 It is shown that the results of echocardiography of mice 7 days after myocardial infarction are shown;

[0021] Figure 4 It is shown that the results of Masson staining and myocardial infarction area statistics of mice 7 days after myocardial infarction are shown;

[0022] Figure 5 It is shown that the results of Tunel staining of mice 3 days after myocardial infarction are shown;

[0023] Figure 6 It is shown that the effect of interfering CAPG on myocardial cell apoptosis is detected by detecting the expression of myocardial cell apoptosis protein under 12-hour hypoxia induction of primary myocardial cells of suckling mice;

[0024] Figure 7 It is shown that the effect of interfering CAPG on myocardial cell apoptosis is detected by Tunel staining under 12-hour hypoxia induction of primary myocardial cells of suckling mice;

[0025] Figure 8 It is shown that the expression of CAPG after 12-hour hypoxia treatment of primary myocardial cells of suckling mice and fibroblasts; con: normoxic control group; hypo: hypoxic treatment group;

[0026] Figure 9The effect of CAPG secreted by fibroblasts on myocardial cell apoptosis was analyzed by detecting myocardial cell apoptosis protein expression; Control (CON): normoxic myocardial cell control group; DMEM: myocardial cell group treated with DMEM medium for 12 h of hypoxia; siNC supernatant group: myocardial cell group treated with supernatant of si-scram (siNC) transfected fibroblasts for 12 h of hypoxia; siCAPG supernatant group: myocardial cell group treated with supernatant of fibroblasts transfected with si-CAPG for 12 h of hypoxia.

[0027] Figure 10 The effect of CAPG secreted by fibroblasts on myocardial cell apoptosis was analyzed by detecting myocardial cell apoptosis protein expression; Control (CON): normoxic myocardial cell control group; DMEM: myocardial cell group treated with DMEM medium for 12 h of hypoxia; siNC supernatant group: myocardial cell group treated with supernatant of si-scram (siNC) transfected fibroblasts for 12 h of hypoxia; siCAPG supernatant group: myocardial cell group treated with supernatant of fibroblasts transfected with si-CAPG for 12 h of hypoxia. DETAILED DESCRIPTION

[0028] In order to make the present application more apparent, the preferred embodiments are described in detail below with reference to the accompanying drawings.

[0029] EMBODIMENT

[0030] I. Experimental methods and reagents

[0031] 1. Western Blot experiment

[0032] (1) Prepare SDS polyacrylamide gel: Place a clean glass plate in the gel preparation frame, add a small amount of ddH2O, check for leaks, prepare 10% concentration separation gel, immediately press the liquid surface with anhydrous ethanol after pouring the gel, polymerize at room temperature, after the separation gel is completely polymerized, pour out the cover layer liquid, gently clean with ddH2O, prepare 5% concentrated gel, mix well and pour immediately, then insert the comb, making sure there are no air bubbles.

[0033] (2) Sample loading: Gently pull out the comb from the solidified concentrated gel, and use a micropipette to add the protein sample to the sample well.

[0034] (3) Electrophoresis: Concentrated gel constant voltage 60 volts, separation gel constant voltage 90 volts, until bromophenol blue reaches the bottom of the gel

[0035] (4) Transfer: Soak the gel in transfer buffer for 10 minutes, cut the PVDF membrane to appropriate size, activate in methanol for 10 seconds, rinse in ddH20 for 5 minutes, and soak in transfer buffer. Soak the transfer filter paper and sponge in transfer buffer, and place the sponge a, filter paper a, gel, PVDF membrane, filter paper b, and sponge b in the wet transfer cassette in order, making sure to remove air bubbles. Place the wet transfer cassette in the transfer tank, with the gel close to the negative electrode,

[0036] (5) Blocking: After the transfer, place the PVDF membrane containing the protein in 5% skim milk, and block at room temperature for 60 minutes on a shaker.

[0037] (6) Incubate the CAPG primary antibody, dilute the primary antibody 1:1000 according to the antibody instructions, and incubate at 4 degrees overnight on a shaker.

[0038] (7) After the primary antibody incubation, rinse with TBST for 3 times, each for 7-10 minutes.

[0039] (8) Incubate the secondary antibody, add HRP-labeled secondary antibody (1:5000 dilution), and incubate at room temperature for 60 minutes on a shaker. After the incubation, rinse with TBST for 3 times, each for 3-5 minutes.

[0040] (9) Development: Remove the water from the PVDF surface, add an appropriate amount of developing solution, and develop in the imaging system to detect the expression of the target protein.

[0041] 2. Establishment of a mouse myocardial infarction model

[0042] Select 8-10-week-old male mice and divide them into four groups: A: shNC+sham operation; B: shCAPG+sham operation; C: shNC+MI operation; D: shCAPG+MI operation. The specific experimental methods are as follows:

[0043] (1) Remove the hair on the chest of the mouse, and perform gas anesthesia with isoflurane. After the mouse shows signs of muscle weakness and flaccid paralysis, fix the mouse on the mouse plate, connect the electrocardiogram, and detect whether the preoperative electrocardiogram is normal.

[0044] (2) After local disinfection of the mouse's chest skin with 75% alcohol, separate the chest wall layer by layer to clearly expose the intercostal space, gently open the second and third or third and fourth intercostal spaces with mosquito forceps, and squeeze out the heart.

[0045] (3) Take the left atrial appendage as the anatomical landmark, and insert the needle 1-2 mm below the atrial appendage. Ligate the left anterior descending branch with 6-0 suture thread from right to left. Detect ECG and heart changes during the operation. ECG shows characteristic ST segment elevation. The myocardium below the ligation line appears pale and the activity is reduced, indicating successful ligation. Tie a surgical knot, cut the ligation line, let the heart automatically rebound into the chest cavity, gently press the chest wall, expel the gas in the chest cavity, and suture the chest wall wound. The sham group only threads without ligation.

[0046] (4) After the operation, normal diet, water, analgesia, and anti-infection treatment.

[0047] 3. Mouse heart ultrasound detection

[0048] Respectively before and 7 days after the heart infarction operation, the heart ultrasound detection was performed:

[0049] (1) Put the mouse into the anesthesia tank and perform gas anesthesia with isoflurane. When the mouse shows muscle weakness and other light anesthesia states, transfer the mouse to a constant temperature mouse plate and fix it. Change to face mask anesthesia. Adjust the gas anesthesia drug concentration to control and maintain the heart rate at 500-600 times / min.

[0050] (2) Remove the mouse's chest hair with depilatory cream.

[0051] (3) Apply an appropriate amount of ultrasound gel to the precordial area. When the mouse's heart rate is 500-600 times / min, use the VisualSonics Vevo2100 ultrasound instrument RMV70730MHz probe to collect the parasternal short-axis and long-axis sections on the mouse's chest wall. When detecting the long-axis section, detect the papillary muscle level or mitral chordae level.

[0052] (4) Measure the heart rate and record the B-mode and M-mode (at the papillary muscle level or mitral chordae level) ultrasound images.

[0053] For different individuals, the same parameters are set for the ultrasound instrument, and each measurement index is selected for 10 consecutive heart cycles and then averaged.

[0054] The measurement indexes include: left ventricular ejection fraction (EF%), fractional shortening (FS), and heart rate (HR).

[0055] 4. Adeno-associated virus AAV9-shCAPG

[0056] Adeno-associated virus AAV9-shCAPG and negative control virus AAV9-shNC were prepared by Hanheng Biotechnology Co., Ltd. The specific sequence of AAV9-shCAPG virus is: TCCTACCTAGTGCTTCACAAT (SEQ ID NO: 1). The titer of AAV9-shCAPG virus and negative control virus is 1x1012 (Vg) / mL.

[0057] 5. Small interfering RNA (si-CAPG):

[0058] The small interfering RNA (si-CAPG, Capg-rat-1053) used to interfere with capping proteins and its negative control si-NC (si-scram) were prepared by Beijing Qingke Biotechnology Co., Ltd. The sequence of si-CAPG is as follows:

[0059] Justice chain sequence: GCAGCCCUGUAUAAGGUCUTT (SEQ ID NO: 2);

[0060] Antisense sequence: AGACCUUAUACAGGGCUGCTT (SEQ ID NO: 3);

[0061] II. Experimental Results

[0062] 1. In serum samples collected from patients with myocardial infarction and healthy subjects at Zhongshan Hospital affiliated with Fudan University, Western blotting first revealed elevated expression of cap protein (CAPG) in macrophages of patients with acute myocardial infarction. Figure 1 As shown, venous blood was collected from mice on days 3, 7, 14, and 28 after myocardial infarction, and serum was separated. The expression of CAPG was found to be elevated after myocardial infarction, with significant increases observed on days 7 and 14 post-infarction. Figure 2 As shown, CAPG is a secreted protein that may be involved in the pathophysiological process of myocardial infarction in clinical patients and may provide some indication of patient prognosis.

[0063] 2. After intravenous injection of AAV9-shCAPG virus into C57 mice, compared with the control virus-treated myocardial infarction group, cardiac function was assessed 7 days after the infarction. The results showed improvement in left ventricular ejection fraction (EF%) and fractional shortening (FS). Figure 3 As shown; mouse heart sections were stained with Masson staining to detect fibrosis, and Evens blue / TTC staining was used to detect myocardial infarction area. The results showed that compared with the control group, the myocardial infarction area was significantly reduced, as shown in the figure. Figure 4 As shown; immunofluorescence of frozen tissue sections revealed a decrease in the percentage of TUNEL-stained cells after shCAPG intervention, indicating reduced cardiomyocyte apoptosis after myocardial infarction, as... Figure 5 As shown.

[0064] 3. Isolation of neonatal rat primary cardiomyocytes, and treatment with CAPG siRNA. Compared with the hypoxia control group, the hypoxia-induced expression of the apoptosis protein cleaved-caspase3 and bax decreased in the 12-hour hypoxia group, as shown in FIG. 3; in addition, Tunel staining showed that si-CAPG can reduce the hypoxia-induced apoptosis of cardiomyocytes, as shown in FIG. 4. Figure 6 Figure 7

[0065] 4. In the experiment, the expression of CAPG in the supernatant secreted by neonatal rat primary cardiomyocytes and fibroblasts after 12 hours of hypoxia treatment was detected, and it was found that CAPG was expressed more highly in the supernatant secreted by hypoxic fibroblasts, as shown in FIG. 5; in addition, the supernatant of hypoxic fibroblasts can induce more expression of apoptosis proteins in cardiomyocytes compared with the supernatant of normoxic fibroblasts, indicating that the CAPG secreted by fibroblasts can aggravate the apoptosis of cardiomyocytes, as shown in FIG. 6; Tunel staining also verified this result, as shown in FIG. 7. Figure 8 Figure 9 Figure 10

[0066] The above results show that the expression of CAPG increases after myocardial infarction, and down-regulating the expression of CAPG can improve the apoptosis of cardiomyocytes and heart function after myocardial infarction.

[0067] According to the results of the present embodiment, CAPG can be used as a diagnostic marker for myocardial ischemic injury, and the specific application method is as follows: peripheral venous blood of a myocardial infarction patient is extracted, and serum is separated by ultracentrifugation; the expression of CAPG protein in the serum is detected by ELISA method, and the absorbance is detected by an enzyme marker; the expression of CAPG in the peripheral blood of each patient is determined, and the degree of increase in the expression of CAPG in the myocardial infarction patient is analyzed according to the normal distribution of normal people. In addition, CAPG can be used as a molecular target for treating myocardial ischemic injury.

[0068] The above embodiments are only preferred embodiments of the present application, and are not intended to limit the present application in any form and in substance. It should be noted that, for those skilled in the art, without departing from the present application, a number of improvements and supplements can also be made, and these improvements and supplements should also be considered as the protection scope of the present application.​​​​​

Claims

1. Use of an agent that inhibits the expression and / or activity of CAPG for the manufacture of a medicament for the treatment of myocardial ischemic injury, characterized in that, The reagent is an adeno-associated virus vector specifically interfering with the expression of the CAPG gene, and the adeno-associated virus vector is an AAV9 virus containing a gene sequence as shown in SEQ ID NO:

1. Alternatively, the reagent is an siRNA specifically interfering with the expression of the CAPG gene, and the sequence of the siRNA is as shown in SEQ ID NO: 2-3.

Images