A Staphylococcus hominis SHoFu616 strain, a screening method thereof, and an application for preparing a drug for preventing and treating atopic dermatitis

By screening and identifying the SHoFu616 strain of Staphylococcus human, it was prepared into antibacterial products for the treatment of atopic dermatitis, which solved the problem of poor efficacy of existing drugs and achieved a significant improvement in the symptoms of dermatitis without side effects.

CN116333923BActive Publication Date: 2025-07-29SHANGHAI FIRST PEOPLES HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310143456.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-21
Publication Date
2025-07-29
Estimated Expiration
2043-02-21

AI Technical Summary

Technical Problem

The existing drugs for treating atopic dermatitis have high recurrence rates, large side effects, long courses and high costs, and lack effective probiotic treatment methods.

Method used

A strain of Staphylococcus aureus SHoFu616, which has a significant antibacterial effect on Staphylococcus aureus, was selected, and was confirmed to be Staphylococcus hominis through physiological and biochemical and molecular identification, and was prepared as antibacterial and/or bactericidal products for the treatment of atopic dermatitis.

Benefits of technology

The SHoFu616 strain of human Staphylococcus significantly improved the symptoms of atopic dermatitis, could significantly inhibit the growth of Staphylococcus aureus, reduce the symptoms of dermatitis, and have no obvious side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116333923B_ABST
    Figure CN116333923B_ABST
Patent Text Reader

Abstract

The present invention discloses a Staphylococcus hominis SHoFu616 strain, a screening method thereof, and an application for preparing drugs for preventing and treating atopic dermatitis. The preservation number of the Staphylococcus hominis SHoFu616 strain is CGMCC No. 26279, and the screening method thereof comprises the following steps: Step 1: Separating, purifying and culturing the collected samples to obtain a number of monoclonal colonies; Step 2: Inoculating the number of monoclonal colonies onto a plate, screening for antibacterial ability, picking out antagonistic monoclonal colonies with antibacterial ability, and performing subculture preservation; Step 3: Identifying the subculture-preserved antagonistic monoclonal colonies to finally screen out the Staphylococcus hominis SHoFu616 strain. Through identification and analysis, this strain belongs to Staphylococcus hominis, and this strain can be used to prepare drugs for antagonizing pathogenic bacteria such as Staphylococcus aureus and drugs for preventing and treating skin inflammatory diseases such as atopic dermatitis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a Staphylococcus hominis SHoFu616 strain, a screening method thereof, and an application for preparing a drug for preventing and treating atopic dermatitis. Background Art

[0002] Atopic dermatitis is a chronic relapsing skin disease that affects newborns or children and may persist into adulthood. Although traditional conventional means for improving or treating atopic dermatitis, such as glucocorticoids, immunosuppressants, antihistamine preparations, and antibacterial drugs, can relieve the symptoms, these treatment methods are all drug-based treatments. For example, the humanized monoclonal antibody - dupilumab that can interfere with the IL-4R signaling pathway targeting the IL-4 receptor alpha chain has a high recurrence rate and non-curative nature in treatment, and also has high treatment costs, a long treatment course, and a narrow audience.

[0003] Currently, there are different treatments for treating or preventing atopic dermatitis, but effective treatment drugs and treatment methods have not been found. Some drug-based treatments are known, but short-term administration of these drugs used for treatment can also produce tolerance, and long-term administration can cause serious side effects. Summary of the Invention

[0004] The purpose of the present invention is to provide a novel treatment method capable of improving or treating atopic dermatitis.

[0005] To achieve the above purpose, the present invention provides a Staphylococcus hominis SHoFu616 strain, and its preservation number is CGMCC No. 26279.

[0006] The present invention also provides a screening method for a Staphylococcus hominis SHoFu616 strain, which is characterized by comprising the following steps:

[0007] Step 1: Separating, purifying and culturing the collected samples to obtain a number of monoclonal colonies;

[0008] Step 2: Inoculating the number of monoclonal colonies onto a plate, performing an antibacterial ability screening, picking out antagonistic monoclonal colonies with antibacterial ability, and carrying out subculture preservation;

[0009] Step 3: Identifying the subculture-preserved antagonistic monoclonal colonies to finally screen out the Staphylococcus hominis SHoFu616 strain.

[0010] Preferably, Step 1 includes: coating the sample on a Columbia blood agar plate, inoculating with a sterile inoculation loop to obtain a coated plate, and placing the coated plate in an incubator at 37°C and 5% CO2 for culturing;

[0011] After the cultivation is completed, pick strains that are milky white, non-hemolytic, and 1 mm to 1.5 mm in diameter on the Columbia blood agar plate for isolation and purification cultivation. After 48 hours of cultivation, pick monoclonal colonies and store them frozen for later use.

[0012] Preferably, the formula of the Columbia blood agar plate includes: 18 - 23 g of special peptone, 0.5 - 1 g of starch, 3 - 5 g of sodium chloride, 7 - 10 g of agar, 50 - 70 mL of defibrinated sheep blood, and 800 - 1000 mL of distilled water.

[0013] Preferably, step 2 includes: separately taking several monoclonal colonies obtained in step 1, respectively performing activation cultivation to obtain different bacterial suspensions, dipping Staphylococcus aureus, evenly coating it on the MH plate, after standing, using a pipette to aspirate 3 μL of the bacterial suspension and respectively drop it on the MH plate coated with Staphylococcus aureus, placing the MH plate coated with the bacterial suspension in an incubator at 37°C and 5% CO₂ for overnight cultivation, performing antibacterial ability screening, and picking the antagonistic monoclonal colonies of Staphylococcus aureus.

[0014] Preferably, the formula of the MH plate includes: 1 - 2 g / L of beef powder, 1 - 1.5 g / L of soluble starch, 13 - 17.5 g / L of acid hydrolysate casein, and 10 - 15 g of agar.

[0015] The present invention also provides an application of the Staphylococcus hominis SHoFu616 strain as described above in the preparation of antibacterial and / or bactericidal products.

[0016] Preferably, the application of the Staphylococcus hominis SHoFu616 strain as an active ingredient in the preparation of drugs for treating atopic dermatitis.

[0017] The present invention also provides a drug, which comprises the Staphylococcus hominis SHoFu616 strain as described above and a pharmaceutically acceptable carrier.

[0018] Preferably, the dosage form of the drug is any one of solution, powder, tablet, capsule, suspension, and emulsion.

[0019] The beneficial effects of the present invention:

[0020] (1) The present invention screened a new strain with significant antibacterial effect against Staphylococcus aureus, named SHoFu616. Through physiological and biochemical reactions, 16S rRNA gene sequencing, and mass spectrometry identification, this new strain was identified as Staphylococcus hominis.

[0021] (2) The Staphylococcus hominis SHoFu616 strain of the present invention has significant probiotic effects and can significantly improve the symptoms of atopic dermatitis caused by MC903. The Staphylococcus hominis SHoFu616 strain can be used as an active ingredient to prepare a drug for treating atopic dermatitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the growth state of the new strain screened in the present invention on Columbia blood agar plate.

[0023] Figure 2 This is the colony effect diagram of the new strain screened in the present invention inhibiting the growth of Staphylococcus aureus.

[0024] Figure 3 This is the colony counting result diagram of the antibacterial effect of Staphylococcus hominis SHoFu616 on Staphylococcus aureus when co-cultured with different ratios of Staphylococcus hominis SHoFu616 and Staphylococcus aureus USA300 in the present invention.

[0025] Figure 4 This is the phylogenetic tree analysis diagram of Staphylococcus hominis SHoFu616 of the present invention and the reported Staphylococcus hominis.

[0026] Figure 5 This is the schematic diagram of drug administration for the mouse atopic dermatitis model constructed according to different days.

[0027] Figure 6 This is the statistical chart of the thickness of the mouse ear on the 7th day of culture.

[0028] Figure 7 This is the statistical chart of the thickness of the mouse ear on the 14th day of culture.

[0029] Figure 8 This is the statistical comparison chart of the thickness of the ears of the treatment group and the control group mice cultured for different days.

[0030] Figure 9 This is the representative photo of the inflammation of the mouse ear on the 14th day of culture.

[0031] Figure 10 This is the pathological section staining result diagram of Staphylococcus hominis SHoFu616 of the present invention on atopic dermatitis caused by MC903.

[0032] Figure 11 This is the comparison diagram of the effects of MC903, MC903+SHoFu616, heat-inactivated group, culture supernatant group, and TSB prevention group on atopic dermatitis respectively.

[0033] Figure 12Schematic diagram of the ability of Staphylococcus hominis SHoFu616 of the present invention to improve the skin transcriptome response caused by MC903. Detailed implementation mode

[0034] The technical solution of the present invention will be further described below in conjunction with the drawings and embodiments.

[0035] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0036] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0037] There are reports showing that skin commensal bacteria can prevent the colonization of Staphylococcus aureus, and the transplantation of skin flora from healthy people can significantly slow down the symptoms of atopic dermatitis. Skin barrier dysfunction and the colonization of Staphylococcus aureus are key factors in the occurrence and development of atopic dermatitis. The clearance of Staphylococcus aureus and the restoration of the skin internal environment homeostasis regulated by normal skin commensal bacteria are the core of the treatment of atopic dermatitis. Probiotics used in cosmetics can balance the epidermal flora of the skin and repair the skin barrier. Topical application of probiotics can treat atopic dermatitis and promote the repair of the skin barrier. There are also studies finding that probiotics can prevent and treat various inflammatory diseases by regulating the phagocytic ability of macrophages and enhance the immunity of the skin. However, there is currently a lack of probiotics specifically targeting the treatment of atopic dermatitis. Therefore, based on the screening of new strains, the present invention aims to develop products for the treatment of atopic dermatitis using microecological technology, so as to solve the defect of poor effect of existing drug-based treatments for atopic dermatitis.

[0038] 1. Experimental culture medium:

[0039] Columbia blood agar plate: Special peptone 18 - 23 g, starch 0.5 - 1 g, sodium chloride 3 - 5 g, agar 7 - 10 g, defibrinated sheep blood 50 - 70 mL, distilled water 800 - 1000 mL. Adjust the pH to 7.3 ± 0.2.

[0040] MH plate: Beef powder 1 - 2 g / L, soluble starch 1 - 1.5 g / L, acid hydrolyzed casein 13 - 17.5 g / L, agar 10 - 15 g. Adjust the pH to 7.4 ± 0.2.

[0041] MH liquid medium: Beef powder 1 - 2 g / L, soluble starch 1 - 1.5 g / L, acid hydrolyzed casein 13 - 17.5 g / L. Adjust the pH to 7.4 ± 0.2.

[0042] MH slant medium: Beef powder 1 - 2 g / L, soluble starch 1 - 1.5 g / L, acid hydrolyzed casein 13 - 17.5 g / L, agar 10 - 15 g. Adjust the pH to 7.4 ± 0.2.

[0043] Principle of Columbia blood agar plate test: Casein tryptic digest, heart infusion tryptic digest, meat peptone, yeast extract, soluble starch provide carbon and nitrogen sources, vitamins and growth factors; sheep blood is a good nutrient for bacterial growth and reproduction. Adding blood to the basal medium at 45 - 50 °C can preserve some heat-labile growth factors in the blood while the blood cells are not damaged. Some bacteria can produce hemolysin during growth, causing the rupture and lysis of red blood cells. When growing on the Columbia plate, a clear or semi-clear hemolysis ring can be observed around the colonies. In the present invention, strains that do not hemolyze (i.e., do not produce hemolysin) are picked for isolation and purification culture.

[0044] 2. Experimental methods and results:

[0045] 2.1 Isolation, purification and culture of strains

[0046] Dip a cotton swab in sterile normal saline, and use the wetted cotton swab to scrape clockwise on the surface of a healthy human body three times, then put it into a sterile tube; smear the cotton swab with the collected sample densely on the Columbia blood agar plate, and use a sterile inoculation loop to streak inoculate in four areas to obtain a spread plate. Place the spread plate in an incubator at 37 °C with 5% CO2 for 48 h;

[0047] As Figure 1 shown, after the culture is completed, pick milky white, non-hemolytic, monoclonal colonies with a diameter of 1 mm - 1.5 mm on the Columbia blood agar plate for isolation and purification culture. After culturing for 48 h, pick several monoclonal colonies and store them frozen in the MH slant medium for later use.

[0048] 2.2 Bacteriostatic experiment of strains

[0049] Take an MH slant medium stored in the refrigerator for activation of monoclonal colonies. Scrape a little bacterial plaque from the MH slant medium into the MH liquid medium, and shake and culture it in a shaker at 37 °C and 160 rpm. After activation, several bottles of different bacterial suspensions are obtained. Dip a cotton swab in a little Staphylococcus aureus with an OD of 0.05 and smear it evenly on the MH plate. After standing at room temperature for 30 min, respectively use a pipette to aspirate 3 μL of the above different bacterial suspensions and drop them on the MH plate coated with Staphylococcus aureus. Place the different MH plates coated with different bacterial suspensions in an incubator at 37 °C with 5% CO2 and culture overnight, and observe the bacteriostatic effect of the newly screened strains on Staphylococcus aureus. As Figure 2 shown, a bacteriostatic ring with a diameter of about 2 - 5 mm against Staphylococcus aureus is formed around the bacterial plaque of the new strain. It shows that the newly screened strain (hereinafter simply referred to as strain SHoFu) has a good bacteriostatic effect on Staphylococcus aureus.

[0050] The EC50 is the concentration for 50% of maximal effect. It refers to the concentration that can cause 50% of the maximal effect. The strain SHoFu was co-cultured with Staphylococcus aureus USA300. After overnight culture, it was diluted at a certain appropriate ratio, and then colony counting of Staphylococcus aureus USA300 and the strain SHoFu was performed on a Staphylococcus aureus chromogenic plate. As Figure 3 shown, the abscissa is the mixing ratio of Staphylococcus aureus USA300 and the strain SHoFu, and the ordinate is the number of colonies. When Staphylococcus aureus USA300: the strain SHoFu = 10, the strain SHoFu can significantly inhibit the growth of Staphylococcus aureus USA300.

[0051] 2.3 Identification of the strain

[0052] Using the 2Compact GP identification card to conduct physiological and biochemical identification of the strain SHoFu, and carry out molecular-level identification of the strain SHoFu. The 16S rRNA gene of the strain SHoFu was extracted for amplification:

[0053] Forward primer 27F: AGAGTTTGATCCTGGCTCAG;

[0054] Reverse primer 1492R: GGTTACCTTGTTACGACTT.

[0055] PCR reaction program:

[0056] 95°C, 5 min, pre-denaturation,

[0057] Amplification was carried out for 30 cycles or less:

[0058] Denaturation: 95°C, 30 s;

[0059] Annealing: 55°C, 45 s;

[0060] Extension: 72°C, 2 min;

[0061] Final extension: 72°C, 10 min.

[0062] Among them, the physiological and biochemical results were: aerobic growth (+), coagulase negative (-), thermonuclease test negative (-), catalase positive (+), urease test positive (+), maltose decomposition test positive (+), raffinose test negative (-), oxidase negative (-), PYR test negative (-), hemolysin negative (-), β-glucosidase (-). The PCR product was sent to Personalbio Co., Ltd. for sequencing, and the obtained sequencing results were analyzed. As Figure 4As shown in the figure, an evolutionary tree was constructed for Staphylococcus using the Neighbor joining (NJ) method. It was found that strain SHoFu was in the same branch as the reported Staphylococcus hominis and had the highest homology. Therefore, based on the above colony morphology, combined with the results of physiological and biochemical reactions and molecular level identification, strain SHoFu belongs to Staphylococcus hominis (hereinafter referred to as Staphylococcus hominis SHoFu616).

[0063] 2.4 Preservation of the strain

[0064] Staphylococcus hominis SHoFu616 was deposited on December 26, 2022 at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms (abbreviated as CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postal code 100101), with the deposit number CGMCC No. 26279, and the taxonomic name is Staphylococcus hominis (hereinafter referred to as Staphylococcus hominis SHoFu616 CGMCC No. 26279).

[0065] 2.5 Experimental study on the mouse model of atopic dermatitis induced by MC903 prevented by Staphylococcus hominis SHoFu616 CGMCC No. 26279

[0066] Through experiments, it was found that the atopic dermatitis model induced by MC903 was more representative and the modeling time was relatively short. Therefore, an animal experiment was carried out using the atopic dermatitis mouse model induced by MC903. As Figure 5 shown, the red arrow indicates MC903, and the green arrow indicates the administration of Staphylococcus hominis SHoFu616 CGMCC No. 26279. A mouse model of atopic dermatitis was established by applying 20 μL of 1 nmol MC903 dissolved in methanol to the ears of mice for 5 consecutive days, with a 2-day interval, and then continuous administration for another 5 days. The experimental results are as Figure 6 、 Figure 7 、 Figure 8 、 Figure 9 、 Figure 10 shown, among which, Figure 6 represents the statistical thickness of the mouse ears on the 7th day, Figure 7 represents the statistical thickness of the mouse ears on the 14th day, Figure 8 represents the statistical thickness of the mouse ears on different days, Figure 9Representative photos showing the inflammation of mouse ears on the 14th day. Experiments have shown that Staphylococcus hominis SHoFu616 CGMCC No.26279 can significantly prevent the occurrence of atopic dermatitis. In the MC903-induced model group, obvious leukocyte infiltration was observed in the ear tissues of mice, while in the MC903+SHoFu616 group, the leukocyte infiltration was significantly reduced, indicating that it can significantly improve the inflammatory responses such as leukocyte infiltration caused by MC903.

[0067] In addition, to further clarify which components of Staphylococcus hominis SHoFu616 CGMCC No.26279 can inhibit the occurrence of atopic dermatitis, heat-inactivated Staphylococcus hominis SHoFu616 CGMCC No.26279 was prepared. As Figure 11 shown, MC903 represents the model group, MC903+SHoFu616 represents the SHoFu616 prevention group, MC903+HK represents the heat-inactivated SHoFu616 prevention group, MC903+Sup represents the prevention group with SHoFu616 culture supernatant, and MC903+TSB represents the control group with TSB prevention, where TSB refers to tryptic soy broth medium. Experiments have shown that heat-inactivated Staphylococcus hominis SHoFu616 CGMCC No.26279 can also significantly prevent atopic dermatitis caused by MC903. To further clarify the therapeutic effect of Staphylococcus hominis SHoFu616 CGMCC No.26279 on atopic dermatitis, after establishing an MC903-induced atopic mouse model, mice were treated with Staphylococcus hominis SHoFu616 CGMCC No.26279 respectively. Compared with the model group, the treatment group with Staphylococcus hominis SHoFu616 CGMCC No.26279 could accelerate the regression of atopic dermatitis inflammation; further comparison found that the therapeutic effect of heat-inactivated Staphylococcus hominis SHoFu616 CGMCC No.26279 was better than that of live SHoFu616, indicating that Staphylococcus hominis SHoFu616 CGMCC No.26279 can be used for the treatment of atopic dermatitis. It was also found that the bacterial cell components were involved in the prevention and treatment of atopic dermatitis.

[0068] 2.6 Transcription mechanism study

[0069] By measuring the transcriptome of mouse skin tissues and performing KEGG enrichment analysis, as Figure 12 shown, it was found that the prevention of atopic dermatitis by Staphylococcus hominis SHoFu616 CGMCC No.26279 is mainly related to the Chemokine signaling pathway and the Toll-like receptor signaling pathway.

[0070] The Staphylococcus hominis SHoFu616 of the present invention, with CGMCC No. 26279, can not only antagonize Staphylococcus aureus but also prevent and treat atopic dermatitis. Using it as an active ingredient to prepare antibacterial and / or bactericidal products, in particular, drugs for treating atopic dermatitis (such as skin inflammatory diseases). It can be understood that according to the present invention, a drug can also be prepared, the drug comprising Staphylococcus hominis SHoFu616 with CGMCC No. 26279 and a pharmaceutically acceptable carrier, and the dosage form of the drug is any one of solution, powder, tablet, capsule, suspension, and emulsion.

[0071] In the present invention, a strain SHoFu616 with significant antibacterial effect against Staphylococcus aureus was isolated from the surface of a healthy human body. Through physiological and biochemical identification and molecular level identification, it was found that this strain belongs to Staphylococcus hominis. It was preserved and named Staphylococcus hominis SHoFu616 with CGMCC No. 26279. In the mouse model experiment, it was found that it can improve atopic dermatitis caused by MC903. Using Staphylococcus hominis SHoFu616 with CGMCC No. 26279 as an active ingredient, drugs for treating atopic dermatitis can be prepared, which has great application value.

[0072] Although the content of the present invention has been introduced in detail through the above preferred embodiments, it should be recognized that the above description should not be considered as a limitation of the present invention. After those skilled in the art read the above content, various modifications and alternatives to the present invention will be obvious. Therefore, the protection scope of the present invention should be defined by the appended claims.

Claims

1. A Staphylococcus hominis strain ([ Staphylococcus hominis ]) SHoFu616 with a deposit number of CGMCC No. 26279. Staphylococcus hominis ​ 2. Use of Staphylococcus hominis ([ Staphylococcus hominis ) strain SHoFu616 as claimed in claim 1 in the preparation of a product for inhibiting and / or killing Staphylococcus aureus.

3. The application according to claim 2, characterized in that The application of the Staphylococcus hominis Staphylococcus hominis ) SHoFu616 strain as an active ingredient for the preparation of a medicament for preventing and treating atopic dermatitis.

4. A drug, characterized in that, The medicament comprises the Staphylococcus hominis strain ( Staphylococcus hominis ) SHoFu616 as claimed in claim 1 and a pharmaceutically acceptable carrier.

5. The medicament according to claim 4, characterized in that, The dosage form of the drug is any one of solution, powder, tablet, capsule, suspension and emulsion.

Citation Information

Patent Citations

  • Staphylococcus epidermidis and application thereof

    CN114058559A

  • Staphylococcus epidermidis with good antioxidant and anti-inflammatory effects and application thereof

    CN115637235A